pLenti-HOXA10-C-term-HA

Vector Name pLenti-HOXA10-C-term-HA
VectorType Lentiviral Vector
Antibiotic Information No selection marker needed for cell immortalization. Primary cells that are not successfully immortalized will die after several passage rounds.
Sequencing Primers CMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
SV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional Information No Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.
        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta     
      481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag     
      541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg     
      601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact     
      661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct     
      721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt     
      781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac     
      841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc     
      901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc     
      961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa     
     1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg     
     1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata     
     1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc     
     1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga     
     1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc     
     1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca     
     1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag     
     1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta     
     1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga     
     1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg     
     1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg     
     1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc     
     1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg     
     1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat     
     1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac     
     1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat     
     1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca     
     2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga     
     2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg     
     2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa     
     2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga     
     2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag     
     2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa     
     2401 aattcaaaat tttcgggttt ttcgaaccta gggttccgcg ttacataact tacggtaaat     
     2461 ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt     
     2521 cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa     
     2581 actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc     
     2641 aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct     
     2701 acttggcagt acatctacgt ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt     
     2761 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg     
     2821 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca     
     2881 actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca     
     2941 gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc     
     3001 atagaagaac cgagtttaaa ctccctatca gtgatagaga tctccctatc agtgatagag     
     3061 agctagcgat atcaacaagt ttgtacaaaa aagttggcat gtcagccaga aagggctatc     
     3121 tgctcccttc gccaaattat cccacaacaa tgtcatgctc ggagagcccc gccgcgaact     
     3181 cttttttggt cgactcgctc atcagctcgg gcagaggcga ggcaggcggc ggtggtggtg     
     3241 gcgcgggggg cggcggcggt ggcggttact acgcccacgg cggggtctac ctgccgcccg     
     3301 ccgccgacct gccctacggg ctgcagagct gcgggctctt ccccacgctg ggcggcaagc     
     3361 gcaatgaggc agcgtcgccg ggcagcggtg gcggtggcgg gggtctaggt cccggggcgc     
     3421 acggctacgg gccctcgccc atagacctgt ggctagacgc gccccggtct tgccggatgg     
     3481 agccgcctga cgggccgccg ccgccgcccc agcagcagcc gccgcccccg ccgcaaccac     
     3541 cccagccagc gccgcaggcc acctcgtgct ctttcgcgca gaacatcaaa gaagagagct     
