pAAV-G-CMV-CBH-gcGFP-Blank-Amp

Vector Name pAAV-G-CMV-CBH-gcGFP-Blank-Amp
Antibiotic Information Ampicillin
Sequencing Primers CMV-F: CGCAAATGGGCGGTAGGCGTG
Additional Information No Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.
1 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 61 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 121 aggggttcct gcggccgcCC TAGGcgttac ataacttacg gtaaatggcc cgcctggctg 181 accgcccaac gacccccgcc cattgacgtc aataatgacg tatgttccca tagtaacgcc 241 aatagggact ttccattgac gtcaatgggt ggagtattta cggtaaactg cccacttggc 301 agtacatcaa gtgtatcata tgccaagtac gccccctatt gacgtcaatg acggtaaatg 361 gcccgcctgg cattatgccc agtacatgac cttatgggac tttcctactt ggcagtacat 421 ctacgtttag tcatcgctat taccatggtg atgcggtttt ggcagtacat caatgggcgt 481 ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt caatgggagt 541 ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaacaactc cgccccattg 601 acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc tcgtttagtg 661 aaccgtcaga tcgcctggag acgccatcca cgctgttttg acctccatag aagaaccgag 721 tttaaactcc ctatcagtga tagagatctc cctatcagtg atagagagct agcgatatca 781 acaagtttgt acaaaaaagc tgaacgagaa acgtaaaatg atataaatat caatatatta 841 aattagattt tgcataaaaa acagactaca taatactgta aaacacaaca tatccagtca 901 ctatggcggc cgcattaggc accccaggct ttacacttta tgcttccggc tcgtataatg 961 tgtggatttt gagttaggat ccgtcgagat tttcaggagc taaggaagct aaaatggaga 1021 aaaaaatcac tggatatacc accgttgata tatcccaatg gcatcgtaaa gaacattttg 1081 aggcatttca gtcagttgct caatgtacct ataaccagac cgttcagctg gatattacgg 1141 cctttttaaa gaccgtaaag aaaaataagc acaagtttta tccggccttt attcacattc 1201 ttgcccgcct gatgaatgct catccggaat tccgtatggc aatgaaagac ggtgagctgg 1261 tgatatggga tagtgttcac ccttgttaca ccgttttcca tgagcaaact gaaacgtttt 1321 catcgctctg gagtgaatac cacgacgatt tccggcagtt tctacacata tattcgcaag 1381 atgtggcgtg ttacggtgaa aacctggcct atttccctaa agggtttatt gagaatatgt 1441 ttttcgtctc agccaatccc tgggtgagtt tcaccagttt tgatttaaac gtggccaata 1501 tggacaactt cttcgccccc gttttcacca tgggcaaata ttatacgcaa ggcgacaagg 1561 tgctgatgcc gctggcgatt caggttcatc atgccgtttg tgatggcttc catgtcggca 1621 gaatgcttaa tgaattacaa cagtactgcg atgagtggca gggcggggcg taaagatctg 1681 gatccggctt actaaaagcc agataacagt atgcgtattt gcgcgctgat ttttgcggta 1741 taagaatata tactgatatg tatacccgaa gtatgtcaaa aagaggtatg ctatgaagca 1801 gcgtattaca gtgacagttg acagcgacag ctatcagttg ctcaaggcat atatgatgtc 1861 aatatctccg gtctggtaag cacaaccatg cagaatgaag cccgtcgtct gcgtgccgaa 1921 cgctggaaag cggaaaatca ggaagggatg gctgaggtcg cccggtttat tgaaatgaac 1981 ggctcttttg ctgacgagaa caggggctgg tgaaatgcag tttaaggttt acacctataa 2041 aagagagagc cgttatcgtc tgtttgtgga tgtacagagt gatattattg acacgcccgg 2101 gcgacggatg gtgatccccc tggccagtgc acgtctgctg tcagataaag tctcccgtga 2161 actttacccg gtggtgcata tcggggatga aagctggcgc atgatgacca ccgatatggc 2221 cagtgtgccg gtctccgtta tcggggaaga agtggctgat ctcagccacc gcgaaaatga 2281 catcaaaaac