pLenti-GIII-CMV-DIO-SV40-GFP

Vector Name pLenti-GIII-CMV-DIO-SV40-GFP
VectorType Lentiviral Vector
Antibiotic Information Kanamycin
Sequencing Primers CMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
Additional Information No Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.
        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta     
      481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag     
      541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg     
      601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact     
      661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct     
      721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt     
      781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac     
      841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc     
      901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc     
      961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa     
     1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg     
     1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata     
     1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc     
     1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga     
     1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc     
     1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca     
     1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag     
     1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta     
     1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga     
     1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg     
     1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg     
     1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc     
     1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg     
     1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat     
     1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac     
     1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat     
     1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca     
     2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga     
     2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg     
     2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa     
     2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga     
     2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag     
     2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa     
     2401 aattcaaaat tttcgggttt ttcgaaccta gggttccgcg ttacataact tacggtaaat     
     2461 ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt     
     2521 cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa     
     2581 actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc     
     2641 aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct     
     2701 acttggcagt acatctacgt ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt     
     2761 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg     
     2821 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca     
     2881 actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca     
     2941 gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc     
     3001 atagaagaac cgagtttaaa ctccctatca gtgatagaga tctccctatc agtgatagag     
     3061 agctagcccc gggatcgatc aattgagtac ttacgtaggt accaatcagc tcgctcacca     
     3121 tataacttcg tataaagtat cctatacgaa gttatatcaa aataggaaga ccaatgcttc     
     3181 accatcgacc cgaattgcca agcatcacca tcgacccata acttcgtata atgtatgcta     
     3241 tacgaagtta tctcgagtca gatatcaacc actttgtaca agaaagctga acgagaaacg     
     3301 taaaatgata taaatatcaa tatattaaat tagattttgc ataaaaaaca gactacataa     
     3361 tactgtaaaa cacaacatat ccagtcacta tggtcgacct gcagactggc tgtgtataag     
     3421 ggagcctgac atttatattc cccagaacat caggttaatg gcgtttttga tgtcattttc     
     3481 gcggtggctg agatcagcca cttcttcccc gataacggag accggcacac tggccatatc     
     3541 ggtggtcatc atgcgccagc tttcatcccc gatatgcacc accgggtaaa gttcacggga     
     3601 gactttatct gacagcagac gtgcactggc cagggggatc accatccgtc gcccgggcgt     
     3661 gtcaataata tcactctgta catccacaaa cagacgataa cggctctctc ttttataggt     
     3721 gtaaacctta aactgcattt caccagcccc tgttctcgtc agcaaaagag ccgttcattt     
     3781 caataaaccg ggcgacctca gccatccctt cctgattttc cgctttccag cgttcggcac     
     3841 gcagacgacg ggcttcattc tgcatggttg tgcttaccag accggagata ttgacatcat     
     3901 atatgccttg agcaactgat agctgtcgct gtcaactgtc actgtaatac gctgcttcat     
     3961 agcatacctc tttttgacat acttcgggta tacatatcag tatatattct tataccgcaa     
     4021 aaatcagcgc gcaaatacgc atactgttat ctggctttta gtaagccgga tccagatctt     
     4081 tacgccccgc cctgccactc atcgcagtac tgttgtaatt cattaagcat tctgccgaca     
     4141 tggaagccat cacaaacggc atgatgaacc tgaatcgcca gcggcatcag caccttgtcg     
     4201 ccttgcgtat aatatttgcc catggtgaaa acgggggcga agaagttgtc catattggcc     
     4261 acgtttaaat caaaactggt gaaactcacc cagggattgg ctgagacgaa aaacatattc     
     4321 tcaataaacc ctttagggaa ataggccagg ttttcaccgt aacacgccac atcttgcgaa     
     4381 tatatgtgta gaaactgccg gaaatcgtcg tggtattcac tccagagcga tgaaaacgtt     
     4441 tcagtttgct catggaaaac ggtgtaacaa gggtgaacac tatcccatat caccagctca     
     4501 ccgtctttca ttgccatacg gaattccgga tgagcattca tcaggcgggc aagaatgtga     
     4561 ataaaggccg gataaaactt gtgcttattt ttctttacgg tctttaaaaa ggccgtaata     
     4621 tccagctgaa cggtctggtt ataggtacat tgagcaactg actgaaatgc ctcaaaatgt     
     4681 tctttacgat gccattggga tatatcaacg gtggtatatc cagtgatttt tttctccatt     
     4741 ttagcttcct tagctcctga aaatctcgac ggatcctaac tcaaaatcca cacattatac     
     4801 gagccggaag cataaagtgt aaagcctggg gtgcctaatg cggccgccat agtgactgga     
     4861 tatgttgtgt tttacagtat tatgtagtct gttttttatg caaaatctaa tttaatatat     
     4921 tgatatttat atcattttac gtttctcgtt cagctttttt gtacaaactt gttgatatcg     
     4981 ctagccaatt gataacttcg tataggatac tttatacgaa gttatcattg ggattcttcc     
     5041 tattttgatc caagcatcac catcgaccct ctagtccaga tctcaccatc gacccataac     
     5101 ttcgtatagc atacattata cgaagttata tggtgagcaa gggcgattct agactgcagc     
     5161 tcgagtaccc atacgacgtc ccagactacg cttgagttta aacacgcgtg gtgtggaaag     
     5221 tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc     
     5281 aggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat     
     5341 tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt     
     5401 tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc     
     5461 gcctcggcct ctgagctatt ccagaagtag tgaggaggct tttttggagg ccgccaccat     
     5521 ggagagcgac gagagcggcc tgcccgccat ggagatcgag tgccgcatca ccggcaccct     
     5581 gaacggcgtg gagttcgagc tggtgggcgg cggagagggc acccccaagc agggccgcat     
     5641 gaccaacaag atgaagagca ccaaaggcgc cctgaccttc agcccctacc tgctgagcca     
     5701 cgtgatgggc tacggcttct accacttcgg cacctacccc agcggctacg agaacccctt     
     5761 cctgcacgcc atcaacaacg gcggctacac caacacccgc atcgagaagt acgaggacgg     
     5821 cggcgtgctg cacgtgagct tcagctaccg ctacgaggcc ggccgcgtga tcggcgactt     