     3601 cctactgcct ctacgactcg gcggacaaat gccccaaagt ctcggccacc gccgccgaac     
     3661 tggctccctt cccgcggggc ccgccgcccg acggctgcgc cctgggcacc tccagcgggg     
     3721 tgccagtgcc tggctacttc cgcctttctc aggcctacgg caccgccaag ggctatggca     
     3781 gcggcggcgg cggcgcgcag caactcgggg ctggcccgtt ccccgcgcag cccccggggc     
     3841 gcggtttcga tctcccgccc gcgctagcct ccggctcggc cgatgcggcc cggaaggagc     
     3901 gagccctcga ttcgccgccg ccccccacgc tggcttgcgg cagcggcggg ggctcgcagg     
     3961 gcgacgagga ggcgcacgcg tcgtcctcgg ccgcggagga gctctccccg gccccttccg     
     4021 agagcagcaa agcctcgccg gagaaggatt ccctgggcaa ttccaaaggt gaaaacgcag     
     4081 ccaactggct cacggcaaag agtggtcgga agaagcgctg cccctacacg aagcaccaga     
     4141 cactggagct ggagaaggag tttctgttca atatgtacct tactcgagag cggcgcctag     
     4201 agattagccg cagcgtccac ctcacggaca gacaagtgaa aatctggttt cagaaccgca     
     4261 ggatgaaact gaagaaaatg aatcgagaaa accggatccg ggagctcaca gccaacttta     
     4321 atttttcctg cccaactttc ttgtacaaag tggttgatat cctcgagtac ccatacgacg     
     4381 tcccagacta cgcttgagtt taaacacgcg tggtgtggaa agtccccagg ctccccagca     
     4441 ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa ccaggtgtgg aaagtcccca     
     4501 ggctccccag caggcagaag tatgcaaagc atgcatctca attagtcagc aaccatagtc     
     4561 ccgcccctaa ctccgcccat cccgccccta actccgccca gttccgccca ttctccgccc     
     4621 catggctgac taattttttt tatttatgca gaggccgagg ccgcctcggc ctctgagcta     
     4681 ttccagaagt agtgaggagg cttttttgga ggccatgacc gagtacaagc ccacggtgcg     
     4741 cctcgccacc cgcgacgacg tccctcgggc cgtacgcacc ctcgccgccg cgttcgccga     
     4801 ctaccccgcc acgcgccaca ccgtggaccc ggaccgccac atcgagcggg tcaccgagct     
     4861 gcaagaactc ttcctcacgc gcgtcgggct cgacatcggc aaggtgtggg tcgcggacga     
     4921 cggcgccgcg gtggcggtct ggaccacgcc ggagagcgtc gaagcggggg cggtgttcgc     
     4981 cgagatcggc ccgcgcatgg ccgagttgag cggttcccgg ctggccgcgc agcaacagat     
     5041 ggaagggctc ctggcgccgc accggcccaa ggagcccgcg tggttcctgg ccaccgtcgg     
     5101 cgtctcgccc gaccaccagg gcaagggtct gggcagcgcc gtcgtgctcc ccggagtgga     
     5161 ggcggccgag cgcgccgggg tgcccgcctt cctggagacc tccgcgcccc gcaacctccc     
     5221 cttctacgag cggctcggct tcaccgtcac cgccgacgtc gaggtgcccg aaggaccgcg     
     5281 cacctggtgc atgacccgca agcccggtgc ctgaacgcgt tccggaaatc aacctctgga     
     5341 ttacaaaatt tgtgaaagat tgactggtat tcttaactat gttgctcctt ttacgctatg     
     5401 tggatacgct gctttaatgc ctttgtatca tgctattgct tcccgtatgg ctttcatttt     
     5461 ctcctccttg tataaatcct ggttgctgtc tctttatgag gagttgtggc ccgttgtcag     
     5521 gcaacgtggc gtggtgtgca ctgtgtttgc tgacgcaacc cccactggtt ggggcattgc     
     5581 caccacctgt cagctccttt ccgggacttt cgctttcccc ctccctattg ccacggcgga     
     5641 actcatcgcc gcctgccttg cccgctgctg gacaggggct cggctgttgg gcactgacaa     
     5701 ttccgtggtg ttgtcgggga agctgacgtc ctttccatgg ctgctcgcct gtgttgccac     
     5761 ctggattctg cgcgggacgt ccttctgcta cgtcccttcg gccctcaatc cagcggacct     
     5821 tccttcccgc ggcctgctgc cggctctgcg gcctcttccg cgtctcgcct tcgccctcag     
     5881 acgagtcgga tctccctttg ggccgcctcc ccgcctgtcc ggatggaagg gctaattcac     
     5941 tcccaacgaa tacaagatct gctttttgct tgtactgggt ctctctggtt agaccagatc     
     6001 tgagcctggg agctctctgg ctaactaggg aacccactgc ttaagcctca ataaagcttg     
     6061 ccttgagtgc ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc     
     6121 ctcagaccct tttagtcagt gtggaaaatc tctagcagta gtagttcatg tcatcttatt     
     6181 attcagtatt tataacttgc aaagaaatga atatcagaga gtgagaggaa cttgtttatt     
     6241 gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt     
     6301 ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgg     
     6361 catctatgtc gggtgcggag aaagaggtaa tgaaatggca ttatgggtat tatgggtctg     
     6421 cattaatgaa tcggccaacg atcccggtgt gaaataccgc acagatgcgt aaggagaaaa     
     6481 taccgcatca ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg     
     6541 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg     
     6601 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag     
     6661 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga     