gccattaacc tgatgttctg gggaatataa atgtcaggct cccttataca 2341 cagccagtct gcaggtcgac catagtgact ggatatgttg tgttttacag tattatgtag 2401 tctgtttttt atgcaaaatc taatttaata tattgatatt tatatcattt tacgtttctc 2461 gttcagcttt cttgtacaaa gtggttgata tctgactcga gTATAAGGAT GATGACGACA 2521 AATGAGCTAG CACATAACTT ACGGTAAATG GCCCGCCTGG CTGACCGCCC AACGACCCCC 2581 GCCCATTGAC GTCAATAGTA ACGCCAATAG GGACTTTCCA TTGACGTCAA TGGGTGGAGT 2641 ATTTACGGTA AACTGCCCAC TTGGCAGTAC ATCAAGTGTA TCATATGCCA AGTACGCCCC 2701 CTATTGACGT CAATGACGGT AAATGGCCCG CCTGGCATTG TGCCCAGTAC ATGACCTTAT 2761 GGGACTTTCC TACTTGGCAG TACATCTACG TATTAGTCAT CGCTATTACC ATGGTCGAGG 2821 TGAGCCCCAC GTTCTGCTTC ACTCTCCCCA TCTCCCCCCC CTCCCCACCC CCAATTTTGT 2881 ATTTATTTAT TTTTTAATTA TTTTGTGCAG CGATGGGGGC GGGGGGGGGG GGGGCGCGCG 2941 CCAGGCGGGG CGGGGCGGGG CGAGGGGCGG GGCGGGGCGA GGCGGAGAGG TGCGGCGGCA 3001 GCCAATCAGA GCGGCGCGCT CCAAAAGTTT CCTTTTATGG CGAGGCGGCG GCGGCGGCGG 3061 CCCTATAAAA AGCGAAGCGC GCGGCGGGCG GGAGTCGCTG CGCGCTGCCT TCGCCCCGTG 3121 CCCCGCTCCG CCGCCGCCTC GCGCCGCCCG CCCCGGCTCT GACTGACCGC GTTACTCCCA 3181 CAGGTGAGCG GGCGGGACGG CCCTTCTCCT CCGGGCTGTA ATTAGCTTCG AACGCCACCA 3241 TGGTGAGCAA GGGCGAGGAG CTGTTCACCG GGGTGGTGCC CATCCTGGTC GAGCTGGACG 3301 GCGACGTAAA CGGCCACAAG TTCAGCGTGT CCGGCGAGGG CGAGGGCGAT GCCACCTACG 3361 GCAAGCTGAC CCTGAAGTTC ATCTGCACCA CCGGCAAGCT GCCCGTGCCC TGGCCCACCC 3421 TCGTGACCAC CTTGACCTAC GGCGTGCAGT GCTTCGCCCG CTACCCCGAC CACATGAAGC 3481 AGCACGACTT CTTCAAGTCC GCCATGCCCG AAGGCTACGT CCAGGAGCGC ACCATCTTCT 3541 TCAAGGACGA CGGCAACTAC AAGACCCGCG CCGAGGTGAA GTTCGAGGGC GACACCCTGG 3601 TGAACCGCAT CGAGCTGAAG GGCATCGACT TCAAGGAGGA CGGCAACATC CTGGGGCACA 3661 AGCTGGAGTA CAACTACAAC AGCCACAAGG TCTATATCAC CGCCGACAAG CAGAAGAACG 3721 GCATCAAGGT GAACTTCAAG ACCCGCCACA ACATCGAGGA CGGCAGCGTG CAGCTCGCCG 3781 ACCACTACCA GCAGAACACC CCCATCGGCG ACGGCCCCGT GCTGCTGCCC GACAACCACT 3841 ACCTGAGCAC CCAGTCCGCC CTGAGCAAAG ACCCCAACGA GAAGCGCGAT CACATGGTCC 3901 TGCTGGAGTT CGTGACCGCC GCCGGGATCA CTCTCGGCAT GGACGAGCTG TACAAGTAAc 3961 ttaaggggtg gcatccctgt gacccctccc cagtgcctct cctggccctg gaagttgcca 4021 ctccagtgcc caccagcctt gtcctaataa aattaagttg catcattttg tctgactagg 4081 tgtccttcta taatattatg gggtggaggg gggtggtatg gagcaagggg caagttggga 4141 agacaacctg tagggcctgc ggggtctatt gggaaccaag ctggagtgca gtggcacaat 4201 cttggctcac tgcaatctcc gcctcctggg ttcaagcgat tctcctgcct cagcctcccg 4261 agttgttggg attccaggca tgcatgacca ggctcagcta atttttgttt ttttggtaga 4321 gacggggttt caccatattg gccaggctgg tctccaactc ctaatctcag gtgatctacc 4381 caccttggcc tcccaaattg ctgggattac aggcgtgaac cactgctccc ttccctgtcc 4441 ttcacgtgcg gaccgagcgg ccgcaggaac ccctagtgat ggagttggcc actccctctc 4501 tgcgcgctcg ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc ccgggctttg 4561 cccgggcggc ctcagtgagc gagcgagcgc gcagctgcct gcaggggcgc ctgatgcggt 4621 attttctcct tacgcatctg tgcggtattt cacaccgcat acgtcaaagc aaccatagta 4681 cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc 4741 tacacttgcc