     5881 caaggtggtg ggcaccggct tccccgagga cagcgtgatc ttcaccgaca agatcatccg     
     5941 cagcaacgcc accgtggagc acctgcaccc catgggcgat aacgtgctgg tgggcagctt     
     6001 cgcccgcacc ttcagcctgc gcgacggcgg ctactacagc ttcgtggtgg acagccacat     
     6061 gcacttcaag agcgccatcc accccagcat cctgcagaac gggggcccca tgttcgcctt     
     6121 ccgccgcgtg gaggagctgc acagcaacac cgagctgggc atcgtggagt accagcacgc     
     6181 cttcaagacc cccatcgcct tcgccagatc ccgcgctcag tcgtccaatt ctgccgtgga     
     6241 cggcaccgcc ggacccggct ccaccggatc tcgctgaacg cgttccggaa atcaacctct     
     6301 ggattacaaa atttgtgaaa gattgactgg tattcttaac tatgttgctc cttttacgct     
     6361 atgtggatac gctgctttaa tgcctttgta tcatgctatt gcttcccgta tggctttcat     
     6421 tttctcctcc ttgtataaat cctggttgct gtctctttat gaggagttgt ggcccgttgt     
     6481 caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca acccccactg gttggggcat     
     6541 tgccaccacc tgtcagctcc tttccgggac tttcgctttc cccctcccta ttgccacggc     
     6601 ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg gctcggctgt tgggcactga     
     6661 caattccgtg gtgttgtcgg ggaagctgac gtcctttcca tggctgctcg cctgtgttgc     
     6721 cacctggatt ctgcgcggga cgtccttctg ctacgtccct tcggccctca atccagcgga     
     6781 ccttccttcc cgcggcctgc tgccggctct gcggcctctt ccgcgtctcg ccttcgccct     
     6841 cagacgagtc ggatctccct ttgggccgcc tccccgcctg tccggatgga agggctaatt     
     6901 cactcccaac gaatacaaga tctgcttttt gcttgtactg ggtctctctg gttagaccag     
     6961 atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc tcaataaagc     
     7021 ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg taactagaga     
     7081 tccctcagac ccttttagtc agtgtggaaa atctctagca gtagtagttc atgtcatctt     
     7141 attattcagt atttataact tgcaaagaaa tgaatatcag agagtgagag gaacttgttt     
     7201 attgcagctt ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca     
     7261 tttttttcac tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc     
     7321 tggcatctat gtcgggtgcg gagaaagagg taatgaaatg gcattatggg tattatgggt     
     7381 ctgcattaat gaatcggcca acgatcccgg tgtgaaatac cgcacagatg cgtaaggaga     
     7441 aaataccgca tcaggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt     
     7501 cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca     
     7561 ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa     
     7621 aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat     
     7681 cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc     
     7741 cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc     
     7801 gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt     
     7861 tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac     
     7921 cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg     
     7981 ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca     
     8041 gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc     
     8101 gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa     
     8161 accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa     
     8221 ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac     
     8281 tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta     
     8341 aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt     
     8401 taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata     
     8461 gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc     
     8521 agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac     
     8581 cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag     
     8641 tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac     
     8701 gttgttgaaa aaggatcttc acctagatcc ttttcacgta gaaagccagt ccgcagaaac     
     8761 ggtgctgacc ccggatgaat gtcagctact gggctatctg gacaagggaa aacgcaagcg     
     8821 caaagagaaa gcaggtagct tgcagtgggc ttacatggcg atagctagac tgggcggttt     
     8881 tatggacagc aagcgaaccg gaattgccag ctggggcgcc ctctggtaag gttgggaagc     
     8941 cctgcaaagt aaactggatg gctttctcgc cgccaaggat ctgatggcgc aggggatcaa     
     9001 gctctgatca agagacagga tgaggatcgt ttcgcatgat tgaacaagat ggattgcacg     
     9061 caggttctcc ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa     
     9121 tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg     
     9181 tcaagaccga cctgtccggt gccctgaatg aactgcaaga cgaggcagcg cggctatcgt     
     9241 ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa     
     9301 gggactggct gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc     
     9361 ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg     
     9421 ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg     
     9481 aagccggtct tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg     
     9541 aactgttcgc caggctcaag gcgagcatgc ccgacggcga ggatctcgtc gtgacccatg     
     9601 gcgatgcctg cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact     
     9661 gtggccggct gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg     
     9721 ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc     
     9781 ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga attttgttaa     
     9841 aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa catcccttat     
     9901 aaatcaaaag aatagaccgc gatagggttg agtgttgttc cagtttggaa caagagtcca     
     9961 ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc     
    10021 ccactacgtg aaccatcacc caaatcaagt tttttgcggt cgaggtgccg taaagctcta     
    10081 aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc ggcgaacgtg     
    10141 gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg     
    10201 gtcacgctgc gcgtaaccac cacacccgcg cgcttaatgc gccgctacag ggcgcgtcca     
    10261 ttcgccattc aggatcgaat taattcttaa ttaacatcat caataatata cctt           
                            LOCUS       dna                     10314 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    457..462
                     /dbxref="REBASE:HpaI"
     Other Gene      715..895
                     /gene="HIV-1_5_LTR other"
     Other Gene      1006..1050
                     /gene="HIV-1_psi_pack other"
     misc_binding    1092..1097
                     /dbxref="REBASE:NruI"
     Regulatory_Seq  1557..1790
                     /gene="RRE reg"
     ORF             1600..2301
                     /sequence="ORF_1 rf(1)"
     misc_binding    2611..2616
                     /dbxref="REBASE:NdeI"
     Promoter        2885..2966
                     /gene="CMV prom"
     Regulatory_Seq  3022..3061
                     /gene="tetO reg"
     misc_binding    3074..3079
                     /dbxref="REBASE:ClaI"
     misc_binding    3098..3103
                     /dbxref="REBASE:KpnI"
     Other Gene      3218..3251
                     /gene="loxP other"
     Other Gene      3273..3392
                     /gene="attR1 other"
     Other Gene      3292..3392
                     /gene="attR2 other"
     Other Gene      3433..3738
                     /gene="ccdB other"
     Marker          4080..4739
                     /gene="CAT marker"