     6721 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct     
     6781 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc     
     6841 tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg     
     6901 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc     
     6961 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca     
     7021 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag     
     7081 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct     
     7141 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc     
     7201 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga     
     7261 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca     
     7321 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat     
     7381 taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac     
     7441 caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc atccatagtt     
     7501 gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc tggccccagt     
     7561 gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc aataaaccag     
     7621 ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc catccagtct     
     7681 attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt gcgcaacgtt     
     7741 gttgaaaaag gatcttcacc tagatccttt tcacgtagaa agccagtccg cagaaacggt     
     7801 gctgaccccg gatgaatgtc agctactggg ctatctggac aagggaaaac gcaagcgcaa     
     7861 agagaaagca ggtagcttgc agtgggctta catggcgata gctagactgg gcggttttat     
     7921 ggacagcaag cgaaccggaa ttgccagctg gggcgccctc tggtaaggtt gggaagccct     
     7981 gcaaagtaaa ctggatggct ttctcgccgc caaggatctg atggcgcagg ggatcaagct     
     8041 ctgatcaaga gacaggatga ggatcgtttc gcatgattga acaagatgga ttgcacgcag     
     8101 gttctccggc cgcttgggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg     
     8161 gctgctctga tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca     
     8221 agaccgacct gtccggtgcc ctgaatgaac tgcaagacga ggcagcgcgg ctatcgtggc     
     8281 tggccacgac gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg     
     8341 actggctgct attgggcgaa gtgccggggc aggatctcct gtcatctcac cttgctcctg     
     8401 ccgagaaagt atccatcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta     
     8461 cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact cggatggaag     
     8521 ccggtcttgt cgatcaggat gatctggacg aagagcatca ggggctcgcg ccagccgaac     
     8581 tgttcgccag gctcaaggcg agcatgcccg acggcgagga tctcgtcgtg acccatggcg     
     8641 atgcctgctt gccgaatatc atggtggaaa atggccgctt ttctggattc atcgactgtg     
     8701 gccggctggg tgtggcggac cgctatcagg acatagcgtt ggctacccgt gatattgctg     
     8761 aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg     
     8821 attcgcagcg catcgccttc tatcgccttc ttgacgagtt cttctgaatt ttgttaaaat     
     8881 ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa tcggcaacat cccttataaa     
     8941 tcaaaagaat agaccgcgat agggttgagt gttgttccag tttggaacaa gagtccacta     
     9001 ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca     
     9061 ctacgtgaac catcacccaa atcaagtttt ttgcggtcga ggtgccgtaa agctctaaat     
     9121 cggaacccta aagggagccc ccgatttaga gcttgacggg gaaagccggc gaacgtggcg     
     9181 agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc     
     9241 acgctgcgcg taaccaccac acccgcgcgc ttaatgcgcc gctacagggc gcgtccattc     
     9301 gccattcagg atcgaattaa ttcttaatta acatcatcaa taatatacct t              
                            LOCUS       dna                      9351 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    457..462
                     /dbxref="REBASE:HpaI"
     Other Gene      715..895
                     /gene="HIV-1_5_LTR other"
     Other Gene      1006..1050
                     /gene="HIV-1_psi_pack other"
     misc_binding    1092..1097
                     /dbxref="REBASE:NruI"
     Regulatory_Seq  1557..1790
                     /gene="RRE reg"
     ORF             1600..2301
                     /sequence="ORF_1 rf(1)"
     misc_binding    2611..2616
                     /dbxref="REBASE:NdeI"
     Promoter        2885..2966
                     /gene="CMV prom"
     ORF             2901..4397
                     /sequence="ORF_3 rf(3)"
     Regulatory_Seq  3022..3061
