pAAV-G-CAGGS-CBH-gcGFP Amp

Vector Name pAAV-G-CAGGS-CBH-gcGFP Amp
Antibiotic Information Ampicillin
Sequencing Primers
Additional Information No Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.
        1 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt     
       61 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact     
      121 aggggttcct gcggccgccc taggccggcc acgcgtggcg cgttgacatt gattattgac     
      181 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg     
      241 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt     
      301 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca     
      361 atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc     
      421 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta     
      481 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac     
      541 catgggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac     
      601 ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg     
      661 gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg gggcggggcg aggcggagag     
      721 gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt tccttttatg gcgaggcggc     
      781 ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc gggagtcgct gcgttgcctt     
      841 cgccccgtgc cccgctccgc gccgcctcgc gccgcccgcc ccggctctga ctgaccgcgt     
      901 tactcccaca ggtgagcggg cgggacggcc cttctcctcc gggctgtaat tagcgcttgg     
      961 tttaatgacg gctcgtttct tttctgtggc tgcgtgaaag ccttaaaggg ctccgggagg     
     1021 gccctttgtg cgggggggag cggctcgggg ggtgcgtgcg tgtgtgtgtg cgtggggagc     
     1081 gccgcgtgcg gcccgcgctg cccggcggct gtgagcgctg cgggcgcggc gcggggcttt     
     1141 gtgcgctccg cgtgtgcgcg aggggagcgc ggccgggggc ggtgccccgc ggtgcggggg     
     1201 ggctgcgagg ggaacaaagg ctgcgtgcgg ggtgtgtgcg tgggggggtg agcagggggt     
     1261 gtgggcgcgg cggtcgggct gtaacccccc cctgcacccc cctccccgag ttgctgagca     
     1321 cggcccggct tcgggtgcgg ggctccgtgc ggggcgtggc gcggggctcg ccgtgccggg     
     1381 cggggggtgg cggcaggtgg gggtgccggg cggggcgggg ccgcctcggg ccggggaggg     
     1441 ctcgggggag gggcgcggcg gccccggagc gccggcggct gtcgaggcgc ggcgagccgc     
     1501 agccattgcc ttttatggta atcgtgcgag agggcgcagg gacttccttt gtcccaaatc     
     1561 tggcggagcc gaaatctggg aggcgccgcc gcaccccctc tagcgggcgc gggcgaagcg     
     1621 gtgcggcgcc ggcaggaagg aaatgggcgg ggagggcctt cgtgcgtcgc cgcgccgccg     
     1681 tccccttctc catctccagc ctcggggctg ccgcaggggg acggctgcct tcggggggga     
     1741 cggggcaggg cggggttcgg cttctggcgt gtgaccggcg gctctagagc ctctgctaac     
     1801 catgttcatg ccttcttctt tttcctacag ctcctgggca acgtgctggt tgttgtgctg     
     1861 tctcatcatt ttggcaaaga attggcgcgc cgagctcgtt tagtgaaccg tcagatcgcc     
     1921 tggagacgcc atccacgctg ttttgacctc catagaagaa ccgagtttaa actccctatc     
     1981 agtgatagag atctccctat cagtgataga gagctagcga tatctgactc gagtataagg     
     2041 atgatgacga caaatgagct agcacataac ttacggtaaa tggcccgcct ggctgaccgc     
     2101 ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc     
     2161 aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc     
     2221 caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt     
     2281 acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta     
     2341 ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac     
     2401 ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg     
     2461 ggggggcgcg cgccaggcgg ggcggggcgg ggcgaggggc ggggcggggc gaggcggaga     
     2521 ggtgcggcgg cagccaatca gagcggcgcg ctccaaaagt ttccttttat ggcgaggcgg     
     2581 cggcggcggc ggccctataa aaagcgaagc gcgcggcggg cgggagtcgc tgcgcgctgc     
     2641 cttcgccccg tgccccgctc cgccgccgcc tcgcgccgcc cgccccggct ctgactgacc     
     2701 gcgttactcc cacaggtgag cgggcgggac ggcccttctc ctccgggctg taattagctt     
     2761 cgaacgccac catggtgagc aagggcgagg agctgttcac cggggtggtg cccatcctgg     
     2821 tcgagctgga cggcgacgta aacggccaca agttcagcgt gtccggcgag ggcgagggcg     
     2881 atgccaccta cggcaagctg accctgaagt tcatctgcac caccggcaag ctgcccgtgc     
     2941 cctggcccac cctcgtgacc accttgacct acggcgtgca gtgcttcgcc cgctaccccg     
     3001 accacatgaa gcagcacgac ttcttcaagt ccgccatgcc cgaaggctac gtccaggagc     
     3061 gcaccatctt cttcaaggac gacggcaact acaagacccg cgccgaggtg aagttcgagg     
     3121 gcgacaccct ggtgaaccgc atcgagctga agggcatcga cttcaaggag gacggcaaca     
     3181 tcctggggca caagctggag tacaactaca acagccacaa ggtctatatc accgccgaca     
     3241 agcagaagaa cggcatcaag gtgaacttca agacccgcca caacatcgag gacggcagcg     
     3301 tgcagctcgc cgaccactac cagcagaaca cccccatcgg cgacggcccc gtgctgctgc     
     3361 ccgacaacca ctacctgagc acccagtccg ccctgagcaa agaccccaac gagaagcgcg     
     3421 atcacatggt cctgctggag ttcgtgaccg ccgccgggat cactctcggc atggacgagc     
     3481 tgtacaagta acttaagggg tggcatccct gtgacccctc cccagtgcct ctcctggccc     
     3541 tggaagttgc cactccagtg cccaccagcc ttgtcctaat aaaattaagt tgcatcattt     
     3601 tgtctgacta ggtgtccttc tataatatta tggggtggag gggggtggta tggagcaagg     
     3661 ggcaagttgg gaagacaacc tgtagggcct gcggggtcta ttgggaacca agctggagtg     
     3721 cagtggcaca atcttggctc actgcaatct ccgcctcctg ggttcaagcg attctcctgc     
     3781 ctcagcctcc cgagttgttg ggattccagg catgcatgac caggctcagc taatttttgt     
     3841 ttttttggta gagacggggt ttcaccatat tggccaggct ggtctccaac tcctaatctc     
     3901 aggtgatcta cccaccttgg cctcccaaat tgctgggatt acaggcgtga accactgctc     
     3961 ccttccctgt ccttcacgtg cggaccgagc ggccgcagga acccctagtg atggagttgg     
     4021 ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag gtcgcccgac     
     4081 gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc ctgcaggggc     
     4141 gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atacgtcaaa     
     4201 gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg     
     4261 cagcgtgacc gctacacttg ccagcgcctt agcgcccgct cctttcgctt tcttcccttc     
     4321 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg     
     4381 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg gtgatggttc     
     4441 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt     
     4501 ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct cgggctattc     
     4561 ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg agctgattta     
     4621 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat ggtgcactct     
     4681 cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc caacacccgc     
     4741 tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt     