     ORF             4080..4739
                     /sequence="ORF_4 rf(5)"
     misc_binding    4521..4526
                     /dbxref="REBASE:EcoRI"
     misc_binding    4840..4847
                     /dbxref="REBASE:NotI"
     Other Gene      4848..4972
                     /gene="attR1 other"
     Other Gene      4848..4948
                     /gene="attR2 other"
     Other Gene      5096..5129
                     /gene="loxP other"
     misc_binding    5148..5153
                     /dbxref="REBASE:XbaI"
     Promoter        5210..5478
                     /gene="SV40 prom"
     Rep_Origin      5377..5454
                     /gene="SV40 origin"
     ORF             5444..6277
                     /sequence="ORF_2 rf(2)"
     misc_binding    5457..5469
                     /dbxref="REBASE:SfiI"
     misc_binding    6103..6108
                     /dbxref="REBASE:ApaI"
     Other Gene      6887..6939
                     /gene="delta_U3 other"
     Other Gene      6940..7120
                     /gene="HIV-1_5_LTR other"
     Rep_Origin      7626..8245
                     /gene="pBR322 origin"
     Promoter        8898..8947
                     /gene="NEOKAN prom"
     misc_binding    9005..9010
                     /dbxref="REBASE:BclI"
     ORF             9036..9830
                     /sequence="ORF_3 rf(3)"
     Marker          9039..9827
                     /gene="NTP_II marker"
     Rep_Origin      9935..10240
                     /gene="f1 origin"
BASE COUNT    2698 a   2516 c   2603 g   2497 t    0 others
ORIGIN
        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta     
      481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag     
      541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg     
      601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact     
      661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct     
      721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt     
      781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac     
      841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc     
      901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc     
      961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa     
     1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg     
     1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata     
     1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc     
     1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga     
     1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc     
     1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca     
     1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag     
     1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta     
     1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga     
     1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg     
     1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg     
     1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc     
     1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg     
     1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat     
     1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac     
     1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat     
     1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca     
     2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga     
     2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg     
     2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa     
     2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga     
     2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag     
     2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa     
     2401 aattcaaaat tttcgggttt ttcgaaccta gggttccgcg ttacataact tacggtaaat     
     2461 ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt     
     2521 cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa     
     2581 actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc     
     2641 aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct     
     2701 acttggcagt acatctacgt ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt     
     2761 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg     
     2821 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca     
     2881 actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca     
     2941 gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc     
     3001 atagaagaac cgagtttaaa ctccctatca gtgatagaga tctccctatc agtgatagag     
     3061 agctagcccc gggatcgatc aattgagtac ttacgtaggt accaatcagc tcgctcacca     
     3121 tataacttcg tataaagtat cctatacgaa gttatatcaa aataggaaga ccaatgcttc     
     3181 accatcgacc cgaattgcca agcatcacca tcgacccata acttcgtata atgtatgcta     
     3241 tacgaagtta tctcgagtca gatatcaacc actttgtaca agaaagctga acgagaaacg     
     3301 taaaatgata taaatatcaa tatattaaat tagattttgc ataaaaaaca gactacataa     
     3361 tactgtaaaa cacaacatat ccagtcacta tggtcgacct gcagactggc tgtgtataag     
     3421 ggagcctgac atttatattc cccagaacat caggttaatg gcgtttttga tgtcattttc     
     3481 gcggtggctg agatcagcca cttcttcccc gataacggag accggcacac tggccatatc     
     3541 ggtggtcatc atgcgccagc tttcatcccc gatatgcacc accgggtaaa gttcacggga     
     3601 gactttatct gacagcagac gtgcactggc cagggggatc accatccgtc gcccgggcgt     
     3661 gtcaataata tcactctgta catccacaaa cagacgataa cggctctctc ttttataggt     
     3721 gtaaacctta aactgcattt caccagcccc tgttctcgtc agcaaaagag ccgttcattt     
     3781 caataaaccg ggcgacctca gccatccctt cctgattttc cgctttccag cgttcggcac     
     3841 gcagacgacg ggcttcattc tgcatggttg tgcttaccag accggagata ttgacatcat     
     3901 atatgccttg agcaactgat agctgtcgct gtcaactgtc actgtaatac gctgcttcat     
     3961 agcatacctc tttttgacat acttcgggta tacatatcag tatatattct tataccgcaa     
     4021 aaatcagcgc gcaaatacgc atactgttat ctggctttta gtaagccgga tccagatctt     
     4081 tacgccccgc cctgccactc atcgcagtac tgttgtaatt cattaagcat tctgccgaca     
     4141 tggaagccat cacaaacggc atgatgaacc tgaatcgcca gcggcatcag caccttgtcg     
     4201 ccttgcgtat aatatttgcc catggtgaaa acgggggcga agaagttgtc catattggcc     
     4261 acgtttaaat caaaactggt gaaactcacc cagggattgg ctgagacgaa aaacatattc     
     4321 tcaataaacc ctttagggaa ataggccagg ttttcaccgt aacacgccac atcttgcgaa     
     4381 tatatgtgta gaaactgccg gaaatcgtcg tggtattcac tccagagcga tgaaaacgtt     
     4441 tcagtttgct catggaaaac ggtgtaacaa gggtgaacac tatcccatat caccagctca     
     4501 ccgtctttca ttgccatacg gaattccgga tgagcattca tcaggcgggc aagaatgtga     
     4561 ataaaggccg gataaaactt gtgcttattt ttctttacgg tctttaaaaa ggccgtaata     
     4621 tccagctgaa cggtctggtt ataggtacat tgagcaactg actgaaatgc ctcaaaatgt     
     4681 tctttacgat gccattggga tatatcaacg gtggtatatc cagtgatttt tttctccatt     
     4741 ttagcttcct tagctcctga aaatctcgac ggatcctaac tcaaaatcca cacattatac     
     4801 gagccggaag cataaagtgt aaagcctggg gtgcctaatg cggccgccat agtgactgga     
     4861 tatgttgtgt tttacagtat tatgtagtct gttttttatg caaaatctaa tttaatatat     