                     /gene="tetO reg"
     misc_binding    3321..3326
                     /dbxref="REBASE:PstI"
     misc_binding    3751..3756
                     /dbxref="REBASE:StuI"
     misc_binding    4294..4299
                     /dbxref="REBASE:BamHI"
     Promoter        4412..4680
                     /gene="SV40 prom"
     Rep_Origin      4579..4656
                     /gene="SV40 origin"
     ORF             4646..5314
                     /sequence="ORF_2 rf(2)"
     Marker          4715..5314
                     /gene="puro marker"
     Other Gene      5924..5976
                     /gene="delta_U3 other"
     Other Gene      5977..6157
                     /gene="HIV-1_5_LTR other"
     Rep_Origin      6663..7282
                     /gene="pBR322 origin"
     Promoter        7935..7984
                     /gene="NEOKAN prom"
     misc_binding    8042..8047
                     /dbxref="REBASE:BclI"
     ORF             8073..8867
                     /sequence="ORF_4 rf(3)"
     Marker          8076..8864
                     /gene="NTP_II marker"
     Rep_Origin      8972..9277
                     /gene="f1 origin"
BASE COUNT    2271 a   2426 c   2584 g   2070 t    0 others
ORIGIN
        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta     
      481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag     
      541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg     
      601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact     
      661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct     
      721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt     
      781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac     
      841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc     
      901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc     
      961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa     
     1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg     
     1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata     
     1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc     
     1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga     
     1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc     
     1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca     
     1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag     
     1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta     
     1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga     
     1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg     
     1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg     
     1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc     
     1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg     
     1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat     
     1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac     
     1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat     
     1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca     
     2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga     
     2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg     
     2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa     
     2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga     
     2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag     
     2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa     
     2401 aattcaaaat tttcgggttt ttcgaaccta gggttccgcg ttacataact tacggtaaat     
     2461 ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt     
     2521 cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa     
     2581 actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc     
     2641 aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct     
     2701 acttggcagt acatctacgt ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt     
     2761 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg     
     2821 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca     
     2881 actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca     
     2941 gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc     
