Search By Gene Symbol or Accession Number



1600015I10Rik siRNA/shRNA/RNAi Lentivector (Mouse) (Target c)

 » 


1600015I10Rik siRNA/shRNA/RNAi Lentivector (Mouse) (Target c)

Order Online
Order by Contact
Cat.No.: i030689c
Quantity: 500 ng
Price: $85.00
Stock: 1-3 Weeks
Qty.:
Email: order@abmGood.com
Phone: 604-247-2416 (Local), 1-866-757-2414 (Toll free)
Fax: 604-247-2414
Payment: or Purchase Order Number
More info: Additional Information Regarding Orders
   


Please refer to Custom Lentivirus Subcloning Services for available virus titers and pricing.
Cat. No. Product Name Qty. Promo/% Off Amount
       
    Total: $0.00  

Haul in savings with our December-only offers on restriction enzymes, growth factors, PCR products and more! Check in every week of December to unwrap a new gift! Details here: https://info.abmgood.com/mystery-offers-revealed.
*Notes about Promo Codes: For NON-DISCOUNT promo codes (i.e. free items or shipping) please enter them during check out in the Notes/Promo Code field. To enter a DISCOUNT promo code enter it into the corresponding box in the 'Promo/% Off' column and then click 'Update' for the given product. If the code is valid for that product the discount percentage will display in place of the box and the amount will become the discounted total for that product(s). If the code is not valid it will remain in the box, please double check the expiry and spelling, and if you feel the code should still be accepted please contact us.
Catalog Number Quantity Promotion Code (Optional)
   
Data Sheet
Print Version
Procedure Overview
Product Application
  • Direct non-viral plasmid transfection for immediate expression
  • Package into Lentiviral particles for high efficiency transduction and stably integrated expression
  • Species Mouse
    Accession Number NM_001081273.2
    Vector piLenti-siRNA-GFP
    Target Sequence Sequence available upon placing order
    Sequencing Primers TACGTCCAAGGTCGGGCAGGAAGA
    User Manual
    Bacterial Selection Kanamycin
    Mammalian Selection Puromycin
    Format Plasmid
    Appearance Liquid
    Storage -20°C or below
    Shelf Life 1 year (when at -20°C or below in a non-frost free freezer)
    Shipping Shipped at ambient temperature
    Quality Control Restriction Enzyme Digest and Sequencing
    Caution This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
    More Information    Our RNA interference lentiviral vectors contain siRNAs. We employ a dual convergent promoter system where the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop - to avoid any possible recombination events that can occur.
       ABM guarantees that at least one out of the four siRNA Lentivector constructs purchased in a set will result in over 70% knockdown of gene expression within target cells showing >80% transfection efficiency. If this is not the case, we will provide a one-time replacement of four new constructs with alternative siRNA sequences. To qualify for this replacement, the vectors must be transfected at ≥5 nM and assayed 48 hours post-transfection. Customers must provide adequate data to show >80% transfection efficiency with a positive control, plus additional qPCR data or a western blot to evaluate the level of gene expression. The replacement set will not covered by the same guarantee, and if these constructs are also considered to be ineffective then it is most likely the gene is not susceptible to siRNA knockdown.
       ABM limits its obligation and liability for the success of this technology to providing one replacement of any siRNA lentivector product only. Before sending your inquiry, please make sure you have optimized your experiments as far as possible, this includes (where applicable) increasing your MOI and the duration of infection (up to 72 hours), and carrying out clone screening before assaying for knockdown. Please send all replacement inquiries and experimental data to technical@abmgood.com
    Disclaimer
    1. Disclaimer for accession number: The provided accession number refers to the transcript (mRNA) sequence the siRNA product targets. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final.
    2. Disclaimer for intended use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s).
    3. Disclaimer for extra nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct.
    Product Documents
    Product References
    FAQs
    Submit a new question:
      Question:
      Email:      
    I want to linearize the siRNA vector for electroporation purposes. Can you suggest a cut site outside the expression cassette that I can use?
    HpaI or PacI will work to linearize the vector. Both sites are located outside of the LTRs.
    Do you have the scramble shRNA lentivirus vector for mouse and rat as control?
    Our scramble negative control can be used for human, mouse and rat. Please refer to Cat.# LV015-G for ordering information.
    Can this vector be used with the 3rd generation packaging system
    Yes, our siRNA lentivectors are 3rd generation, but can be packaged using either 2nd or 3rd generation packaging systems.
    Could I transiently transfect these vectors to my target cell using lipofectamine or fugene directly? If I can do in this way, how many siRNA do I need to order for one target gene. I notice for each gene you have four options, and also have ***_set. Is one siRNA lentivector enough for knock-down assay?
    You can use Lipofectamine to transiently transfect the vectors to your target cells. Since the effect of an siRNA on a gene in a particular cell line can vary, we suggest choosing the set of 4 siRNA constructs to increase your chances of getting good knockdown of your target gene in your cells.
    Is the siRNA set composed of lentiviral vectors with shRNAs or siRNAs? Do you validate the RNA interference?
    Our RNA interference lentiviral vectors contain siRNAs. We employ a dual convergent promoter system where the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop - to avoid any possible recombination events that can occur.

    In cases where there are no verified and published siRNA sequences for your gene of interest, we use our siRNA design software to locate suitable target sites. If these designed siRNAs don't give efficient knock down of gene expression in your experiments, we offer a onetime replacement (free of charge) that will contain a new set of sequences to try.