     4921 tgatatttat atcattttac gtttctcgtt cagctttttt gtacaaactt gttgatatcg     
     4981 ctagccaatt gataacttcg tataggatac tttatacgaa gttatcattg ggattcttcc     
     5041 tattttgatc caagcatcac catcgaccct ctagtccaga tctcaccatc gacccataac     
     5101 ttcgtatagc atacattata cgaagttata tggtgagcaa gggcgattct agactgcagc     
     5161 tcgagtaccc atacgacgtc ccagactacg cttgagttta aacacgcgtg gtgtggaaag     
     5221 tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc     
     5281 aggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat     
     5341 tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt     
     5401 tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc     
     5461 gcctcggcct ctgagctatt ccagaagtag tgaggaggct tttttggagg ccgccaccat     
     5521 ggagagcgac gagagcggcc tgcccgccat ggagatcgag tgccgcatca ccggcaccct     
     5581 gaacggcgtg gagttcgagc tggtgggcgg cggagagggc acccccaagc agggccgcat     
     5641 gaccaacaag atgaagagca ccaaaggcgc cctgaccttc agcccctacc tgctgagcca     
     5701 cgtgatgggc tacggcttct accacttcgg cacctacccc agcggctacg agaacccctt     
     5761 cctgcacgcc atcaacaacg gcggctacac caacacccgc atcgagaagt acgaggacgg     
     5821 cggcgtgctg cacgtgagct tcagctaccg ctacgaggcc ggccgcgtga tcggcgactt     
     5881 caaggtggtg ggcaccggct tccccgagga cagcgtgatc ttcaccgaca agatcatccg     
     5941 cagcaacgcc accgtggagc acctgcaccc catgggcgat aacgtgctgg tgggcagctt     
     6001 cgcccgcacc ttcagcctgc gcgacggcgg ctactacagc ttcgtggtgg acagccacat     
     6061 gcacttcaag agcgccatcc accccagcat cctgcagaac gggggcccca tgttcgcctt     
     6121 ccgccgcgtg gaggagctgc acagcaacac cgagctgggc atcgtggagt accagcacgc     
     6181 cttcaagacc cccatcgcct tcgccagatc ccgcgctcag tcgtccaatt ctgccgtgga     
     6241 cggcaccgcc ggacccggct ccaccggatc tcgctgaacg cgttccggaa atcaacctct     
     6301 ggattacaaa atttgtgaaa gattgactgg tattcttaac tatgttgctc cttttacgct     
     6361 atgtggatac gctgctttaa tgcctttgta tcatgctatt gcttcccgta tggctttcat     
     6421 tttctcctcc ttgtataaat cctggttgct gtctctttat gaggagttgt ggcccgttgt     
     6481 caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca acccccactg gttggggcat     
     6541 tgccaccacc tgtcagctcc tttccgggac tttcgctttc cccctcccta ttgccacggc     
     6601 ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg gctcggctgt tgggcactga     
     6661 caattccgtg gtgttgtcgg ggaagctgac gtcctttcca tggctgctcg cctgtgttgc     
     6721 cacctggatt ctgcgcggga cgtccttctg ctacgtccct tcggccctca atccagcgga     
     6781 ccttccttcc cgcggcctgc tgccggctct gcggcctctt ccgcgtctcg ccttcgccct     
     6841 cagacgagtc ggatctccct ttgggccgcc tccccgcctg tccggatgga agggctaatt     
     6901 cactcccaac gaatacaaga tctgcttttt gcttgtactg ggtctctctg gttagaccag     
     6961 atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc tcaataaagc     
     7021 ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg taactagaga     
     7081 tccctcagac ccttttagtc agtgtggaaa atctctagca gtagtagttc atgtcatctt     
     7141 attattcagt atttataact tgcaaagaaa tgaatatcag agagtgagag gaacttgttt     
     7201 attgcagctt ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca     
     7261 tttttttcac tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc     
     7321 tggcatctat gtcgggtgcg gagaaagagg taatgaaatg gcattatggg tattatgggt     
     7381 ctgcattaat gaatcggcca acgatcccgg tgtgaaatac cgcacagatg cgtaaggaga     
     7441 aaataccgca tcaggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt     
     7501 cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca     
     7561 ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa     
     7621 aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat     
     7681 cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc     
     7741 cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc     
     7801 gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt     
     7861 tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac     
     7921 cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg     
     7981 ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca     
     8041 gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc     
     8101 gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa     
     8161 accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa     
     8221 ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac     
     8281 tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta     
     8341 aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt     
     8401 taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata     
     8461 gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc     
     8521 agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac     
     8581 cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag     
     8641 tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac     
     8701 gttgttgaaa aaggatcttc acctagatcc ttttcacgta gaaagccagt ccgcagaaac     
     8761 ggtgctgacc ccggatgaat gtcagctact gggctatctg gacaagggaa aacgcaagcg     
     8821 caaagagaaa gcaggtagct tgcagtgggc ttacatggcg atagctagac tgggcggttt     
     8881 tatggacagc aagcgaaccg gaattgccag ctggggcgcc ctctggtaag gttgggaagc     
     8941 cctgcaaagt aaactggatg gctttctcgc cgccaaggat ctgatggcgc aggggatcaa     
     9001 gctctgatca agagacagga tgaggatcgt ttcgcatgat tgaacaagat ggattgcacg     
     9061 caggttctcc ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa     
     9121 tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg     
     9181 tcaagaccga cctgtccggt gccctgaatg aactgcaaga cgaggcagcg cggctatcgt     
     9241 ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa     
     9301 gggactggct gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc     
     9361 ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg     
     9421 ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg     
     9481 aagccggtct tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg     
     9541 aactgttcgc caggctcaag gcgagcatgc ccgacggcga ggatctcgtc gtgacccatg     
     9601 gcgatgcctg cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact     
     9661 gtggccggct gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg     
     9721 ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc     
     9781 ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga attttgttaa     
     9841 aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa catcccttat     
     9901 aaatcaaaag aatagaccgc gatagggttg agtgttgttc cagtttggaa caagagtcca     
     9961 ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc     
    10021 ccactacgtg aaccatcacc caaatcaagt tttttgcggt cgaggtgccg taaagctcta     
    10081 aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc ggcgaacgtg     
    10141 gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg     
    10201 gtcacgctgc gcgtaaccac cacacccgcg cgcttaatgc gccgctacag ggcgcgtcca     
    10261 ttcgccattc aggatcgaat taattcttaa ttaacatcat caataatata cctt           
//
                        
