pLenti-Bmi1

Vector Name pLenti-Bmi1
VectorType Lentiviral Plasmid
Antibiotic Information Bacterial: Kanamycin. Mammalian: Puromycin.
Sequencing Primers CMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
SV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional Information The gene expression is driven by a CMV promoter, without any Tag or reporter.
Vector with Insert: 9004bp
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.
Insert sequence: 
atgcatcgaacaacgagaatcaagatcactgagctaaatccccacctgatgtgtgtgctt
tgtggagggtacttcattgatgccacaaccataatagaatgtctacattccttctgtaaa
acgtgtattgttcgttacctggagaccagcaagtattgtcctatttgtgatgtccaagtt
cacaagaccagaccactactgaatataaggtcagataaaactctccaagatattgtatac
aaattagttccagggcttttcaaaaatgaaatgaagagaagaagggatttttatgcagct
catccttctgctgatgctgccaatggctctaatgaagatagaggagaggttgcagatgaa
gataagagaattataactgatgatgagataataagcttatccattgaattctttgaccag
aacagattggatcggaaagtaaacaaagacaaagagaaatctaaggaggaggtgaatgat
aaaagatacttacgatgcccagcagcaatgactgtgatgcacttaagaaagtttctcaga
agtaaaatggacatacctaatactttccagattgatgtcatgtatgaggaggaaccttta
aaggattattatacactaatggatattgcctacatttatacctggagaaggaatggtcca
cttccattgaaatacagagttcgacctacttgtaaaagaatgaagatcagtcaccagaga
gatggactgacaaatgctggagaactggaaagtgactctgggagtgacaaggccaacagc
ccagcaggaggtattccctccacctcttcttgtttgcctagccccagtactccagtgcag
tctcctcatccacagtttcctcacatttccagtactatgaatggaaccagcaacagcccc
agcggtaaccaccaatcttcttttgccaatagacctcgaaaatcatcagtaaatgggtca
tcagcaacttcttctggttga