     4801 ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgagccggga     
     4861 gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg cgcgagacga aagggcctcg     
     4921 tgatacgcct atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg     
     4981 gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa     
     5041 atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga     
     5101 agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc     
     5161 ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg     
     5221 gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc     
     5281 gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat     
     5341 tatcccgtat tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg     
     5401 acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag     
     5461 aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa     
     5521 cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc     
     5581 gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca     
     5641 cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc     
     5701 tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc     
     5761 tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg     
     5821 ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta     
     5881 tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag     
     5941 gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga     
     6001 ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc     
     6061 tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa     
     6121 agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa     
     6181 aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc     
     6241 cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgttcttcta gtgtagccgt     
     6301 agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc     
     6361 tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac     
     6421 gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca     
     6481 gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg     
     6541 ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag     
     6601 gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt     
     6661 ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat     
     6721 ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc     
     6781 acatgt                                                                
                            LOCUS       dna                      6786 bp                                   
FEATURES             Location/Qualifiers
     misc_binding    162..167
                     /dbxref="REBASE:HincII"
     Promoter        545..822
                     /gene="cBA prom"
     ORF             962..1693
                     /sequence="ORF_4 rf(6)"
     misc_binding    1019..1024
                     /dbxref="REBASE:ApaI"
     misc_binding    1783..1788
                     /dbxref="REBASE:XbaI"
     misc_binding    1892..1897
                     /dbxref="REBASE:SacI"
     Regulatory_Seq  1973..2012
                     /gene="tetO reg"
     misc_binding    1989..1994
                     /dbxref="REBASE:BglII"
     misc_binding    2019..2024
                     /dbxref="REBASE:EcoRV"
     misc_binding    2028..2033
                     /dbxref="REBASE:XhoI"
     Promoter        2344..2623
                     /gene="cBA prom"
     ORF             2754..3506
                     /sequence="ORF_3 rf(5)"
     Reporter        2772..3488
                     /gene="EGFP reporter"
     ORF             2772..3491
                     /sequence="ORF_1 rf(3)"
     Terminator      3498..3974
                     /gene="hGH_PA term"
     misc_binding    3810..3815
                     /dbxref="REBASE:SphI"
     Rep_Origin      4229..4535
                     /gene="f1 origin"
     Promoter        5036..5064
                     /gene="amp prom"
     Marker          5106..5966
                     /gene="amp marker"
     ORF             5106..5966
                     /sequence="ORF_2 rf(3)"
     Rep_Origin      6121..6740
                     /gene="pBR322 origin"
BASE COUNT    1364 a   1913 c   1999 g   1510 t    0 others
ORIGIN
        1 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt     
       61 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact     
      121 aggggttcct gcggccgccc taggccggcc acgcgtggcg cgttgacatt gattattgac     
      181 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg     
      241 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt     
      301 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca     
      361 atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc     
      421 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta     
      481 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac     
      541 catgggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac     
      601 ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg     
      661 gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg gggcggggcg aggcggagag     
      721 gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt tccttttatg gcgaggcggc     
      781 ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc gggagtcgct gcgttgcctt     
      841 cgccccgtgc cccgctccgc gccgcctcgc gccgcccgcc ccggctctga ctgaccgcgt     
      901 tactcccaca ggtgagcggg cgggacggcc cttctcctcc gggctgtaat tagcgcttgg     
      961 tttaatgacg gctcgtttct tttctgtggc tgcgtgaaag ccttaaaggg ctccgggagg     
     1021 gccctttgtg cgggggggag cggctcgggg ggtgcgtgcg tgtgtgtgtg cgtggggagc     
     1081 gccgcgtgcg gcccgcgctg cccggcggct gtgagcgctg cgggcgcggc gcggggcttt     
     1141 gtgcgctccg cgtgtgcgcg aggggagcgc ggccgggggc ggtgccccgc ggtgcggggg     
     1201 ggctgcgagg ggaacaaagg ctgcgtgcgg ggtgtgtgcg tgggggggtg agcagggggt     
     1261 gtgggcgcgg cggtcgggct gtaacccccc cctgcacccc cctccccgag ttgctgagca     
     1321 cggcccggct tcgggtgcgg ggctccgtgc ggggcgtggc gcggggctcg ccgtgccggg     
     1381 cggggggtgg cggcaggtgg gggtgccggg cggggcgggg ccgcctcggg ccggggaggg     
     1441 ctcgggggag gggcgcggcg gccccggagc gccggcggct gtcgaggcgc ggcgagccgc     
     1501 agccattgcc ttttatggta atcgtgcgag agggcgcagg gacttccttt gtcccaaatc     
     1561 tggcggagcc gaaatctggg aggcgccgcc gcaccccctc tagcgggcgc gggcgaagcg     
     1621 gtgcggcgcc ggcaggaagg aaatgggcgg ggagggcctt cgtgcgtcgc cgcgccgccg     
     1681 tccccttctc catctccagc ctcggggctg ccgcaggggg acggctgcct tcggggggga     
