CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)

Cat. No.
K010
Unit
1.0 µg
Price
$140.00
Cat. No. K010
Name CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
Unit 1.0 µg
Category Control Vectors & Viruses
Description

Control CRISPR Lentiviral Vector with scrambled sgRNA and spCas9.

Target Sequence: GCACTCACATCGCTACATCA

Vector Map pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro (click blue link to view)
Caution This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
Material Citation If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. K010
Print & Download Datasheet
  • Prieto, K., Cao, Y., Mohamed, E., Trillo-Tinoco, J., Sierra, R. A., Urueña, C., … Barreto, A. "Polyphenol-rich extract induces apoptosis with immunogenic markers in melanoma cells through the ER stress-associated kinase PERK" Cell Death Discovery 5(1): (2019). DOI: 10.1038/s41420-019-0214-2.
  • Singh, A., Borah, A. K., Deka, K., Gogoi, A. P., Verma, K., Barah, P., & Saha, S. "Arginylation regulates adipogenesis by regulating expression of PPARγ at transcript and protein level" Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids 1864(4):596–607 (2019). DOI: 10.1016/j.bbalip.2018.12.015.
  • Taura, M., Song, E., Ho, Y.-C., & Iwasaki, A. "Apobec3A maintains HIV-1 latency through recruitment of epigenetic silencing machinery to the long terminal repeat" Proceedings of the National Academy of Sciences 116(6):2282–2289 (2019). DOI: 10.1073/pnas.1819386116.
This product has no review yet.
Other Products
E. coli
Human
Human (H. sapiens)
Luc
Luciola italica
N/A
Other
Photinus pyralis
Renilla reniformis
Serotype 1
Serotype 10
Serotype 2
Serotype 3
Serotype 4
Serotype 5
Serotype 6
Serotype 7
Serotype 8
Serotype 9

Lentiviral Vector
AAV Vector
Adenovirus Vector
Protein Vector
ORF Vector
siRNA Vector
miRNA Vector
3'UTR Vector
CRISPR Knockout Vector
CRISPR Activation Vector
Control Vectors & Viruses Vector
circRNA Vector
Internal Vector