    ABM guarantees that at least one out of the four siRNA Lentivector constructs purchased in a set will give over 70% knockdown efficiency within appropriate target cells showing >80% transfection efficiency. If these four constructs are still considered to be ineffective, then it is most likely the gene is not susceptible to siRNA knockdown.
    Can I use phoenix 293 cells to produce the lentivirus with the lentiviral siRNA plasmids you sell?
    The Phoenix 293T cells are suitable for retrovirus packaging but not for lentivirus packaging. To package our lentivectors, you will need to use a 2nd or 3rd generation packaging mix, like the ones we have here:

    http://www.abmgood.com/Lentivirus-Packaging-Systems.html
    I want to transfect the siRNA using Lipofectamine. How much of the siRNA do you recommend to transfect in a 60mm dish for efficient knock down of the gene?
    Since every gene is different, it is best to optimize the transfection condition to allow for the most siRNA vector used without having toxicity. Try transfecting a series of 5ug, 8ug, 10ug and 12ug of the siRNA with your cells and the best one will be the highest siRNA used without seeing toxicity.
    Are they high copy or low copy plasmids? What is expected plasmid DNA yield?
    These are high copy plasmids and should be propagated with an authentic DH5a strain. We typically see a yield of 300-500ug DNA from a 250mL culture.
    Is there a provided protocol I can reference when using this product?
    You can find the User Manual and Infection Protocol at the following link:

    http://www.abmgood.com/RNAi-shRNA-siRNA-Expression-Vector.html
    What primers can I use to sequence my vectors?
    One forward sequencing reaction using the U6 primer should be sufficient:

    U6 forward sequencing primer
    5'-TACGTCCAAGGTCGGGCAGGAAGA-3'
    What enzymes can I use to cut the plasmids for verification?
    BamHI will cut out GFP in these vectors, so you should see a 0.8kb band when you cut the plasmids with this enzyme (applies only to vectors containing GFP).

    Another method you can use to check for the insert is to perform an EcoRI digest. The parental vector contains 2 EcoRI sites, one between the two BbsI sites which were used to clone in the insert, and one located immediately after GFP. If the insert is cloned in, the first EcoRI site will be removed, and when this is cut by EcoRI, you will only get a linearized vector band. Ones that are still the parental plasmid with no insert cloned in will still contain both EcoRI sites, and cutting with EcoRI will give 2 bands, ~8.2kb + 0.8kb.

    Alternatively KpnI should give a 0.9kb band if the insert is present, and a linear vector band only if there is no insert present. The siRNA insert is cloned in with a KpnI site for screening purposes.
    How many ug DNA do you recommend to transfect cells in a 6 well plate?
    We recommend transfecting 2ug DNA (0.5ug/ul) per well of a 6-well plate
    I want to know the shRNA lentivector set contains a mix of 4 plasmids or 4 individual plasmid?
    The vector sets are supplied as 4 individual constructs, only the pooled lentivirus is supplied as a mixed solution. Please also note that our system utilizes the expression of mature siRNA sequences from two convergent promoters and this is not a hairpin loop, shRNA based system.
    Can you please advice on a protocol for vector extraction from filter paper?
    1) Cut out the circle on the filter paper (this is where the DNA will be spotted), and then cut it into tiny pieces into a 1.5ml tube.
    2) Put 30-50ul of PCR-grade water, 10mM Tris, or TE buffer to elute the DNA from the filter paper. The liquid may be completely soaked up by the filter, this is OK. Cap the tube and leave at room temperature for 5 minutes.
    3) Centrifuge the tube at high speed for 1 minute to collect the liquid, or use a pipette and "compress" the filter paper at the bottom of the tube to squeeze out as much liquid as possible. Collect the liquid in a new tube, and then use DH5a competent cells to amplify the plasmid, use the suitable antibiotic to select for positive clones.
    For lentiviral siRNA construct sets, would you recommend using 4 siRNA constructs in the same packaging mixture and collecting the supernatant of the packaging cells, or should we introduce the constructs separately into packaging cells and pool the supernatants before infection. Which way is better to increase knock-down efficiency?
    We would recommend packaging separately first, so that you can see which construct works better prior to pooling them together to infect your target cells.
    Is the 5'LTR wildtype? For the 3' LTR, is the U3 region deleted?
    This is not the wildtype 5'LTR. The U3 region is removed.
    How does lentiviral delivery of siRNA differ from shRNA?
    siRNA and shRNA have the same intention and they are to silent gene expression by cleaving the target mRNA. However, their differences are as follows:
    a) siRNA (small interfering RNA) is a linear sequence that binds to the target mRNA and cleaves it, preventing the unwanted protein from being made
    b) shRNA (short hairpin RNA) is a DNA construct encoding a sequence of single stranded RNA and its complement, separated by a stuffer fragment, allowing the RNA molecule to fold back on itself, creating a hairpin loop

    Traditionally, siRNA is made synthetically and introduced into the cells as is which is short lived; whereas shRNA is cloned into a vector and then introduced cell's genome, which can prolong expression. However, shRNA poses a difficulty on amplification and sequencing and thus it is not easy to construct.

    abm has come up with a novel technology where we combined the ability to clone siRNA into a vector, but with the same effect as shRNA. With the help of a dual convergent promoter vector system, the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop, which thus avoids any possible recombination events that can occur. However, the siRNA sequence is expressed in both directions, and therefore mimicks the actions of shRNA.