     1741 cggggcaggg cggggttcgg cttctggcgt gtgaccggcg gctctagagc ctctgctaac     
     1801 catgttcatg ccttcttctt tttcctacag ctcctgggca acgtgctggt tgttgtgctg     
     1861 tctcatcatt ttggcaaaga attggcgcgc cgagctcgtt tagtgaaccg tcagatcgcc     
     1921 tggagacgcc atccacgctg ttttgacctc catagaagaa ccgagtttaa actccctatc     
     1981 agtgatagag atctccctat cagtgataga gagctagcga tatctgactc gagtataagg     
     2041 atgatgacga caaatgagct agcacataac ttacggtaaa tggcccgcct ggctgaccgc     
     2101 ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc     
     2161 aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc     
     2221 caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt     
     2281 acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta     
     2341 ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac     
     2401 ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg     
     2461 ggggggcgcg cgccaggcgg ggcggggcgg ggcgaggggc ggggcggggc gaggcggaga     
     2521 ggtgcggcgg cagccaatca gagcggcgcg ctccaaaagt ttccttttat ggcgaggcgg     
     2581 cggcggcggc ggccctataa aaagcgaagc gcgcggcggg cgggagtcgc tgcgcgctgc     
     2641 cttcgccccg tgccccgctc cgccgccgcc tcgcgccgcc cgccccggct ctgactgacc     
     2701 gcgttactcc cacaggtgag cgggcgggac ggcccttctc ctccgggctg taattagctt     
     2761 cgaacgccac catggtgagc aagggcgagg agctgttcac cggggtggtg cccatcctgg     
     2821 tcgagctgga cggcgacgta aacggccaca agttcagcgt gtccggcgag ggcgagggcg     
     2881 atgccaccta cggcaagctg accctgaagt tcatctgcac caccggcaag ctgcccgtgc     
     2941 cctggcccac cctcgtgacc accttgacct acggcgtgca gtgcttcgcc cgctaccccg     
     3001 accacatgaa gcagcacgac ttcttcaagt ccgccatgcc cgaaggctac gtccaggagc     
     3061 gcaccatctt cttcaaggac gacggcaact acaagacccg cgccgaggtg aagttcgagg     
     3121 gcgacaccct ggtgaaccgc atcgagctga agggcatcga cttcaaggag gacggcaaca     
     3181 tcctggggca caagctggag tacaactaca acagccacaa ggtctatatc accgccgaca     
     3241 agcagaagaa cggcatcaag gtgaacttca agacccgcca caacatcgag gacggcagcg     
     3301 tgcagctcgc cgaccactac cagcagaaca cccccatcgg cgacggcccc gtgctgctgc     
     3361 ccgacaacca ctacctgagc acccagtccg ccctgagcaa agaccccaac gagaagcgcg     
     3421 atcacatggt cctgctggag ttcgtgaccg ccgccgggat cactctcggc atggacgagc     
     3481 tgtacaagta acttaagggg tggcatccct gtgacccctc cccagtgcct ctcctggccc     
     3541 tggaagttgc cactccagtg cccaccagcc ttgtcctaat aaaattaagt tgcatcattt     
     3601 tgtctgacta ggtgtccttc tataatatta tggggtggag gggggtggta tggagcaagg     
     3661 ggcaagttgg gaagacaacc tgtagggcct gcggggtcta ttgggaacca agctggagtg     
     3721 cagtggcaca atcttggctc actgcaatct ccgcctcctg ggttcaagcg attctcctgc     
     3781 ctcagcctcc cgagttgttg ggattccagg catgcatgac caggctcagc taatttttgt     
     3841 ttttttggta gagacggggt ttcaccatat tggccaggct ggtctccaac tcctaatctc     
     3901 aggtgatcta cccaccttgg cctcccaaat tgctgggatt acaggcgtga accactgctc     
     3961 ccttccctgt ccttcacgtg cggaccgagc ggccgcagga acccctagtg atggagttgg     
     4021 ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag gtcgcccgac     
     4081 gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc ctgcaggggc     
     4141 gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atacgtcaaa     
     4201 gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg     
     4261 cagcgtgacc gctacacttg ccagcgcctt agcgcccgct cctttcgctt tcttcccttc     
     4321 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg     
     4381 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg gtgatggttc     
     4441 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt     
     4501 ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct cgggctattc     
     4561 ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg agctgattta     
     4621 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat ggtgcactct     
     4681 cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc caacacccgc     
     4741 tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt     
     4801 ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgagccggga     
     4861 gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg cgcgagacga aagggcctcg     
     4921 tgatacgcct atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg     
     4981 gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa     
     5041 atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga     
     5101 agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc     
     5161 ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg     
     5221 gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc     
     5281 gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat     
     5341 tatcccgtat tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg     
     5401 acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag     
     5461 aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa     
     5521 cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc     
     5581 gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca     
     5641 cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc     
     5701 tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc     
     5761 tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg     
     5821 ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta     
     5881 tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag     
     5941 gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga     
     6001 ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc     
     6061 tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa     
     6121 agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa     
     6181 aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc     
     6241 cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgttcttcta gtgtagccgt     
     6301 agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc     
     6361 tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac     
     6421 gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca     
     6481 gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg     
     6541 ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag     
     6601 gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt     
     6661 ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat     
     6721 ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc     
     6781 acatgt                                                                
                        
