mir-941-2 miRNA

CAT.NO	UNIT	PRICE
		$215.00

Specifications

Print Version

Description	microRNAs (miRNAs) are small non-coding RNA sequences important for gene regulation. This mir-941-2 miRNA can be used in experiments to investigate post-translational gene regulation by mimicking the effect of the endogenous miRNA.
SKU	10006973
Accession Number	MI0005764
Description	This miRNA AAV vector is part of abm’s AAV Expression System and can be packaged into virus using an appropriate packaging mix to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	Amh1103800
Accession Number	MI0005764
Format	Vector
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	AAV Vector
Species	Human (H. sapiens)
Unit quantity	500 ng
Reporter	GFP
Vector Size	5837
Vector Map	pAAV-mir-GFP-hGH-amp
Serotype	N/A
Storage Condition	AAV Vectors are shelf stable for 1 year when stored at -20°C or below. Shipping and short term storage are acceptable at ambient temperature. Avoid repeated freeze-thaw cycles.
QC	Restriction Enzyme Digest and Sequencing
Bacterial Selection	Ampicillin
Recommended Controls	pAAV-mir-GFP-Blank (Cat# Am00100)
Mammalian Selection Marker	Puromycin
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use AAV is part of abm’s AAV Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	Amh1103801
Accession Number	MI0005764
Format	Virus
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	AAV Virus
Species	Human (H. sapiens)
Titer	>1 x 10⁹ GC/ml
Unit quantity	5 x 200 μl
Reporter	GFP
Vector Size	5837
Vector Map	pAAV-mir-GFP-hGH-amp
Serotype	AAV Serotype 1
Storage Condition	AAV viruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
QC	qPCR Based Titer Determination and Transduction Efficiency Test
Bacterial Selection	Ampicillin
Recommended Controls	AAV-mir-GFP-Blank Serotype 1 (Cat# Am00101)
Mammalian Selection Marker	Puromycin
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use AAV is part of abm’s AAV Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	Amh1103802
Accession Number	MI0005764
Format	Virus
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	AAV Virus
Species	Human (H. sapiens)
Titer	>1 x 10⁹ GC/ml
Unit quantity	5 x 200 μl
Reporter	GFP
Vector Size	5837
Vector Map	pAAV-mir-GFP-hGH-amp
Serotype	AAV Serotype 2
Storage Condition	AAV viruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
QC	qPCR Based Titer Determination and Transduction Efficiency Test
Bacterial Selection	Ampicillin
Recommended Controls	AAV-mir-GFP-Blank Serotype 2 (Cat# Am00102)
Mammalian Selection Marker	Puromycin
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use AAV is part of abm’s AAV Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	Amh1103803
Accession Number	MI0005764
Format	Virus
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	AAV Virus
Species	Human (H. sapiens)
Titer	>1 x 10⁹ GC/ml
Unit quantity	5 x 200 μl
Reporter	GFP
Vector Size	5837
Vector Map	pAAV-mir-GFP-hGH-amp
Serotype	AAV Serotype 3
Storage Condition	AAV viruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
QC	qPCR Based Titer Determination and Transduction Efficiency Test
Bacterial Selection	Ampicillin
Recommended Controls	AAV-mir-GFP-Blank Serotype 3 (Cat# Am00103)
Mammalian Selection Marker	Puromycin
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use AAV is part of abm’s AAV Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	Amh1103804
Accession Number	MI0005764
Format	Virus
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	AAV Virus
Species	Human (H. sapiens)
Titer	>1 x 10⁹ GC/ml
Unit quantity	5 x 200 μl
Reporter	GFP
Vector Size	5837
Vector Map	pAAV-mir-GFP-hGH-amp
Serotype	AAV Serotype 4
Storage Condition	AAV viruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
QC	qPCR Based Titer Determination and Transduction Efficiency Test
Bacterial Selection	Ampicillin
Recommended Controls	AAV-mir-GFP-Blank Serotype 4 (Cat# Am00104)
Mammalian Selection Marker	Puromycin
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use AAV is part of abm’s AAV Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	Amh1103805
Accession Number	MI0005764
Format	Virus
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	AAV Virus
Species	Human (H. sapiens)
Titer	>1 x 10⁹ GC/ml
Unit quantity	5 x 200 μl
Reporter	GFP
Vector Size	5837
Vector Map	pAAV-mir-GFP-hGH-amp
Serotype	AAV Serotype 5
Storage Condition	AAV viruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
QC	qPCR Based Titer Determination and Transduction Efficiency Test
Bacterial Selection	Ampicillin
Recommended Controls	AAV-mir-GFP-Blank Serotype 5 (Cat# Am00105)
Mammalian Selection Marker	Puromycin
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use AAV is part of abm’s AAV Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	Amh1103806
Accession Number	MI0005764
Format	Virus
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	AAV Virus
Species	Human (H. sapiens)
Titer	>1 x 10⁹ GC/ml
Unit quantity	5 x 200 μl
Reporter	GFP
Vector Size	5837
Vector Map	pAAV-mir-GFP-hGH-amp
Serotype	AAV Serotype 6
Storage Condition	AAV viruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
QC	qPCR Based Titer Determination and Transduction Efficiency Test
Bacterial Selection	Ampicillin
Recommended Controls	AAV-mir-GFP-Blank Serotype 6 (Cat# Am00106)
Mammalian Selection Marker	Puromycin
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use AAV is part of abm’s AAV Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	Amh1103807
Accession Number	MI0005764
Format	Virus