agcgccttag cgcccgctcc tttcgctttc ttcccttcct ttctcgccac 4801 gttcgccggc tttccccgtc aagctctaaa tcgggggctc cctttagggt tccgatttag 4861 tgctttacgg cacctcgacc ccaaaaaact tgatttgggt gatggttcac gtagtgggcc 4921 atcgccctga tagacggttt ttcgcccttt gacgttggag tccacgttct ttaatagtgg 4981 actcttgttc caaactggaa caacactcaa ctctatctcg ggctattctt ttgatttata 5041 agggattttg ccgatttcgg tctattggtt aaaaaatgag ctgatttaac aaaaatttaa 5101 cgcgaatttt aacaaaatat taacgtttac aattttatgg tgcactctca gtacaatctg 5161 ctctgatgcc gcatagttaa gccagccccg acacccgcca acacccgctg acgcgccctg 5221 acgggcttgt ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg 5281 catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg agccgggagc tgcatgtgtc 5341 agaggttttc accgtcatca ccgaaacgcg cgagacgaaa gggcctcgtg atacgcctat 5401 ttttataggt taatgtcatg ataataatgg tttcttagac gtcaggtggc acttttcggg 5461 gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat atgtatccgc 5521 tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag agtatgagta 5581 ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt cctgtttttg 5641 ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg 5701 gttacatcga actggatctc aacagcggta agatccttga gagttttcgc cccgaagaac 5761 gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta tcccgtattg 5821 acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac ttggttgagt 5881 actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa ttatgcagtg 5941 ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg atcggaggac 6001 cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt 6061 gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg atgcctgtag 6121 caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta gcttcccggc 6181 aacaattaat agactggatg gaggcggata aagttgcagg accacttctg cgctcggccc 6241 ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggg tctcgcggta 6301 tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc tacacgacgg 6361 ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt gcctcactga 6421 ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt gatttaaaac 6481 ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa 6541 tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat 6601 cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc 6661 taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg 6721 gcttcagcag agcgcagata ccaaatactg ttcttctagt gtagccgtag ttaggccacc 6781 acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg 6841 ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg 6901 ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa 6961 cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc acgcttcccg 7021 aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga gagcgcacga 7081 gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt cgccacctct 7141 gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg aaaaacgcca 7201 gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac atgt