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcgggcgaccttt 60
      GGACGTCCGTCGACGCGCGAGCGAGCGAGTGACTCCGGCGGGCCCGCAGCCCGCTGGAAA

61    ggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcact 120
      CCAGCGGGCCGGAGTCACTCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGA

                                                  HincII 
                                                  |
121   aggggttcctgcggccgccctaggccggccacgcgtggcgcgttgacattgattattgac 180
      TCCCCAAGGACGCCGGCGGGATCCGGCCGGTGCGCACCGCGCAACTGTAACTAATAACTG

181   tagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccg 240
      ATCAATAATTATCATTAGTTAATGCCCCAGTAATCAAGTATCGGGTATATACCTCAAGGC

241   cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccatt 300
      GCAATGTATTGAATGCCATTTACCGGGCGGACCGACTGGCGGGTTGCTGGGGGCGGGTAA

301   gacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtca 360
      CTGCAGTTATTACTGCATACAAGGGTATCATTGCGGTTATCCCTGAAAGGTAACTGCAGT

361   atgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcc 420
      TACCCACCTGATAAATGCCATTTGACGGGTGAACCGTCATGTAGTTCACATAGTATACGG

421   aagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagta 480
      TTCATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGACCGTAATACGGGTCAT

481   catgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattac 540
      GTACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCATAATCAGTAGCGATAATG

          cBA prom(545,822)>>> 
          |
541   catgggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccac 600
      GTACCCAGCTCCACTCGGGGTGCAAGACGAAGTGAGAGGGGTAGAGGGGGGGGAGGGGTG

601   ccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcgggggggg 660
      GGGGTTAAAACATAAATAAATAAAAAATTAATAAAACACGTCGCTACCCCCGCCCCCCCC

661   gggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagag 720
      CCCCCGCGCGCGGTCCGCCCCGCCCCGCCCCGCTCCCCGCCCCGCCCCGCTCCGCCTCTC

721   gtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggc 780
      CACGCCGCCGTCGGTTAGTCTCGCCGCGCGAGGCTTTCAAAGGAAAATACCGCTCCGCCG

781   ggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgttgcctt 840
      CCGCCGCCGCCGGGATATTTTTCGCTTCGCGCGCCGCCCGCCCTCAGCGACGCAACGGAA

841   cgccccgtgccccgctccgcgccgcctcgcgccgcccgccccggctctgactgaccgcgt 900
      GCGGGGCACGGGGCGAGGCGCGGCGGAGCGCGGCGGGCGGGGCCGAGACTGACTGGCGCA

901   tactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagcgcttgg 960
      ATGAGGGTGTCCACTCGCCCGCCCTGCCGGGAAGAGGAGGCCCGACATTAATCGCGAACC

       ORF_4 rf(6)(962,1693)<<< 
       |
961   tttaatgacggctcgtttcttttctgtggctgcgtgaaagccttaaagggctccgggagg 1020
      AAATTACTGCCGAGCAAAGAAAAGACACCGACGCACTTTCGGAATTTCCCGAGGCCCTCC