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	AAV Virus
Species	Human (H. sapiens)
Titer	>1 x 10⁹ GC/ml
Unit quantity	5 x 200 μl
Reporter	GFP
Vector Size	5837
Vector Map	pAAV-mir-GFP-hGH-amp
Serotype	AAV Serotype 7
Storage Condition	AAV viruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
QC	qPCR Based Titer Determination and Transduction Efficiency Test
Bacterial Selection	Ampicillin
Recommended Controls	AAV-mir-GFP-Blank Serotype 7 (Cat# Am00107)
Mammalian Selection Marker	Puromycin
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use AAV is part of abm’s AAV Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	Amh1103808
Accession Number	MI0005764
Format	Virus
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	AAV Virus
Species	Human (H. sapiens)
Titer	>1 x 10⁹ GC/ml
Unit quantity	5 x 200 μl
Reporter	GFP
Vector Size	5837
Vector Map	pAAV-mir-GFP-hGH-amp
Serotype	AAV Serotype 8
Storage Condition	AAV viruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
QC	qPCR Based Titer Determination and Transduction Efficiency Test
Bacterial Selection	Ampicillin
Recommended Controls	AAV-mir-GFP-Blank Serotype 8 (Cat# Am00108)
Mammalian Selection Marker	Puromycin
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use AAV is part of abm’s AAV Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	Amh1103809
Accession Number	MI0005764
Format	Virus
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	AAV Virus
Species	Human (H. sapiens)
Titer	>1 x 10⁹ GC/ml
Unit quantity	5 x 200 μl
Reporter	GFP
Vector Size	5837
Vector Map	pAAV-mir-GFP-hGH-amp
Serotype	AAV Serotype 9
Storage Condition	AAV viruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
QC	qPCR Based Titer Determination and Transduction Efficiency Test
Bacterial Selection	Ampicillin
Recommended Controls	AAV-mir-GFP-Blank Serotype 9 (Cat# Am00109)
Mammalian Selection Marker	Puromycin
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use AAV is part of abm’s AAV Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	Amh1103810
Accession Number	MI0005764
Format	Virus
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	AAV Virus
Species	Human (H. sapiens)
Titer	>1 x 10⁹ GC/ml
Unit quantity	5 x 200 μl
Reporter	GFP
Vector Size	5837
Vector Map	pAAV-mir-GFP-hGH-amp
Serotype	AAV Serotype 10
Storage Condition	AAV viruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
QC	qPCR Based Titer Determination and Transduction Efficiency Test
Bacterial Selection	Ampicillin
Recommended Controls	AAV-mir-GFP-Blank Serotype 10 (Cat# Am00110)
Mammalian Selection Marker	Puromycin
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use miRNA lentivirus is part of abm’s Lentivirus Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models. This virus contains a GFP reporter for monitoring transduction efficiency.
SKU	mh16038
Accession Number	MI0005764
Format	Virus
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	Lentivirus
Species	Human (H. sapiens)
Titer	>10⁷ IU/ml
Unit quantity	2 x 50 μl
Reporter	GFP
Vector Map	pLenti-III-mir-GFP
Serotype	N/A
Storage Condition	Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This miRNA lentiviral vector is part of abm’s Lentivirus Expression System and can be packaged into virus using an appropriate packaging mix to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	mh41038
Applications	Direct non-viral plasmid transfection for immediate expression. Package into Lentiviral particles for high efficiency transduction and stably integrated expression.
Accession Number	MI0005764
Format	Vector
Features	No Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	Lentiviral Vector
Species	Human (H. sapiens)
Unit quantity	500 ng
Reporter	None
Vector Map	pLenti-III-mir
Serotype	N/A
Storage Condition	Store at -20°C or below upon receipt
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This ready-to-use miRNA lentivirus is part of abm’s Lentivirus Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models.
SKU	mh46038
Accession Number	MI0005764
Format	Virus
Features	No Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	Lentivirus
Species	Human (H. sapiens)
Titer	>10⁷ IU/ml
Unit quantity	2 x 50 μl
Reporter	None
Vector Map	pLenti-III-mir
Serotype	N/A
Storage Condition	Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.
Description	This miRNA lentiviral vector is part of abm’s Lentivirus Expression System and can be packaged into virus using an appropriate packaging mix to over-express your miRNA of interest in a wide range of host cells or animal models. This construct contains a GFP reporter for monitoring transfection efficiency.
SKU	mh11038
Accession Number	MI0005764
Format	Vector
Features	GFP Reporter
Gene Name	hsa-mir-941-2
miRNA ID	MI0005764
miRNA Name	hsa-mir-941-2
Insert	Pre-miRNA
System	Lentiviral Vector
Species	Human (H. sapiens)
Titer	N/A
Unit quantity	500 ng
Vector Map	pLenti-III-mir-GFP
Serotype	N/A
Storage Condition	Store at -20°C or below upon receipt
Disclaimer	abm guarantees that the correct construct is provided and GFP expression is displayed upon successful transduction. If this is not the case, we will provide a one-time replacement. Customers must provide adequate data to show >80% transfection efficiency with a positive control. The replacement will not be covered by the same guarantee. Please note that due to the large number of variables applicable, any further expression analysis is not covered by the guarantee, as such analysis is dependent on the end user's experimental conditions.