     3001 atagaagaac cgagtttaaa ctccctatca gtgatagaga tctccctatc agtgatagag     
     3061 agctagcgat atcaacaagt ttgtacaaaa aagttggcat gtcagccaga aagggctatc     
     3121 tgctcccttc gccaaattat cccacaacaa tgtcatgctc ggagagcccc gccgcgaact     
     3181 cttttttggt cgactcgctc atcagctcgg gcagaggcga ggcaggcggc ggtggtggtg     
     3241 gcgcgggggg cggcggcggt ggcggttact acgcccacgg cggggtctac ctgccgcccg     
     3301 ccgccgacct gccctacggg ctgcagagct gcgggctctt ccccacgctg ggcggcaagc     
     3361 gcaatgaggc agcgtcgccg ggcagcggtg gcggtggcgg gggtctaggt cccggggcgc     
     3421 acggctacgg gccctcgccc atagacctgt ggctagacgc gccccggtct tgccggatgg     
     3481 agccgcctga cgggccgccg ccgccgcccc agcagcagcc gccgcccccg ccgcaaccac     
     3541 cccagccagc gccgcaggcc acctcgtgct ctttcgcgca gaacatcaaa gaagagagct     
     3601 cctactgcct ctacgactcg gcggacaaat gccccaaagt ctcggccacc gccgccgaac     
     3661 tggctccctt cccgcggggc ccgccgcccg acggctgcgc cctgggcacc tccagcgggg     
     3721 tgccagtgcc tggctacttc cgcctttctc aggcctacgg caccgccaag ggctatggca     
     3781 gcggcggcgg cggcgcgcag caactcgggg ctggcccgtt ccccgcgcag cccccggggc     
     3841 gcggtttcga tctcccgccc gcgctagcct ccggctcggc cgatgcggcc cggaaggagc     
     3901 gagccctcga ttcgccgccg ccccccacgc tggcttgcgg cagcggcggg ggctcgcagg     
     3961 gcgacgagga ggcgcacgcg tcgtcctcgg ccgcggagga gctctccccg gccccttccg     
     4021 agagcagcaa agcctcgccg gagaaggatt ccctgggcaa ttccaaaggt gaaaacgcag     
     4081 ccaactggct cacggcaaag agtggtcgga agaagcgctg cccctacacg aagcaccaga     
     4141 cactggagct ggagaaggag tttctgttca atatgtacct tactcgagag cggcgcctag     
     4201 agattagccg cagcgtccac ctcacggaca gacaagtgaa aatctggttt cagaaccgca     
     4261 ggatgaaact gaagaaaatg aatcgagaaa accggatccg ggagctcaca gccaacttta     
     4321 atttttcctg cccaactttc ttgtacaaag tggttgatat cctcgagtac ccatacgacg     
     4381 tcccagacta cgcttgagtt taaacacgcg tggtgtggaa agtccccagg ctccccagca     
     4441 ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa ccaggtgtgg aaagtcccca     
     4501 ggctccccag caggcagaag tatgcaaagc atgcatctca attagtcagc aaccatagtc     
     4561 ccgcccctaa ctccgcccat cccgccccta actccgccca gttccgccca ttctccgccc     
     4621 catggctgac taattttttt tatttatgca gaggccgagg ccgcctcggc ctctgagcta     
     4681 ttccagaagt agtgaggagg cttttttgga ggccatgacc gagtacaagc ccacggtgcg     
     4741 cctcgccacc cgcgacgacg tccctcgggc cgtacgcacc ctcgccgccg cgttcgccga     
     4801 ctaccccgcc acgcgccaca ccgtggaccc ggaccgccac atcgagcggg tcaccgagct     
     4861 gcaagaactc ttcctcacgc gcgtcgggct cgacatcggc aaggtgtggg tcgcggacga     
     4921 cggcgccgcg gtggcggtct ggaccacgcc ggagagcgtc gaagcggggg cggtgttcgc     
     4981 cgagatcggc ccgcgcatgg ccgagttgag cggttcccgg ctggccgcgc agcaacagat     
     5041 ggaagggctc ctggcgccgc accggcccaa ggagcccgcg tggttcctgg ccaccgtcgg     
     5101 cgtctcgccc gaccaccagg gcaagggtct gggcagcgcc gtcgtgctcc ccggagtgga     
     5161 ggcggccgag cgcgccgggg tgcccgcctt cctggagacc tccgcgcccc gcaacctccc     
     5221 cttctacgag cggctcggct tcaccgtcac cgccgacgtc gaggtgcccg aaggaccgcg     
     5281 cacctggtgc atgacccgca agcccggtgc ctgaacgcgt tccggaaatc aacctctgga     
     5341 ttacaaaatt tgtgaaagat tgactggtat tcttaactat gttgctcctt ttacgctatg     
     5401 tggatacgct gctttaatgc ctttgtatca tgctattgct tcccgtatgg ctttcatttt     
     5461 ctcctccttg tataaatcct ggttgctgtc tctttatgag gagttgtggc ccgttgtcag     
     5521 gcaacgtggc gtggtgtgca ctgtgtttgc tgacgcaacc cccactggtt ggggcattgc     
     5581 caccacctgt cagctccttt ccgggacttt cgctttcccc ctccctattg ccacggcgga     
     5641 actcatcgcc gcctgccttg cccgctgctg gacaggggct cggctgttgg gcactgacaa     
     5701 ttccgtggtg ttgtcgggga agctgacgtc ctttccatgg ctgctcgcct gtgttgccac     
     5761 ctggattctg cgcgggacgt ccttctgcta cgtcccttcg gccctcaatc cagcggacct     
     5821 tccttcccgc ggcctgctgc cggctctgcg gcctcttccg cgtctcgcct tcgccctcag     
     5881 acgagtcgga tctccctttg ggccgcctcc ccgcctgtcc ggatggaagg gctaattcac     
     5941 tcccaacgaa tacaagatct gctttttgct tgtactgggt ctctctggtt agaccagatc     
     6001 tgagcctggg agctctctgg ctaactaggg aacccactgc ttaagcctca ataaagcttg     
     6061 ccttgagtgc ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc     