         ApaI 
         |
1021  gccctttgtgcgggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagc 1080
      CGGGAAACACGCCCCCCCTCGCCGAGCCCCCCACGCACGCACACACACACGCACCCCTCG

1081  gccgcgtgcggcccgcgctgcccggcggctgtgagcgctgcgggcgcggcgcggggcttt 1140
      CGGCGCACGCCGGGCGCGACGGGCCGCCGACACTCGCGACGCCCGCGCCGCGCCCCGAAA

1141  gtgcgctccgcgtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcggggg 1200
      CACGCGAGGCGCACACGCGCTCCCCTCGCGCCGGCCCCCGCCACGGGGCGCCACGCCCCC

1201  ggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggt 1260
      CCGACGCTCCCCTTGTTTCCGACGCACGCCCCACACACGCACCCCCCCACTCGTCCCCCA

1261  gtgggcgcggcggtcgggctgtaacccccccctgcacccccctccccgagttgctgagca 1320
      CACCCGCGCCGCCAGCCCGACATTGGGGGGGGACGTGGGGGGAGGGGCTCAACGACTCGT

1321  cggcccggcttcgggtgcggggctccgtgcggggcgtggcgcggggctcgccgtgccggg 1380
      GCCGGGCCGAAGCCCACGCCCCGAGGCACGCCCCGCACCGCGCCCCGAGCGGCACGGCCC

1381  cggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggaggg 1440
      GCCCCCCACCGCCGTCCACCCCCACGGCCCGCCCCGCCCCGGCGGAGCCCGGCCCCTCCC

1441  ctcgggggaggggcgcggcggccccggagcgccggcggctgtcgaggcgcggcgagccgc 1500
      GAGCCCCCTCCCCGCGCCGCCGGGGCCTCGCGGCCGCCGACAGCTCCGCGCCGCTCGGCG

1501  agccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatc 1560
      TCGGTAACGGAAAATACCATTAGCACGCTCTCCCGCGTCCCTGAAGGAAACAGGGTTTAG

1561  tggcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcgggcgaagcg 1620
      ACCGCCTCGGCTTTAGACCCTCCGCGGCGGCGTGGGGGAGATCGCCCGCGCCCGCTTCGC

1621  gtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccg 1680
      CACGCCGCGGCCGTCCTTCCTTTACCCGCCCCTCCCGGAAGCACGCAGCGGCGCGGCGGC

1681  tccccttctccatctccagcctcggggctgccgcagggggacggctgccttcggggggga 1740
      AGGGGAAGAGGTAGAGGTCGGAGCCCCGACGGCGTCCCCCTGCCGACGGAAGCCCCCCCT

                                                 XbaI 
                                                 |
1741  cggggcagggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaac 1800
      GCCCCGTCCCGCCCCAAGCCGAAGACCGCACACTGGCCGCCGAGATCTCGGAGACGATTG

1801  catgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttgttgtgctg 1860
      GTACAAGTACGGAAGAAGAAAAAGGATGTCGAGGACCCGTTGCACGACCAACAACACGAC

                                          SacI 
                                          |
1861  tctcatcattttggcaaagaattggcgcgccgagctcgtttagtgaaccgtcagatcgcc 1920
      AGAGTAGTAAAACCGTTTCTTAACCGCGCGGCTCGAGCAAATCACTTGGCAGTCTAGCGG

                                                          tetO reg(1973,2012)>>> 
                                                          |
1921  tggagacgccatccacgctgttttgacctccatagaagaaccgagtttaaactccctatc 1980
      ACCTCTGCGGTAGGTGCGACAAAACTGGAGGTATCTTCTTGGCTCAAATTTGAGGGATAG

               BglII                           EcoRV  XhoI 
               |                               |      |
1981  agtgatagagatctccctatcagtgatagagagctagcgatatctgactcgagTATAAGG 2040
      TCACTATCTCTAGAGGGATAGTCACTATCTCTCGATCGCTATAGACTGAGCTCATATTCC

2041  ATGATGACGACAAATGAGCTAGCACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC 2100
      TACTACTGCTGTTTACTCGATCGTGTATTGAATGCCATTTACCGGGCGGACCGACTGGCG

2101  CCAACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTC 2160
      GGTTGCTGGGGGCGGGTAACTGCAGTTATCATTGCGGTTATCCCTGAAAGGTAACTGCAG

2161  AATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGC 2220
      TTACCCACCTCATAAATGCCATTTGACGGGTGAACCGTCATGTAGTTCACATAGTATACG

2221  CAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGT 2280
      GTTCATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGACCGTAACACGGGTCA

2281  ACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTA 2340
      TGTACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCATAATCAGTAGCGATAAT

         cBA prom(2344,2623)>>> 
         |
2341  CCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCAC 2400
      GGTACCAGCTCCACTCGGGGTGCAAGACGAAGTGAGAGGGGTAGAGGGGGGGGAGGGGTG

2401  CCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGG 2460
      GGGGTTAAAACATAAATAAATAAAAAATTAATAAAACACGTCGCTACCCCCGCCCCCCCC