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
      AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61    gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
      CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

                                               Encap other(162,310)>>> 
                                               |
121   cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
      GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181   aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
      TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241   aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
      TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301   tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
      ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

          amp prom(365,393)<<< 
          |
361   ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
      CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

                                             HpaI 
                                             |
421   gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
      CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481   gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 540
      CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541   caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 600
      GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601   tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 660
      ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

                                                            HIV-1_5_LTR other(715,895)>>> 
                                                            |
661   gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 720
      CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721   ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 780
      GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781   aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 840
      TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841   tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 900
      AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901   gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 960
      CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

                                                   HIV-1_psi_pack other(1006,1050)>>> 
                                                   |
961   ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 1020
      CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021  ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 1080
      AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

                    NruI 
                    |
1081  ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 1140
      CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141  aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 1200
      TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201  tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 1260
      ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261  caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 1320
      GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321  aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 1380
      TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381  aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 1440
      TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441  ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 1500
      CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

                                                              RRE reg(1557,1790)>>> 
                                                              |
1501  gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 1560
      CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

                                             ORF_1 rf(1)(1600,2301)>>> 
                                             |
1561  gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 1620
      CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621  ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 1680
      GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681  agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 1740
      TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741  caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 1800
      GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801  ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 1860
      CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861  aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 1920
      TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921  aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 1980
      TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981  gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 2040
      CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041  aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 2100
      TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101  atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 2160
      TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161  tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 2220
      AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221  ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 2280
      CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281  aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 2340
      TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

2341  aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 2400
      TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

2401  aattcaaaattttcgggtttttcgaacctagggttccgcgttacataacttacggtaaat 2460
      TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCCCAAGGCGCAATGTATTGAATGCCATTTA

2461  ggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgtt 2520
      CCGGGCGGACCGACTGGCGGGTTGCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAA

2521  cccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaa 2580
      GGGTATCATTGCGGTTATCCCTGAAAGGTAACTGCAGTTACCCACCTCATAAATGCCATT

                                      NdeI 
                                      |
2581  actgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtc 2640
      TGACGGGTGAACCGTCATGTAGTTCACATAGTATACGGTTCATGCGGGGGATAACTGCAG

2641  aatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcct 2700
      TTACTGCCATTTACCGGGCGGACCGTAATACGGGTCATGTACTGGAATACCCTGAAAGGA

2701  acttggcagtacatctacgtttagtcatcgctattaccatggtgatgcggttttggcagt 2760
      TGAACCGTCATGTAGATGCAAATCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCA

2761  acatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattg 2820
      TGTAGTTACCCGCACCTATCGCCAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAAC

2821  acgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaaca 2880
      TGCAGTTACCCTCAAACAAAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGT

          CMV prom(2885,2966)>>> 
          |
2881  actccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagca 2940
      TGAGGCGGGGTAACTGCGTTTACCCGCCATCCGCACATGCCACCCTCCAGATATATTCGT

2941  gagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctcc 3000
      CTCGAGCAAATCACTTGGCAGTCTAGCGGACCTCTGCGGTAGGTGCGACAAAACTGGAGG

                           tetO reg(3022,3061)>>> 
                           |
3001  atagaagaaccgagtttaaactccctatcagtgatagagatctccctatcagtgatagag 3060
      TATCTTCTTGGCTCAAATTTGAGGGATAGTCACTATCTCTAGAGGGATAGTCACTATCTC

                     ClaI                       KpnI 
                     |                          |
3061  agctagccccgggatcgatcaattgagtacttacgtaggtaccaatcagctcgctcacca 3120
      TCGATCGGGGCCCTAGCTAGTTAACTCATGAATGCATCCATGGTTAGTCGAGCGAGTGGT

3121  tataacttcgtataaagtatcctatacgaagttatatcaaaataggaagaccaatgcttc 3180
      ATATTGAAGCATATTTCATAGGATATGCTTCAATATAGTTTTATCCTTCTGGTTACGAAG

                                           loxP other(3218,3251)<<< 
                                           |
3181  accatcgacccgaattgccaagcatcaccatcgacccataacttcgtataatgtatgcta 3240
      TGGTAGCTGGGCTTAACGGTTCGTAGTGGTAGCTGGGTATTGAAGCATATTACATACGAT

                                                         attR2 other(3292,3392)<<< 
                                                         |
                                      attR1 other(3273,3392)>>> 
                                      |                  |
3241  tacgaagttatctcgagtcagatatcaaccactttgtacaagaaagctgaacgagaaacg 3300
      ATGCTTCAATAGAGCTCAGTCTATAGTTGGTGAAACATGTTCTTTCGACTTGCTCTTTGC

3301  taaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataa 3360
      ATTTTACTATATTTATAGTTATATAATTTAATCTAAAACGTATTTTTTGTCTGATGTATT

3361  tactgtaaaacacaacatatccagtcactatggtcgacctgcagactggctgtgtataag 3420
      ATGACATTTTGTGTTGTATAGGTCAGTGATACCAGCTGGACGTCTGACCGACACATATTC

                  ccdB other(3433,3738)<<< 
                  |
3421  ggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttc 3480
      CCTCGGACTGTAAATATAAGGGGTCTTGTAGTCCAATTACCGCAAAAACTACAGTAAAAG

3481  gcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatc 3540
      CGCCACCGACTCTAGTCGGTGAAGAAGGGGCTATTGCCTCTGGCCGTGTGACCGGTATAG

3541  ggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacggga 3600
      CCACCAGTAGTACGCGGTCGAAAGTAGGGGCTATACGTGGTGGCCCATTTCAAGTGCCCT

3601  gactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgt 3660
      CTGAAATAGACTGTCGTCTGCACGTGACCGGTCCCCCTAGTGGTAGGCAGCGGGCCCGCA

3661  gtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggt 3720
      CAGTTATTATAGTGAGACATGTAGGTGTTTGTCTGCTATTGCCGAGAGAGAAAATATCCA