Documents

Supporting Protocol

MSDS

Other

FAQs

Are the inserts in our vector in a pri-miRNA format or a mature miRNA format?

Majority of our inserts are in the pri-miRNA format (about 500-600bp in size). If the miRNA is found in a cluster, the insert will then be the mature miRNA format (about 150bp in size) to ensure that the construct is only expressing one miRNA. If the R in mir is big (miR) and the accession# is MIMA#########, then it’s typically the Mature format. If the r in mir is small (mir) and the accession# is MI#########, then it’s typically the pre-miRNA format. This information can also be found on the "insert type" section of this product webpage.

	what primers can I use to screen LentimiRa-GFP-miRNA constructs?
For screening: Forward primer sequence: Ctcggcatggacgagctgtacaag Reverse primer sequence: TGGAATAGCTCAGAGGCCGAGGC 407bp for the background, 407bp+500 to 600bp for the construct with insert

Are both the pre-miRNA and GFP under the same CMV promoter? If yes, is there a translational cleavage site between the two?

Yes, both the pre-miRNA and GFP are under the same CMV promoter. There is no translational cleavage site between the two. The transcription termination site is after the pre-miRNA, so both GFP and the pre-miRNA are transcribed together, thus making GFP an actual transcription reporter for the miRNA. The pre-miRNA region of the mRNA folds over on itself and forms a stem loop structure which will be processed in the cell by the Drosha/Pasha enzymes and cleaved from the GFP portion of the mRNA.

It is mentioned that the regular (untouched) 293T cells are to be maintained in 500ug/ml of geneticin (G418). Is this correct? If yes, please explain.

Yes, 293T cells are resistance to Geneticin(G418), as the drug was originally used to select cells expressing the SV40 large T antigen. Just like any other stable cell line generated, the cells should be kept at lower concentration of the selection drug to keep the selection pressure. Please note, that in this case since these wildtype cells are stably transfected with puromycin resistance gene, just adding puromycin may be sufficient to keep the selection pressure for the gene of interest.