2461  GGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGA 2520
      CCCCCCGCGCGCGGTCCGCCCCGCCCCGCCCCGCTCCCCGCCCCGCCCCGCTCCGCCTCT

2521  GGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCAAAAGTTTCCTTTTATGGCGAGGCGG 2580
      CCACGCCGCCGTCGGTTAGTCTCGCCGCGCGAGGTTTTCAAAGGAAAATACCGCTCCGCC

2581  CGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGC 2640
      GCCGCCGCCGCCGGGATATTTTTCGCTTCGCGCGCCGCCCGCCCTCAGCGACGCGCGACG

2641  CTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACC 2700
      GAAGCGGGGCACGGGGCGAGGCGGCGGCGGAGCGCGGCGGGCGGGGCCGAGACTGACTGG

                                                           ORF_3 rf(5)(2754,3506)<<< 
                                                           |
2701  GCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCTT 2760
      CGCAATGAGGGTGTCCACTCGCCCGCCCTGCCGGGAAGAGGAGGCCCGACATTAATCGAA

                 ORF_1 rf(3)(2772,3491)>>> 
                 |
                 EGFP reporter(2772,3488)>>> 
                 |
2761  CGAACGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG 2820
      GCTTGCGGTGGTACCACTCGTTCCCGCTCCTCGACAAGTGGCCCCACCACGGGTAGGACC

2821  TCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCG 2880
      AGCTCGACCTGCCGCTGCATTTGCCGGTGTTCAAGTCGCACAGGCCGCTCCCGCTCCCGC

2881  ATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGC 2940
      TACGGTGGATGCCGTTCGACTGGGACTTCAAGTAGACGTGGTGGCCGTTCGACGGGCACG

2941  CCTGGCCCACCCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCG 3000
      GGACCGGGTGGGAGCACTGGTGGAACTGGATGCCGCACGTCACGAAGCGGGCGATGGGGC

3001  ACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGC 3060
      TGGTGTACTTCGTCGTGCTGAAGAAGTTCAGGCGGTACGGGCTTCCGATGCAGGTCCTCG

3061  GCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGG 3120
      CGTGGTAGAAGAAGTTCCTGCTGCCGTTGATGTTCTGGGCGCGGCTCCACTTCAAGCTCC

3121  GCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACA 3180
      CGCTGTGGGACCACTTGGCGTAGCTCGACTTCCCGTAGCTGAAGTTCCTCCTGCCGTTGT

3181  TCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGACA 3240
      AGGACCCCGTGTTCGACCTCATGTTGATGTTGTCGGTGTTCCAGATATAGTGGCGGCTGT

3241  AGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCG 3300
      TCGTCTTCTTGCCGTAGTTCCACTTGAAGTTCTGGGCGGTGTTGTAGCTCCTGCCGTCGC

3301  TGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGC 3360
      ACGTCGAGCGGCTGGTGATGGTCGTCTTGTGGGGGTAGCCGCTGCCGGGGCACGACGACG

3361  CCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCG 3420
      GGCTGTTGGTGATGGACTCGTGGGTCAGGCGGGACTCGTTTCTGGGGTTGCTCTTCGCGC

3421  ATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGC 3480
      TAGTGTACCAGGACGACCTCAAGCACTGGCGGCGGCCCTAGTGAGAGCCGTACCTGCTCG

                       hGH_PA term(3498,3974)>>> 
                       |
3481  TGTACAAGTAActtaaggggtggcatccctgtgacccctccccagtgcctctcctggccc 3540
      ACATGTTCATTGAATTCCCCACCGTAGGGACACTGGGGAGGGGTCACGGAGAGGACCGGG

3541  tggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattt 3600
      ACCTTCAACGGTGAGGTCACGGGTGGTCGGAACAGGATTATTTTAATTCAACGTAGTAAA

3601  tgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaagg 3660
      ACAGACTGATCCACAGGAAGATATTATAATACCCCACCTCCCCCCACCATACCTCGTTCC

3661  ggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtg 3720
      CCGTTCAACCCTTCTGTTGGACATCCCGGACGCCCCAGATAACCCTTGGTTCGACCTCAC

3721  cagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgc 3780
      GTCACCGTGTTAGAACCGAGTGACGTTAGAGGCGGAGGACCCAAGTTCGCTAAGAGGACG

                                        SphI 
                                        |
3781  ctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgt 3840
      GAGTCGGAGGGCTCAACAACCCTAAGGTCCGTACGTACTGGTCCGAGTCGATTAAAAACA

3841  ttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctc 3900
      AAAAAACCATCTCTGCCCCAAAGTGGTATAACCGGTCCGACCAGAGGTTGAGGATTAGAG

3901  aggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctc 3960
      TCCACTAGATGGGTGGAACCGGAGGGTTTAACGACCCTAATGTCCGCACTTGGTGACGAG

3961  ccttccctgtccttcacgtgcggaccgagcggccgcaggaacccctagtgatggagttgg 4020
      GGAAGGGACAGGAAGTGCACGCCTGGCTCGCCGGCGTCCTTGGGGATCACTACCTCAACC