3721  gtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcattt 3780
      CATTTGGAATTTGACGTAAAGTGGTCGGGGACAAGAGCAGTCGTTTTCTCGGCAAGTAAA

3781  caataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcac 3840
      GTTATTTGGCCCGCTGGAGTCGGTAGGGAAGGACTAAAAGGCGAAAGGTCGCAAGCCGTG

3841  gcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcat 3900
      CGTCTGCTGCCCGAAGTAAGACGTACCAACACGAATGGTCTGGCCTCTATAACTGTAGTA

3901  atatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcat 3960
      TATACGGAACTCGTTGACTATCGACAGCGACAGTTGACAGTGACATTATGCGACGAAGTA

3961  agcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaa 4020
      TCGTATGGAGAAAAACTGTATGAAGCCCATATGTATAGTCATATATAAGAATATGGCGTT

4021  aaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccagatctt 4080
      TTTAGTCGCGCGTTTATGCGTATGACAATAGACCGAAAATCATTCGGCCTAGGTCTAGAA

     ORF_4 rf(5)(4080,4739)<<< 
     |
     CAT marker(4080,4739)<<< 
     |
4081  tacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgaca 4140
      ATGCGGGGCGGGACGGTGAGTAGCGTCATGACAACATTAAGTAATTCGTAAGACGGCTGT

4141  tggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcg 4200
      ACCTTCGGTAGTGTTTGCCGTACTACTTGGACTTAGCGGTCGCCGTAGTCGTGGAACAGC

4201  ccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggcc 4260
      GGAACGCATATTATAAACGGGTACCACTTTTGCCCCCGCTTCTTCAACAGGTATAACCGG

4261  acgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattc 4320
      TGCAAATTTAGTTTTGACCACTTTGAGTGGGTCCCTAACCGACTCTGCTTTTTGTATAAG

4321  tcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaa 4380
      AGTTATTTGGGAAATCCCTTTATCCGGTCCAAAAGTGGCATTGTGCGGTGTAGAACGCTT

4381  tatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtt 4440
      ATATACACATCTTTGACGGCCTTTAGCAGCACCATAAGTGAGGTCTCGCTACTTTTGCAA

4441  tcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctca 4500
      AGTCAAACGAGTACCTTTTGCCACATTGTTCCCACTTGTGATAGGGTATAGTGGTCGAGT

                           EcoRI 
                           |
4501  ccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtga 4560
      GGCAGAAAGTAACGGTATGCCTTAAGGCCTACTCGTAAGTAGTCCGCCCGTTCTTACACT

4561  ataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaata 4620
      TATTTCCGGCCTATTTTGAACACGAATAAAAAGAAATGCCAGAAATTTTTCCGGCATTAT

4621  tccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgt 4680
      AGGTCGACTTGCCAGACCAATATCCATGTAACTCGTTGACTGACTTTACGGAGTTTTACA

4681  tctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccatt 4740
      AGAAATGCTACGGTAACCCTATATAGTTGCCACCATATAGGTCACTAAAAAAAGAGGTAA

4741  ttagcttccttagctcctgaaaatctcgacggatcctaactcaaaatccacacattatac 4800
      AATCGAAGGAATCGAGGACTTTTAGAGCTGCCTAGGATTGAGTTTTAGGTGTGTAATATG

                                                     attR1 other(4848,4972)<<< 
                                                     |
                                               NotI  attR2 other(4848,4948)>>> 
                                               |     |
4801  gagccggaagcataaagtgtaaagcctggggtgcctaatgcggccgccatagtgactgga 4860
      CTCGGCCTTCGTATTTCACATTTCGGACCCCACGGATTACGCCGGCGGTATCACTGACCT

4861  tatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatat 4920
      ATACAACACAAAATGTCATAATACATCAGACAAAAAATACGTTTTAGATTAAATTATATA

4921  tgatatttatatcattttacgtttctcgttcagcttttttgtacaaacttgttgatatcg 4980
      ACTATAAATATAGTAAAATGCAAAGAGCAAGTCGAAAAAACATGTTTGAACAACTATAGC

4981  ctagccaattgataacttcgtataggatactttatacgaagttatcattgggattcttcc 5040
      GATCGGTTAACTATTGAAGCATATCCTATGAAATATGCTTCAATAGTAACCCTAAGAAGG

                                                             loxP other(5096,5129)>>> 
                                                             |
5041  tattttgatccaagcatcaccatcgaccctctagtccagatctcaccatcgacccataac 5100
      ATAAAACTAGGTTCGTAGTGGTAGCTGGGAGATCAGGTCTAGAGTGGTAGCTGGGTATTG

                                                      XbaI 
                                                      |
5101  ttcgtatagcatacattatacgaagttatatggtgagcaagggcgattctagactgcagc 5160
      AAGCATATCGTATGTAATATGCTTCAATATACCACTCGTTCCCGCTAAGATCTGACGTCG

                                                       SV40 prom(5210,5478)>>> 
                                                       |
5161  tcgagtacccatacgacgtcccagactacgcttgagtttaaacacgcgtggtgtggaaag 5220
      AGCTCATGGGTATGCTGCAGGGTCTGATGCGAACTCAAATTTGTGCGCACCACACCTTTC

5221  tccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacc 5280
      AGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTGG

5281  aggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaat 5340
      TCCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTA

                                          SV40 origin(5377,5454)>>> 
                                          |
5341  tagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagt 5400
      ATCAGTCGTTGGTATCAGGGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGCGGGTCA

                                                 ORF_2 rf(2)(5444,6277)>>> 
                                                 |
5401  tccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggcc 5460
      AGGCGGGTAAGAGGCGGGGTACCGACTGATTAAAAAAAATAAATACGTCTCCGGCTCCGG

          SfiI 
          |
5461  gcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggccgccaccAt 5520
      CGGAGCCGGAGACTCGATAAGGTCTTCATCACTCCTCCGAAAAAACCTCCGGCGGTGGTA

5521  ggagagcgacgagagcggcctgcccgccatggagatcgagtgccgcatcaccggcaccct 5580
      CCTCTCGCTGCTCTCGCCGGACGGGCGGTACCTCTAGCTCACGGCGTAGTGGCCGTGGGA

