SV40 T antigen Cell Immortalization Reagents
To order, check the corresponding box(es) on the right, and then click 'Add to Cart'.
| Cat. No. | Product Name | Qty. | Promo/% Off | Amount | ||
|---|---|---|---|---|---|---|
| Total: | $0.00 | |||||
| *Notes about Promo Codes: For NON-DISCOUNT promo codes (i.e. free items or shipping) please enter them during check out in the Notes/Promo Code field. To enter a DISCOUNT promo code enter it into the corresponding box in the 'Promo/% Off' column and then click 'Update' for the given product. If the code is valid for that product the discount percentage will display in place of the box and the amount will become the discounted total for that product(s). If the code is not valid it will remain in the box, please double check the expiry and spelling, and if you feel the code should still be accepted please contact us. | ||||||
Product Details
Description
Several methods exist for immortalizing mammalian cells in culture. One such method is to use viral genes, for example the simian virus 40 (SV40) T antigen, to induce immortalization. SV40 T (large T) antigen has been shown to be the simplest and most reliable agent for the immortalization of many different cell types in culture, and the mechanism has been well documented. For the most part, viral genes achieve immortalization by inactivating the tumor suppressor genes (p53, Rb, and others) that can induce a replicative senescent state in cells. Recent studies have also shown that SV40 T antigen can induce Telomerase activity in the infected cells.
The most recently discovered approach to cell immortalization is through the expression of Telomerase Reverse Transcriptase protein (TERT), particularly for cells that are most affected by telomere length (e.g. human). This protein is inactive in most somatic cells, but when hTERT is exogenously expressed, the cells are able to maintain sufficient telomere lengths to avoid replicative senescence. Analysis of several telomerase-immortalized cell lines has verified that the cells maintain a stable genotype and retain critical phenotypic markers.
However, over-expression of hTERT in some cell types, especially in primary epithelial cells, fails to induce cell immortalization and instead may induce cell death. Recent research has found that co-expression of hTERT catalytic subunit with either p53 or RB siRNA can immortalize human, primary, ovarian, epithelial cells, providing a more authentic normal cell model with well-defined genetic background (Yang G. et al., Carcinogenesis 2007; Yang G. et al., Oncogene 2007). Likewise, over expression of Ras or Myc T58A mutants has also been found to be able to immortalize some primary cell types (Sears R. et al., Genes & Dev. 2000).
With years of experience in cell immortalization, ABM has developed the most comprehensive cell immortalization products that comprise of plasmids and retroviral and adenoviral vectors for hTERT, p53 and RB, siRNAs, and SV40 T antigens. We also offer ready-to-use recombinant retroviruses and adenoviruses. All these tools will make your cell immortalization projects simpler and easier than ever before.
All our retroviral vectors are derived from Moloney Murine Leukemia Virus (MoMuLV).
The most recently discovered approach to cell immortalization is through the expression of Telomerase Reverse Transcriptase protein (TERT), particularly for cells that are most affected by telomere length (e.g. human). This protein is inactive in most somatic cells, but when hTERT is exogenously expressed, the cells are able to maintain sufficient telomere lengths to avoid replicative senescence. Analysis of several telomerase-immortalized cell lines has verified that the cells maintain a stable genotype and retain critical phenotypic markers.
However, over-expression of hTERT in some cell types, especially in primary epithelial cells, fails to induce cell immortalization and instead may induce cell death. Recent research has found that co-expression of hTERT catalytic subunit with either p53 or RB siRNA can immortalize human, primary, ovarian, epithelial cells, providing a more authentic normal cell model with well-defined genetic background (Yang G. et al., Carcinogenesis 2007; Yang G. et al., Oncogene 2007). Likewise, over expression of Ras or Myc T58A mutants has also been found to be able to immortalize some primary cell types (Sears R. et al., Genes & Dev. 2000).
With years of experience in cell immortalization, ABM has developed the most comprehensive cell immortalization products that comprise of plasmids and retroviral and adenoviral vectors for hTERT, p53 and RB, siRNAs, and SV40 T antigens. We also offer ready-to-use recombinant retroviruses and adenoviruses. All these tools will make your cell immortalization projects simpler and easier than ever before.
All our retroviral vectors are derived from Moloney Murine Leukemia Virus (MoMuLV).
Notes
NOT FOR RESALE without prior written consent of ABM. This product is distributed for laboratory research only.
Caution: Not for diagnostic use.
FAQs
Do the usual antibiotics (penicillin and streptomycin) or a fungicide (amphotericin B) usually being added to the primary epithelial cell cultures interfere with the immortalization process via SV40 large T antigen (lower somehow the transfection efficiency)? Must we remove the above compounds before immortalization with a retroviral or a lentiviral vector?
Normally all the routine antibiotics do not interfere the infection efficiency of lenti/retro viral vectors.
What do I use to check if my cells were successfully immortalized by the SV40 agent?
We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202.
Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below:
http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html
Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below:
http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html
What are the primers to use for SV40 identification?
SV40 Forward Primer Sequence
5’ GACTCAGGGCATGAAACAGG
SV40 Reverse Primer Sequence
5’ ACTGAGGGGCCTGAAATGA
5’ GACTCAGGGCATGAAACAGG
SV40 Reverse Primer Sequence
5’ ACTGAGGGGCCTGAAATGA

