LentimiRa-GFP-hsa-let-7a-5p Virus
CAT.NO | UNIT | PRICE |
---|---|---|
mh15001 | 2 x 50 μl | $485.00 |
Description | This ready-to-use miRNA lentivirus is part of abm’s Lentivirus Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models. This virus contains a GFP reporter for monitoring transduction efficiency. |
---|---|
SKU | mh15001 |
Accession Number | MIMAT0000062 |
Format | Virus |
Features | GFP Reporter |
Gene Name | hsa-let-7a-5p |
miRNA ID | MIMAT0000062 |
miRNA Name | hsa-let-7a-5p |
Insert | Mature miRNA |
System | Lentivirus |
Species | Human (H. sapiens) |
Titer | >107 IU/ml |
Unit quantity | 2 x 50 μl |
Vector Map | pLenti-III-mico-GFP |
Serotype | N/A |
Storage Condition | Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles. |
Disclaimer |
abm guarantees that the correct construct is provided and GFP expression is displayed upon successful transduction. If this is not the case, we will provide a one-time replacement. Customers must provide adequate data to show >80% transfection efficiency with a positive control. The replacement will not be covered by the same guarantee. Please note that due to the large number of variables applicable, any further expression analysis is not covered by the guarantee, as such analysis is dependent on the end user's experimental conditions. |
Supporting Protocol
- Lentiviral Vector Amplification Protocol
- Important Considerations for Lentiviruses
- Selection-Drug Killing Curve
- Lentivector Packaging Protocol
- Lentivirus Infection Protocol
MSDS
QC
Other
- Enhanced Lentivirus Safety Features: Replication Incompetency
- Suggested MOI for Common Cancer Cell Lines
Are the inserts in our vector in a pri-miRNA format or a mature miRNA format? | |
Majority of our inserts are in the pri-miRNA format (about 500-600bp in size). If the miRNA is found in a cluster, the insert will then be the mature miRNA format (about 150bp in size) to ensure that the construct is only expressing one miRNA.
If the R in mir is big (miR) and the accession# is MIMA#########, then it’s typically the Mature format.
If the r in mir is small (mir) and the accession# is MI#########, then it’s typically the pre-miRNA format.
This information can also be found on the "insert type" section of this product webpage.
|
what primers can I use to screen LentimiRa-GFP-miRNA constructs? | |
For screening:
Forward primer sequence:
Ctcggcatggacgagctgtacaag
Reverse primer sequence:
TGGAATAGCTCAGAGGCCGAGGC
407bp for the background,
407bp+500 to 600bp for the construct with insert |
Are both the pre-miRNA and GFP under the same CMV promoter? If yes, is there a translational cleavage site between the two? | |
Yes, both the pre-miRNA and GFP are under the same CMV promoter.
There is no translational cleavage site between the two.
The transcription termination site is after the pre-miRNA, so both GFP and the pre-miRNA are transcribed together, thus making GFP an actual transcription reporter for the miRNA. The pre-miRNA region of the mRNA folds over on itself and forms a stem loop structure which will be processed in the cell by the Drosha/Pasha enzymes and cleaved from the GFP portion of the mRNA. |
It is mentioned that the regular (untouched) 293T cells are to be maintained in 500ug/ml of geneticin (G418). Is this correct? If yes, please explain. | |
Yes, 293T cells are resistance to Geneticin(G418), as the drug was originally used to select cells expressing the SV40 large T antigen. Just like any other stable cell line generated, the cells should be kept at lower concentration of the selection drug to keep the selection pressure.
Please note, that in this case since these wildtype cells are stably transfected with puromycin resistance gene, just adding puromycin may be sufficient to keep the selection pressure for the gene of interest. |
12
- Qiao, J et al. "miR-335 and miR-363 regulation of neuroblastoma tumorigenesis and metastasis" Surgery 2:226-33 (2013). PubMed: 23806264. Application: miRNA Expression.
- Wen, Z et al. "MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF " Plos One 9 (9):e104666 (2014). DOI: 10.1371/journal.pone.0104666. PubMed: 25251394. Application: miRNA expression and inhibition.
- Bibikova, E. "Identification of Novel Pathways in the Pathogenesis of Diamond-Blackfan Anemia" Thesis: http://digitalcommons.library.tmc.edu/utgsbs_dissertations/516/ : (2014). Application: Control Vector.
- Hasegawa, S et al. "MicroRNA-1246 expression associated with CCNG2-mediated chemoresistance and stemness in pancreatic cancer" Br J Cancer 111 (8):1572-1580 (2014). DOI: 10.1038/bjc.2014.454. PubMed: 25117811. Application: miRNA expression.
- Liang, Y., Song, X., Li, Y., Su, P., Han, D., Ma, T., … Yang, Q. "circKDM4C suppresses tumor progression and attenuates doxorubicin resistance by regulating miR-548p/PBLD axis in breast cancer" Oncogene 38(42):6850–6866 (2019). DOI: 10.1038/s41388-019-0926-z.
- Verma, M., Asakura, Y., & Asakura, A. "Inhibition of microRNA‐92a increases blood vessels and satellite cells in skeletal muscle but does not improve duchenne muscular dystrophy–related phenotype in mdx mice" Muscle & Nerve 59(5):594–602 (2019). DOI: 10.1002/mus.26433.
- Wu., Chien-Wei., . "Downregulation of MiR-144 by Triptolide Enhanced p85α−PTEN Complex Formation Causing S Phase Arrest of Human Nasopharyngeal Carcinoma Cells" European Journal of Pharmacology 855:137-148 (2019). DOI: 10.1016/j.ejphar.2019.04.052..
- Wu, M.-J., Chen, Y.-S., Kim, M. R., Chang, C.-C., Gampala, S., Zhang, Y., … Chang, C.-J. "Epithelial-Mesenchymal Transition Directs Stem Cell Polarity via Regulation of Mitofusin" Cell Metabolism 29(4):993–1002.e6 (2019). DOI: 10.1016/j.cmet.2018.11.004.
- Xiang, X., Zhou, Y., Sun, H., Tan, S., Lu, Z., Huang, L., & Wang, W. "Ivabradine abrogates TNF-α-induced degradation of articular cartilage matrix" International Immunopharmacology 66:347–353 (2019). DOI: 10.1016/j.intimp.2018.11.035.
- Zhang, Y., Zhou, J., Li, M. . "MicroRNA-184 promotes apoptosis of trophoblast cells via targeting WIG1 and induces early spontaneous abortion" Cell Death Dis 10 223: (2019). DOI: 10.1038/s41419-019-1443-2.
- Zhou, Y., Lei, J., Xie, Q., Wu, L., Jin, S., Guo, B., ... & Zhang, J. "Fibrinogen-like protein 2 controls sepsis catabasis by interacting with resolvin Dp5" Science Advances 5(11):eaax0629 (2019).
- Zhu, R., Xue, X., Shen, M., Tsai, Y., Keng, P. C., Chen, Y., … Chen, Y. "NFκB and TNFα as individual key molecules associated with the cisplatin-resistance and radioresistance of lung cancer" Experimental Cell Research 374(1):181–188 (2019). DOI: 10.1016/j.yexcr.2018.11.022.