5581  gaacggcgtggagttcgagctggtgggcggcggagagggcacccccaagcagggccgcat 5640
      CTTGCCGCACCTCAAGCTCGACCACCCGCCGCCTCTCCCGTGGGGGTTCGTCCCGGCGTA

5641  gaccaacaagatgaagagcaccaaaggcgccctgaccttcagcccctacctgctgagcca 5700
      CTGGTTGTTCTACTTCTCGTGGTTTCCGCGGGACTGGAAGTCGGGGATGGACGACTCGGT

5701  cgtgatgggctacggcttctaccacttcggcacctaccccagcggctacgagaacccctt 5760
      GCACTACCCGATGCCGAAGATGGTGAAGCCGTGGATGGGGTCGCCGATGCTCTTGGGGAA

5761  cctgcacgccatcaacaacggcggctacaccaacacccgcatcgagaagtacgaggacgg 5820
      GGACGTGCGGTAGTTGTTGCCGCCGATGTGGTTGTGGGCGTAGCTCTTCATGCTCCTGCC

5821  cggcgtgctgcacgtgagcttcagctaccgctacgaggccggccgcgtgatcggcgactt 5880
      GCCGCACGACGTGCACTCGAAGTCGATGGCGATGCTCCGGCCGGCGCACTAGCCGCTGAA

5881  caaggtggtgggcaccggcttccccgaggacagcgtgatcttcaccgacaagatcatccg 5940
      GTTCCACCACCCGTGGCCGAAGGGGCTCCTGTCGCACTAGAAGTGGCTGTTCTAGTAGGC

5941  cagcaacgccaccgtggagcacctgcaccccatgggcgataacgtgctggtgggcagctt 6000
      GTCGTTGCGGTGGCACCTCGTGGACGTGGGGTACCCGCTATTGCACGACCACCCGTCGAA

6001  cgcccgcaccttcagcctgcgcgacggcggctactacagcttcgtggtggacagccacat 6060
      GCGGGCGTGGAAGTCGGACGCGCTGCCGCCGATGATGTCGAAGCACCACCTGTCGGTGTA

                                                     ApaI 
                                                     |
6061  gcacttcaagagcgccatccaccccagcatcctgcagaacgggggccccatgttcgcctt 6120
      CGTGAAGTTCTCGCGGTAGGTGGGGTCGTAGGACGTCTTGCCCCCGGGGTACAAGCGGAA

6121  ccgccgcgtggaggagctgcacagcaacaccgagctgggcatcgtggagtaccagcacgc 6180
      GGCGGCGCACCTCCTCGACGTGTCGTTGTGGCTCGACCCGTAGCACCTCATGGTCGTGCG

6181  cttcaagacccccatcgccttcgccagatcccgcgctcagtcgtccaattctgccgtgga 6240
      GAAGTTCTGGGGGTAGCGGAAGCGGTCTAGGGCGCGAGTCAGCAGGTTAAGACGGCACCT

6241  cggcaccgccggacccggctccaccggatctcgctgaacgcgttccggaaatcaacctct 6300
      GCCGTGGCGGCCTGGGCCGAGGTGGCCTAGAGCGACTTGCGCAAGGCCTTTAGTTGGAGA

6301  ggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgct 6360
      CCTAATGTTTTAAACACTTTCTAACTGACCATAAGAATTGATACAACGAGGAAAATGCGA

6361  atgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcat 6420
      TACACCTATGCGACGAAATTACGGAAACATAGTACGATAACGAAGGGCATACCGAAAGTA

6421  tttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgt 6480
      AAAGAGGAGGAACATATTTAGGACCAACGACAGAGAAATACTCCTCAACACCGGGCAACA

6481  caggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcat 6540
      GTCCGTTGCACCGCACCACACGTGACACAAACGACTGCGTTGGGGGTGACCAACCCCGTA

6541  tgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggc 6600
      ACGGTGGTGGACAGTCGAGGAAAGGCCCTGAAAGCGAAAGGGGGAGGGATAACGGTGCCG

6601  ggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactga 6660
      CCTTGAGTAGCGGCGGACGGAACGGGCGACGACCTGTCCCCGAGCCGACAACCCGTGACT

6661  caattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgc 6720
      GTTAAGGCACCACAACAGCCCCTTCGACTGCAGGAAAGGTACCGACGAGCGGACACAACG

6721  cacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcgga 6780
      GTGGACCTAAGACGCGCCCTGCAGGAAGACGATGCAGGGAAGCCGGGAGTTAGGTCGCCT

6781  ccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtctcgccttcgccct 6840
      GGAAGGAAGGGCGCCGGACGACGGCCGAGACGCCGGAGAAGGCGCAGAGCGGAAGCGGGA

                                                    delta_U3 other(6887,6939)>>> 
                                                    |
6841  cagacgagtcggatctccctttgggccgcctccccgcctgtccggatggaagggctaatt 6900
      GTCTGCTCAGCCTAGAGGGAAACCCGGCGGAGGGGCGGACAGGCCTACCTTCCCGATTAA

                                             HIV-1_5_LTR other(6940,7120)>>> 
                                             |
6901  cactcccaacgaatacaagatctgctttttgcttgtactgggtctctctggttagaccag 6960
      GTGAGGGTTGCTTATGTTCTAGACGAAAAACGAACATGACCCAGAGAGACCAATCTGGTC

6961  atctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagc 7020
      TAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAATTCGGAGTTATTTCG

7021  ttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagaga 7080
      AACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTGAGACCATTGATCTCT

7081  tccctcagacccttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatctt 7140
      AGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCATCATCAAGTACAGTAGAA

7141  attattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgttt 7200
      TAATAAGTCATAAATATTGAACGTTTCTTTACTTATAGTCTCTCACTCTCCTTGAACAAA

7201  attgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagca 7260
      TAACGTCGAATATTACCAATGTTTATTTCGTTATCGTAGTGTTTAAAGTGTTTATTTCGT

7261  tttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtc 7320
      AAAAAAAGTGACGTAAGATCAACACCAAACAGGTTTGAGTAGTTACATAGAATAGTACAG