4021  ccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgac 4080
      GGTGAGGGAGAGACGCGCGAGCGAGCGAGTGACTCCGGCCCGCTGGTTTCCAGCGGGCTG

4081  gcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggc 4140
      CGGGCCCGAAACGGGCCCGCCGGAGTCACTCGCTCGCTCGCGCGTCGACGGACGTCCCCG

4141  gcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatacgtcaaa 4200
      CGGACTACGCCATAAAAGAGGAATGCGTAGACACGCCATAAAGTGTGGCGTATGCAGTTT

                                  f1 origin(4229,4535)>>> 
                                  |
4201  gcaaccatagtacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcg 4260
      CGTTGGTATCATGCGCGGGACATCGCCGCGTAATTCGCGCCGCCCACACCACCAATGCGC

4261  cagcgtgaccgctacacttgccagcgccttagcgcccgctcctttcgctttcttcccttc 4320
      GTCGCACTGGCGATGTGAACGGTCGCGGAATCGCGGGCGAGGAAAGCGAAAGAAGGGAAG

4321  ctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagg 4380
      GAAAGAGCGGTGCAAGCGGCCGAAAGGGGCAGTTCGAGATTTAGCCCCCGAGGGAAATCC

4381  gttccgatttagtgctttacggcacctcgaccccaaaaaacttgatttgggtgatggttc 4440
      CAAGGCTAAATCACGAAATGCCGTGGAGCTGGGGTTTTTTGAACTAAACCCACTACCAAG

4441  acgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgtt 4500
      TGCATCACCCGGTAGCGGGACTATCTGCCAAAAAGCGGGAAACTGCAACCTCAGGTGCAA

4501  ctttaatagtggactcttgttccaaactggaacaacactcaactctatctcgggctattc 4560
      GAAATTATCACCTGAGAACAAGGTTTGACCTTGTTGTGAGTTGAGATAGAGCCCGATAAG

4561  ttttgatttataagggattttgccgatttcggtctattggttaaaaaatgagctgattta 4620
      AAAACTAAATATTCCCTAAAACGGCTAAAGCCAGATAACCAATTTTTTACTCGACTAAAT

4621  acaaaaatttaacgcgaattttaacaaaatattaacgtttacaattttatggtgcactct 4680
      TGTTTTTAAATTGCGCTTAAAATTGTTTTATAATTGCAAATGTTAAAATACCACGTGAGA

4681  cagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgc 4740
      GTCATGTTAGACGAGACTACGGCGTATCAATTCGGTCGGGGCTGTGGGCGGTTGTGGGCG

4741  tgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgt 4800
      ACTGCGCGGGACTGCCCGAACAGACGAGGGCCGTAGGCGAATGTCTGTTCGACACTGGCA

4801  ctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagccggga 4860
      GAGGCCCTCGACGTACACAGTCTCCAAAAGTGGCAGTAGTGGCTTTGCGCGCTCGGCCCT

4861  gctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcg 4920
      CGACGTACACAGTCTCCAAAAGTGGCAGTAGTGGCTTTGCGCGCTCTGCTTTCCCGGAGC

4921  tgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtg 4980
      ACTATGCGGATAAAAATATCCAATTACAGTACTATTATTACCAAAGAATCTGCAGTCCAC

                                                             amp prom(5036,5064)>>> 
                                                             |
4981  gcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaa 5040
      CGTGAAAAGCCCCTTTACACGCGCCTTGGGGATAAACAAATAAAAAGATTTATGTAAGTT

5041  atatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaagga 5100
      TATACATAGGCGAGTACTCTGTTATTGGGACTATTTACGAAGTTATTATAACTTTTTCCT

           ORF_2 rf(3)(5106,5966)>>> 
           |
           amp marker(5106,5966)>>> 
           |
5101  agagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgcc 5160
      TCTCATACTCATAAGTTGTAAAGGCACAGCGGGAATAAGGGAAAAAACGCCGTAAAACGG

5161  ttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgg 5220
      AAGGACAAAAACGAGTGGGTCTTTGCGACCACTTTCATTTTCTACGACTTCTAGTCAACC

5221  gtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttc 5280
      CACGTGCTCACCCAATGTAGCTTGACCTAGAGTTGTCGCCATTCTAGGAACTCTCAAAAG

5281  gccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtat 5340
      CGGGGCTTCTTGCAAAAGGTTACTACTCGTGAAAATTTCAAGACGATACACCGCGCCATA

5341  tatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatg 5400
      ATAGGGCATAACTGCGGCCCGTTCTCGTTGAGCCAGCGGCGTATGTGATAAGAGTCTTAC

5401  acttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagag 5460
      TGAACCAACTCATGAGTGGTCAGTGTCTTTTCGTAGAATGCCTACCGTACTGTCATTCTC

5461  aattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaa 5520
      TTAATACGTCACGACGGTATTGGTACTCACTATTGTGACGCCGGTTGAATGAAGACTGTT

5521  cgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactc 5580
      GCTAGCCTCCTGGCTTCCTCGATTGGCGAAAAAACGTGTTGTACCCCCTAGTACATTGAG

5581  gccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacacca 5640
      CGGAACTAGCAACCCTTGGCCTCGACTTACTTCGGTATGGTTTGCTGCTCGCACTGTGGT

