2410022L05Rik AAV Vector (Mouse) (CMV)
| Cat. No. | 10433104 |
| Name | 2410022L05Rik AAV Vector (Mouse) (CMV) |
| Unit | 1 μg |
| Gene Name | 2410022L05Rik |
| Alias | 1700029I03Rik; AA409325; AI256813; C85432; Copr5 |
| Accession Number | NM_025556.3 |
| Species | Mouse |
| Vector Map | pAAV-G-CMV-amp (click blue link to view) |
| System | AAV Vector |
| Insert Size | 522 |
| Vector Size | 4108 |
| Storage Condition | Store AAV vectors at -20°C |
| Disclaimer |
1.Disclaimer for transcript variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only.However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2.Disclaimer for gene sequence: The provided accession number refers to the transcript (mRNA) sequence for this product.Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3.Disclaimer for intended use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4.Disclaimer for extra nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the gene of interest which, in most cases,is innocuous to the stability/functionality and the expression of that gene. 5.Disclaimer for the stop codon: The stop codon for the inserted gene is located after the 3' cloning site in our vectors. Our vectors contain open ORF inserts (no stop codon) to allow for subsequent insertion into other vectors with C-terminal tags or C-terminal fusion proteins if desired. Please note that a stop codon will need to be added by PCR to the end of the gene insert if no tag or fusion protein is needed in subsequent vectors. Alternatively, if you would like to receive this construct with a natural stop codon (i.e. right after the gene), please contact technical@abmgood.comprior to order placement. |
| Guarantee | abm guarantees that the correct ORF construct is provided and the mRNA expression is displayed upon successful transduction. If this is not the case, we will provide a one-time replacement. Customers must provide adequate data to show >80% transfection efficiency with a positive control, plus additional qPCR data or a western blot to evaluate the level of gene expression. The replacement will not be covered by the same guarantee. Please note that due to the large number of variables applicable, any further expression analysis (e.g. protein expression) is not covered by the guarantee, as such analysis is dependent on the end user's experimental conditions. |
| Caution | This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information. |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. 10433104 |
| What are the correct concentration units for each recombinant viral particle? | |
|
For lentiviruses and retroviruses, they are measured in CFU/ml (colony-forming units per millilitre). Transduction with lentiviruses and retroviruses can cause the formation of colonies, which can be quantified for concentration. For AAV the titer is measured as genome copies per mL (GC/mL). Adenoviruses are measured as PFU/ml (plaque-forming units per millilitre). Transduction with adenoviruses will kill packaging cells, forming plaques in the process for quantification. The concentration for all three types of viruses can also be classified as IU/ml (Infectious Units/ml). Ultimately, the units refers to the viral particles and different units reflect the different assays involved.
|
| What do I use to check if my cells were successfully immortalized by the SV40 agent? | |
|
We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202.
Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below:
http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html
|
| What are the primers to use for SV40 identification? | |
|
SV40 Forward Primer Sequence
5’ ACTGAGGGGCCTGAAATGA
SV40 Reverse Primer Sequence
5’ GACTCAGGGCATGAAACAGG
These are qPCR primers and the band size is 61 bp.
|
| What advantages / disadvantages exist between the Lenti-SV40, -SV40T, and SV40T+t vectors? | |
|
There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only.
It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.
|
| What is the accession number for the SV40? | |
|
The SV40 covers the entire genome and the accession number is J02400.1. You can use this information to design primers for conventional PCR as well.
|
| How long after transduction can the infection efficiency be observed? | |
|
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
| What are the primers to use for SV40T and SV40T tsA58 detection? | |
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
| What is the sequence of the SV40 large T antigen? | |
|
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
| How much DNA do I need to provide for Custom AAV without DNA Amplification? | |
|
You will need to provide purified plasmid DNA at a concentration of 0.5ug/ul or more.
50 ug DNA needed for Custom AAV without DNA amplification (10^9 GC/ml) 200 ug DNA needed for Custom AAV without DNA amplification (10^12 GC/ml) 300 ug DNA needed for Custom AAV without DNA amplification (10^13 GC/ml) |
| What's the difference between GC/ml and vg/ml? | |
|
Both are used interchangeably and it is a qPCR based titer method.
|
| Why do I not see GFP expression after infecting AAV in my cell line? | |
|
Serotype selection is an important parameter affecting transduction ability of AAV particles. Thus, determine which serotype works best for your cell line. You could refer to our technical sheet "AAV - General Guideline to Serotype Selection". eg. Serotype 5 has limited transduction ability on most cell types.
|
| Is your AAV preparation in-vivo grade? | |
|
Our high titer AAV preps undergo extensive purification steps leading to high quality viral particles ready to inject for your in-vivo models. For reference, see our in-vivo infectivity data as tested by an independent lab {https://www.abmgood.com/AAV-Adeno-Associated-Virus.html}
|
| For G221 and LV620, what does the 'V12' in RasV12 mean? | |
|
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
| Where is the SV40T tsA58 gene sequence? | |
|
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
| What are the QC methods for testing AAV? | |
|
We provide qPCR based titer as primary method of determining successful packaging. If your virus has GFP or RFP reporter, we also perform virus infectivity testing in HEK293T cell line and provide you image in CoA.Since infectivity is serotype dependent, and HEK293T cells are not infected well with Serotype 4,5 and 6, we are unable to confirm infection for these serotypes in our standard evaluation cell line. For such cases, titer as determined by qPCR is considered final parameter to determine successful packaging of virus.
|
| Can I work with different serotypes of AAV virus in the same equipment to keep the infected cells? | |
|
There is no problem with using different serotypes in the same equipment, as long as the handler takes the basic precautions to avoid cross-contamination.
|
| How should I store abm’s vectors? | |
|
We recommend storing abm’s vectors at -20°C and avoiding repeated freeze/thaws as this may affect plasmid integrity and cloning efficiency.
|
- Iacono, L. L., Lelpo, D., Accoto, A., Di Segni, M., Babicola, L., D’Addario, S. L., ... & Andolina, D. "MicroRNA-34a Regulates the Depression-like Behavior in Mice by Modulating the Expression of Target Genes in the Dorsal Raphè" Molecular neurobiology 1-14: (2019).