     6121 ctcagaccct tttagtcagt gtggaaaatc tctagcagta gtagttcatg tcatcttatt     
     6181 attcagtatt tataacttgc aaagaaatga atatcagaga gtgagaggaa cttgtttatt     
     6241 gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt     
     6301 ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgg     
     6361 catctatgtc gggtgcggag aaagaggtaa tgaaatggca ttatgggtat tatgggtctg     
     6421 cattaatgaa tcggccaacg atcccggtgt gaaataccgc acagatgcgt aaggagaaaa     
     6481 taccgcatca ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg     
     6541 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg     
     6601 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag     
     6661 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga     
     6721 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct     
     6781 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc     
     6841 tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg     
     6901 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc     
     6961 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca     
     7021 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag     
     7081 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct     
     7141 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc     
     7201 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga     
     7261 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca     
     7321 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat     
     7381 taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac     
     7441 caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc atccatagtt     
     7501 gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc tggccccagt     
     7561 gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc aataaaccag     
     7621 ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc catccagtct     
     7681 attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt gcgcaacgtt     
     7741 gttgaaaaag gatcttcacc tagatccttt tcacgtagaa agccagtccg cagaaacggt     
     7801 gctgaccccg gatgaatgtc agctactggg ctatctggac aagggaaaac gcaagcgcaa     
     7861 agagaaagca ggtagcttgc agtgggctta catggcgata gctagactgg gcggttttat     
     7921 ggacagcaag cgaaccggaa ttgccagctg gggcgccctc tggtaaggtt gggaagccct     
     7981 gcaaagtaaa ctggatggct ttctcgccgc caaggatctg atggcgcagg ggatcaagct     
     8041 ctgatcaaga gacaggatga ggatcgtttc gcatgattga acaagatgga ttgcacgcag     
     8101 gttctccggc cgcttgggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg     
     8161 gctgctctga tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca     
     8221 agaccgacct gtccggtgcc ctgaatgaac tgcaagacga ggcagcgcgg ctatcgtggc     
     8281 tggccacgac gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg     
     8341 actggctgct attgggcgaa gtgccggggc aggatctcct gtcatctcac cttgctcctg     
     8401 ccgagaaagt atccatcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta     
     8461 cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact cggatggaag     
     8521 ccggtcttgt cgatcaggat gatctggacg aagagcatca ggggctcgcg ccagccgaac     
     8581 tgttcgccag gctcaaggcg agcatgcccg acggcgagga tctcgtcgtg acccatggcg     
     8641 atgcctgctt gccgaatatc atggtggaaa atggccgctt ttctggattc atcgactgtg     
     8701 gccggctggg tgtggcggac cgctatcagg acatagcgtt ggctacccgt gatattgctg     
     8761 aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg     
     8821 attcgcagcg catcgccttc tatcgccttc ttgacgagtt cttctgaatt ttgttaaaat     
     8881 ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa tcggcaacat cccttataaa     
     8941 tcaaaagaat agaccgcgat agggttgagt gttgttccag tttggaacaa gagtccacta     
     9001 ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca     
     9061 ctacgtgaac catcacccaa atcaagtttt ttgcggtcga ggtgccgtaa agctctaaat     
     9121 cggaacccta aagggagccc ccgatttaga gcttgacggg gaaagccggc gaacgtggcg     
     9181 agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc     
     9241 acgctgcgcg taaccaccac acccgcgcgc ttaatgcgcc gctacagggc gcgtccattc     
     9301 gccattcagg atcgaattaa ttcttaatta acatcatcaa taatatacct t              
//
                        
