LentimiRa-mmu-miR-199a-5p Vector

CAT.NOUNITPRICE
mm42167
$215.00

Specifications


DescriptionThis miRNA lentiviral vector is part of abm’s Lentivirus Expression System and can be packaged into virus using an appropriate packaging mix to over-express your miRNA of interest in a wide range of host cells or animal models.
SKUmm42167
FAQs


Are the inserts in our vector in a pri-miRNA format or a mature miRNA format?
Majority of our inserts are in the pri-miRNA format (about 500-600bp in size). If the miRNA is found in a cluster, the insert will then be the mature miRNA format (about 150bp in size) to ensure that the construct is only expressing one miRNA. If the R in mir is big (miR) and the accession# is MIMA#########, then it’s typically the Mature format. If the r in mir is small (mir) and the accession# is MI#########, then it’s typically the pre-miRNA format. This information can also be found on the "insert type" section of this product webpage.
what primers can I use to screen LentimiRa-GFP-miRNA constructs?
For screening: Forward primer sequence: Ctcggcatggacgagctgtacaag Reverse primer sequence: TGGAATAGCTCAGAGGCCGAGGC 407bp for the background, 407bp+500 to 600bp for the construct with insert
Are both the pre-miRNA and GFP under the same CMV promoter? If yes, is there a translational cleavage site between the two?
Yes, both the pre-miRNA and GFP are under the same CMV promoter. There is no translational cleavage site between the two. The transcription termination site is after the pre-miRNA, so both GFP and the pre-miRNA are transcribed together, thus making GFP an actual transcription reporter for the miRNA. The pre-miRNA region of the mRNA folds over on itself and forms a stem loop structure which will be processed in the cell by the Drosha/Pasha enzymes and cleaved from the GFP portion of the mRNA.
It is mentioned that the regular (untouched) 293T cells are to be maintained in 500ug/ml of geneticin (G418). Is this correct? If yes, please explain.
Yes, 293T cells are resistance to Geneticin(G418), as the drug was originally used to select cells expressing the SV40 large T antigen. Just like any other stable cell line generated, the cells should be kept at lower concentration of the selection drug to keep the selection pressure. Please note, that in this case since these wildtype cells are stably transfected with puromycin resistance gene, just adding puromycin may be sufficient to keep the selection pressure for the gene of interest.
References


12
  • Qiao, J et al. "miR-335 and miR-363 regulation of neuroblastoma tumorigenesis and metastasis" Surgery 2:226-33 (2013). PubMed: 23806264. Application: miRNA Expression.
  • Wen, Z et al. "MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF " Plos One 9 (9):e104666 (2014). DOI: 10.1371/journal.pone.0104666. PubMed: 25251394. Application: miRNA expression and inhibition.
  • Bibikova, E. "Identification of Novel Pathways in the Pathogenesis of Diamond-Blackfan Anemia" Thesis: http://digitalcommons.library.tmc.edu/utgsbs_dissertations/516/ : (2014). Application: Control Vector.
  • Hasegawa, S et al. "MicroRNA-1246 expression associated with CCNG2-mediated chemoresistance and stemness in pancreatic cancer" Br J Cancer 111 (8):1572-1580 (2014). DOI: 10.1038/bjc.2014.454. PubMed: 25117811. Application: miRNA expression.
  • Liang, Y., Song, X., Li, Y., Su, P., Han, D., Ma, T., … Yang, Q. "circKDM4C suppresses tumor progression and attenuates doxorubicin resistance by regulating miR-548p/PBLD axis in breast cancer" Oncogene 38(42):6850–6866 (2019). DOI: 10.1038/s41388-019-0926-z.
  • Verma, M., Asakura, Y., & Asakura, A. "Inhibition of microRNA‐92a increases blood vessels and satellite cells in skeletal muscle but does not improve duchenne muscular dystrophy–related phenotype in mdx mice" Muscle & Nerve 59(5):594–602 (2019). DOI: 10.1002/mus.26433.
  • Wu., Chien-Wei., . "Downregulation of MiR-144 by Triptolide Enhanced p85α−PTEN Complex Formation Causing S Phase Arrest of Human Nasopharyngeal Carcinoma Cells" European Journal of Pharmacology 855:137-148 (2019). DOI: 10.1016/j.ejphar.2019.04.052..
  • Wu, M.-J., Chen, Y.-S., Kim, M. R., Chang, C.-C., Gampala, S., Zhang, Y., … Chang, C.-J. "Epithelial-Mesenchymal Transition Directs Stem Cell Polarity via Regulation of Mitofusin" Cell Metabolism 29(4):993–1002.e6 (2019). DOI: 10.1016/j.cmet.2018.11.004.
  • Xiang, X., Zhou, Y., Sun, H., Tan, S., Lu, Z., Huang, L., & Wang, W. "Ivabradine abrogates TNF-α-induced degradation of articular cartilage matrix" International Immunopharmacology 66:347–353 (2019). DOI: 10.1016/j.intimp.2018.11.035.
  • Zhang, Y., Zhou, J., Li, M. . "MicroRNA-184 promotes apoptosis of trophoblast cells via targeting WIG1 and induces early spontaneous abortion"  Cell Death Dis 10  223: (2019). DOI: 10.1038/s41419-019-1443-2.
  • Zhou, Y., Lei, J., Xie, Q., Wu, L., Jin, S., Guo, B., ... & Zhang, J. "Fibrinogen-like protein 2 controls sepsis catabasis by interacting with resolvin Dp5" Science Advances 5(11):eaax0629 (2019).
  • Zhu, R., Xue, X., Shen, M., Tsai, Y., Keng, P. C., Chen, Y., … Chen, Y. "NFκB and TNFα as individual key molecules associated with the cisplatin-resistance and radioresistance of lung cancer" Experimental Cell Research 374(1):181–188 (2019). DOI: 10.1016/j.yexcr.2018.11.022.