	Why are miRNA mimics on your site offered at 2 x 2.5nmol, but miRNA inhibitors at 2 x 5.0nmol?
This is because our mimics now are double-stranded while the inhibitors are single-stranded. The amount of materials are quantified in OD and both mimics/inhibitors are synthesized to yield the same OD. Therefore, the number of moles of mimics is half of that of the inhibitors.

References

Qiao, J et al. "miR-335 and miR-363 regulation of neuroblastoma tumorigenesis and metastasis" Surgery 2:226-33 (2013). PubMed: 23806264. Application: miRNA Expression.
Wen, Z et al. "MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF " Plos One 9 (9):e104666 (2014). DOI: 10.1371/journal.pone.0104666. PubMed: 25251394. Application: miRNA expression and inhibition.
Bibikova, E. "Identification of Novel Pathways in the Pathogenesis of Diamond-Blackfan Anemia" Thesis: http://digitalcommons.library.tmc.edu/utgsbs_dissertations/516/ : (2014). Application: Control Vector.
Hasegawa, S et al. "MicroRNA-1246 expression associated with CCNG2-mediated chemoresistance and stemness in pancreatic cancer" Br J Cancer 111 (8):1572-1580 (2014). DOI: 10.1038/bjc.2014.454. PubMed: 25117811. Application: miRNA expression.
Liang, Y., Song, X., Li, Y., Su, P., Han, D., Ma, T., … Yang, Q. "circKDM4C suppresses tumor progression and attenuates doxorubicin resistance by regulating miR-548p/PBLD axis in breast cancer" Oncogene 38(42):6850–6866 (2019). DOI: 10.1038/s41388-019-0926-z.
Verma, M., Asakura, Y., & Asakura, A. "Inhibition of microRNA‐92a increases blood vessels and satellite cells in skeletal muscle but does not improve duchenne muscular dystrophy–related phenotype in mdx mice" Muscle & Nerve 59(5):594–602 (2019). DOI: 10.1002/mus.26433.
Win, S., Min, R. W., Chen, C. Q., Zhang, J., Chen, Y., Li, M., ... & Aung, F. W. "Expression of mitochondrial membrane–linked SAB determines severity of sex-dependent acute liver injury" The Journal of clinical investigation 129(12): (2019).
Wu., Chien-Wei., . "Downregulation of MiR-144 by Triptolide Enhanced p85α−PTEN Complex Formation Causing S Phase Arrest of Human Nasopharyngeal Carcinoma Cells" European Journal of Pharmacology 855:137-148 (2019). DOI: 10.1016/j.ejphar.2019.04.052..
Wu, M.-J., Chen, Y.-S., Kim, M. R., Chang, C.-C., Gampala, S., Zhang, Y., … Chang, C.-J. "Epithelial-Mesenchymal Transition Directs Stem Cell Polarity via Regulation of Mitofusin" Cell Metabolism 29(4):993–1002.e6 (2019). DOI: 10.1016/j.cmet.2018.11.004.
Xiang, X., Zhou, Y., Sun, H., Tan, S., Lu, Z., Huang, L., & Wang, W. "Ivabradine abrogates TNF-α-induced degradation of articular cartilage matrix" International Immunopharmacology 66:347–353 (2019). DOI: 10.1016/j.intimp.2018.11.035.
Zhang, Y., Zhou, J., Li, M. . "MicroRNA-184 promotes apoptosis of trophoblast cells via targeting WIG1 and induces early spontaneous abortion" Cell Death Dis 10 223: (2019). DOI: 10.1038/s41419-019-1443-2.
Zhou, Y., Lei, J., Xie, Q., Wu, L., Jin, S., Guo, B., ... & Zhang, J. "Fibrinogen-like protein 2 controls sepsis catabasis by interacting with resolvin Dp5" Science Advances 5(11):eaax0629 (2019).
Zhu, R., Xue, X., Shen, M., Tsai, Y., Keng, P. C., Chen, Y., … Chen, Y. "NFκB and TNFα as individual key molecules associated with the cisplatin-resistance and radioresistance of lung cancer" Experimental Cell Research 374(1):181–188 (2019). DOI: 10.1016/j.yexcr.2018.11.022.