Retro-SV40LT Retrovirus
Cat. No. | RVP010 |
Name | Retro-SV40LT Retrovirus |
Unit | 5 x 50 µl |
Unpacking and Storage Instructions |
-80°C |
Description |
Retrovirus expressing SV40 large T antigen (108IU/ml). Often used to immortalize difficult to transduce cells like epithelial cells and lymphocytes (B cells, T cells, etc...). |
Expression System Type | Retrovirus |
Vector Map | pRetro-SV40LT |
Note |
*For for-profit organizations and corporations, the purchase price is 1.5 times the listing price. |
Caution |
NOT FOR RESALE without prior written consent of abm. This product is distributed for laboratory research only. Caution: Not for diagnostic use. |
Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. RVP010 |
Print & Download Datasheet
What PCR primers can I use for SV40 large T detection? | |
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
Expected band size: 792bp
|
What qPCR primers can I use for SV40 large T detection? | |
SV40 Forward Primer Sequence
TTCCCTGACCTGAAGGCAAATC
SV40 Reverse Primer Sequence
GGCTGAACTTTGAGCTAGGAGTAG
|
There are no references for this product yet!
This product has no review yet.