7321  tggcatctatgtcgggtgcggagaaagaggtaatgaaatggcattatgggtattatgggt 7380
      ACCGTAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGTAATACCCATAATACCCA

7381  ctgcattaatgaatcggccaacgatcccggtgtgaaataccgcacagatgcgtaaggaga 7440
      GACGTAATTACTTAGCCGGTTGCTAGGGCCACACTTTATGGCGTGTCTACGCATTCCTCT

7441  aaataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgtt 7500
      TTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAA

7501  cggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatca 7560
      GCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGT

7561  ggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaa 7620
      CCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTT

           pBR322 origin(7626,8245)<<< 
           |
7621  aaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaat 7680
      TTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTA

7681  cgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccc 7740
      GCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGG

7741  cctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtcc 7800
      GGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGG

7801  gcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagt 7860
      CGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCA

7861  tcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgac 7920
      AGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTG

7921  cgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcg 7980
      GCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGC

7981  ccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctaca 8040
      GGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGT

8041  gagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgc 8100
      CTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACG

8101  gctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaa 8160
      CGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTT

8161  accaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaa 8220
      TGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTT

8221  ggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaac 8280
      CCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTG

8281  tcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatcctttta 8340
      AGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAAT

8341  aattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagt 8400
      TTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCA

8401  taccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccata 8460
      ATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTAT

8461  gttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggcccc 8520
      CAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGG

8521  agtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaac 8580
      TCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTG

8581  cagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccag 8640
      GTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTC

8641  tctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaac 8700
      AGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTG

8701  gttgttgaaaaaggatcttcacctagatccttttcacgtagaaagccagtccgcagaaac 8760
      CAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTG

8761  ggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcg 8820
      CCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGC

8821  caaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttt 8880
      GTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAA

                       NEOKAN prom(8898,8947)>>> 
                       |
8881  tatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagc 8940
      ATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCG

8941  cctgcaaagtaaactggatggctttctcgccgccaaggatctgatggcgcaggggatcaa 9000
      GGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTT

                                            NTP_II marker(9039,9827)>>> 
                                            |
           BclI                          ORF_3 rf(3)(9036,9830)>>> 
           |                             |  |
9001  gctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacg 9060
      CGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGC

9061  caggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaa 9120
      GTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTT

9121  tcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttg 9180
      AGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAAC

9181  tcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgt 9240
      AGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCA

9241  ggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaa 9300
      CCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTT

9301  gggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctc 9360
      CCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAG

9361  ctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccgg 9420
      GACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCC

9421  ctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatgg 9480
      GATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACC

9481  aagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccg 9540
      TTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGC

9541  aactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatg 9600
      TTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTAC

9601  gcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgact 9660
      CGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGA

9661  gtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattg 9720
      CACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAAC

9721  ctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctc 9780
      GACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAG

9781  ccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattttgttaa 9840
      GGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATT

9841  aatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaacatcccttat 9900
      TTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATA

                                        f1 origin(9935,10240)<<< 
                                        |
9901  aaatcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaagagtcca 9960
      TTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGT

9961  ctattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggc 10020
      GATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCG

10021 ccactacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaaagctcta 10080
      GGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGAT

10081 aatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtg 10140
      TTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCAC

10141 gcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcg 10200
      CGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGC

10201 gtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacagggcgcgtcca 10260
      CAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGT

10261 ttcgccattcaggatcgaattaattcttaattaacatcatcaataatatacctt 10314
      AAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA
                            LOCUS       dna                     10314 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    457..462
                     /dbxref="REBASE:HpaI"
     Other Gene      715..895
                     /gene="HIV-1_5_LTR other"
     Other Gene      1006..1050
                     /gene="HIV-1_psi_pack other"
     misc_binding    1092..1097
                     /dbxref="REBASE:NruI"
     Regulatory_Seq  1557..1790
                     /gene="RRE reg"
     ORF             1600..2301
                     /sequence="ORF_1 rf(1)"
     misc_binding    2611..2616
                     /dbxref="REBASE:NdeI"
     Promoter        2885..2966
                     /gene="CMV prom"
     Regulatory_Seq  3022..3061
                     /gene="tetO reg"
     misc_binding    3074..3079
                     /dbxref="REBASE:ClaI"
     misc_binding    3098..3103
                     /dbxref="REBASE:KpnI"
     Other Gene      3218..3251
                     /gene="loxP other"
     Other Gene      3273..3392
                     /gene="attR1 other"
     Other Gene      3292..3392
                     /gene="attR2 other"
     Other Gene      3433..3738
                     /gene="ccdB other"
     Marker          4080..4739
                     /gene="CAT marker"
     ORF             4080..4739
                     /sequence="ORF_4 rf(5)"
     misc_binding    4521..4526
                     /dbxref="REBASE:EcoRI"
     misc_binding    4840..4847
                     /dbxref="REBASE:NotI"
     Other Gene      4848..4972
                     /gene="attR1 other"
     Other Gene      4848..4948
                     /gene="attR2 other"
     Other Gene      5096..5129
                     /gene="loxP other"
     misc_binding    5148..5153
                     /dbxref="REBASE:XbaI"
     Promoter        5210..5478
                     /gene="SV40 prom"
     Rep_Origin      5377..5454
                     /gene="SV40 origin"
     ORF             5444..6277
                     /sequence="ORF_2 rf(2)"
     misc_binding    5457..5469
                     /dbxref="REBASE:SfiI"
     misc_binding    6103..6108
                     /dbxref="REBASE:ApaI"
     Other Gene      6887..6939
                     /gene="delta_U3 other"
     Other Gene      6940..7120
                     /gene="HIV-1_5_LTR other"
     Rep_Origin      7626..8245
                     /gene="pBR322 origin"
     Promoter        8898..8947
                     /gene="NEOKAN prom"
     misc_binding    9005..9010
                     /dbxref="REBASE:BclI"
     ORF             9036..9830
                     /sequence="ORF_3 rf(3)"
     Marker          9039..9827
                     /gene="NTP_II marker"
     Rep_Origin      9935..10240
                     /gene="f1 origin"
BASE COUNT    2698 a   2516 c   2603 g   2497 t    0 others