5641  cgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactc 5700
      GCTACGGACATCGTTACCGTTGTTGCAACGCGTTTGATAATTGACCGCTTGATGAATGAG

5701  tagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttc 5760
      ATCGAAGGGCCGTTGTTAATTATCTGACCTACCTCCGCCTATTTCAACGTCCTGGTGAAG

5761  tgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtg 5820
      ACGCGAGCCGGGAAGGCCGACCGACCAAATAACGACTATTTAGACCTCGGCCACTCGCAC

5821  ggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagtta 5880
      CCAGAGCGCCATAGTAACGTCGTGACCCCGGTCTACCATTCGGGAGGGCATAGCATCAAT

5881  tctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagatag 5940
      AGATGTGCTGCCCCTCAGTCCGTTGATACCTACTTGCTTTATCTGTCTAGCGACTCTATC

5941  gtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttaga 6000
      CACGGAGTGACTAATTCGTAACCATTGACAGTCTGGTTCAAATGAGTATATATGAAATCT

6001  ttgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatc 6060
      AACTAAATTTTGAAGTAAAAATTAAATTTTCCTAGATCCACTTCTAGGAAAAACTATTAG

6061  tcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaa 6120
      AGTACTGGTTTTAGGGAATTGCACTCAAAAGCAAGGTGACTCGCAGTCTGGGGCATCTTT

      pBR322 origin(6121,6740)>>> 
      |
6121  agatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaa 6180
      TCTAGTTTCCTAGAAGAACTCTAGGAAAAAAAGACGCGCATTAGACGACGAACGTTTGTT

6181  aaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttc 6240
      TTTTTGGTGGCGATGGTCGCCACCAAACAAACGGCCTAGTTCTCGATGGTTGAGAAAAAG

6241  cgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgt 6300
      GCTTCCATTGACCGAAGTCGTCTCGCGTCTATGGTTTATGACAAGAAGATCACATCGGCA

6301  agttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcc 6360
      TCAATCCGGTGGTGAAGTTCTTGAGACATCGTGGCGGATGTATGGAGCGAGACGATTAGG

6361  tgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagac 6420
      ACAATGGTCACCGACGACGGTCACCGCTATTCAGCACAGAATGGCCCAACCTGAGTTCTG

6421  gatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagccca 6480
      CTATCAATGGCCTATTCCGCGTCGCCAGCCCGACTTGCCCCCCAAGCACGTGTGTCGGGT

6481  gcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcg 6540
      CGAACCTCGCTTGCTGGATGTGGCTTGACTCTATGGATGTCGCACTCGATACTCTTTCGC

6541  ccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacag 6600
      GGTGCGAAGGGCTTCCCTCTTTCCGCCTGTCCATAGGCCATTCGCCGTCCCAGCCTTGTC

6601  gagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggt 6660
      CTCTCGCGTGCTCCCTCGAAGGTCCCCCTTTGCGGACCATAGAAATATCAGGACAGCCCA

6661  ttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctat 6720
      AAGCGGTGGAGACTGAACTCGCAGCTAAAAACACTACGAGCAGTCCCCCCGCCTCGGATA

6721  ggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctc 6780
      CCTTTTTGCGGTCGTTGCGCCGGAAAAATGCCAAGGACCGGAAAACGACCGGAAAACGAG

6781  acatgt 6786
      TGTACA
                            LOCUS       dna                      6786 bp                                   
FEATURES             Location/Qualifiers
     misc_binding    162..167
                     /dbxref="REBASE:HincII"
     Promoter        545..822
                     /gene="cBA prom"
     ORF             962..1693
                     /sequence="ORF_4 rf(6)"
     misc_binding    1019..1024
                     /dbxref="REBASE:ApaI"
     misc_binding    1783..1788
                     /dbxref="REBASE:XbaI"
     misc_binding    1892..1897
                     /dbxref="REBASE:SacI"
     Regulatory_Seq  1973..2012
                     /gene="tetO reg"
     misc_binding    1989..1994
                     /dbxref="REBASE:BglII"
     misc_binding    2019..2024
                     /dbxref="REBASE:EcoRV"
     misc_binding    2028..2033
                     /dbxref="REBASE:XhoI"
     Promoter        2344..2623
                     /gene="cBA prom"
     ORF             2754..3506
                     /sequence="ORF_3 rf(5)"
     Reporter        2772..3488
                     /gene="EGFP reporter"
     ORF             2772..3491
                     /sequence="ORF_1 rf(3)"
     Terminator      3498..3974
                     /gene="hGH_PA term"
     misc_binding    3810..3815
                     /dbxref="REBASE:SphI"
     Rep_Origin      4229..4535
                     /gene="f1 origin"
     Promoter        5036..5064
                     /gene="amp prom"
     Marker          5106..5966
                     /gene="amp marker"
     ORF             5106..5966
                     /sequence="ORF_2 rf(3)"
     Rep_Origin      6121..6740
                     /gene="pBR322 origin"
BASE COUNT    1364 a   1913 c   1999 g   1510 t    0 others