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     TTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGTTTGTGACGTGGCGCGGGGCGT 60
      AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61    GGGAACGGGGCGGGTGACGTAGTAGTGTGGCGGAAGTGTGATGTTGCAAGTGTGGCGGAA 120
      CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

                                               Encap other(162,310)>>> 
                                               |
121   CACATGTAAGCGACGGATGTGGCAAAAGTGACGTTTTTGGTGTGCGCCGGTGTACACAGG 180
      GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181   AAGTGACAATTTTCGCGCGGTTTTAGGCGGATGTTGTAGTAAATTTGGGCGTAACCGAGT 240
      TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241   AAGATTTGGCCATTTTCGCGGGAAAACTGAATAAGAGGAAGTGAAATCTGAATAATTTTG 300
      TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301   TGTTACTCATAGCGCGTAATACGGCAGACCTCAGCGCTAGATTATTGAAGCATTTATCAG 360
      ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

          amp prom(365,393)<<< 
          |
361   GGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGG 420
      CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

                                             HpaI 
                                             |
421   GTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTTAACTATAACGGTCCTAAGGTA 480
      CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481   GCGAAAATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAG 540
      CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541   CAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGG 600
      GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601   TACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACT 660
      ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

                                                            HIV-1_5_LTR other(715,895)>>> 
                                                            |
661   GAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCT 720
      CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721   CTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTT 780
      GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781   AAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGAC 840
      TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841   TCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGC 900
      AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901   GCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTC 960
      CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

                                                   HIV-1_psi_pack other(1006,1050)>>> 
                                                   |
961   GGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAA 1020
      CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021  TTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGG 1080
      AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

                    NruI 
                    |
1081  GGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATA 1140
      CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141  AATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCC 1200
      TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201  TGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGA 1260
      ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261  CAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATC 1320
      GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321  AAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACA 1380
      TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381  AAAGTAAGACCACCGCACAGCAAGCCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAG 1440
      TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441  GGACATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTA 1500
      CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

                                                              RRE reg(1557,1790)>>> 
                                                              |
1501  GCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGA 1560
      CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

                                             ORF_1 rf(1)(1600,2301)>>> 
                                             |
1561  GCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACG 1620
      CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621  CTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTG 1680
      GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681  AGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTC 1740
      TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741  CAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGG 1800
      GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801  GGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAAT 1860
      CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861  AAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAAC 1920
      TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921  AATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAAT 1980
      TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981  GAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACA 2040
      CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041  AATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGA 2100
      TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101  ATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCG 2160
      TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161  TTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAA 2220
      AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221  GGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGA 2280
      CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281  AAGCTTGGGATTCGAATTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAG 2340
      TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

2341  AATAGTAGACATAATAGCAACAGACATACAAACTAAAGAACTACAAAAACAAATTACAAA 2400
      TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

2401  AATTCAAAATTTTCGGGTTTTTCGAACCTAGGGTTCCGCGTTACATAACTTACGGTAAAT 2460
      TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCCCAAGGCGCAATGTATTGAATGCCATTTA

2461  GGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTT 2520
      CCGGGCGGACCGACTGGCGGGTTGCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAA

2521  CCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAA 2580
      GGGTATCATTGCGGTTATCCCTGAAAGGTAACTGCAGTTACCCACCTCATAAATGCCATT

                                      NdeI 
                                      |
2581  ACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTC 2640
      TGACGGGTGAACCGTCATGTAGTTCACATAGTATACGGTTCATGCGGGGGATAACTGCAG

2641  AATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCT 2700
      TTACTGCCATTTACCGGGCGGACCGTAATACGGGTCATGTACTGGAATACCCTGAAAGGA

2701  ACTTGGCAGTACATCTACGTTTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGT 2760
      TGAACCGTCATGTAGATGCAAATCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCA

2761  ACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTG 2820
      TGTAGTTACCCGCACCTATCGCCAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAAC

2821  ACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACA 2880
      TGCAGTTACCCTCAAACAAAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGT

                          ORF_3 rf(3)(2901,4397)>>> 
                          |
          CMV prom(2885,2966)>>> 
          |               |
2881  ACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCA 2940
      TGAGGCGGGGTAACTGCGTTTACCCGCCATCCGCACATGCCACCCTCCAGATATATTCGT

2941  GAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCC 3000
      CTCGAGCAAATCACTTGGCAGTCTAGCGGACCTCTGCGGTAGGTGCGACAAAACTGGAGG

                           tetO reg(3022,3061)>>> 
                           |
3001  ATAGAAGAACCGAGTTTAAACTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAG 3060
      TATCTTCTTGGCTCAAATTTGAGGGATAGTCACTATCTCTAGAGGGATAGTCACTATCTC

3061  AGCTAGCGATATCAACAAGTTTGTACAAAAAAGTTGGCATGTCAGCCAGAAAGGGCTATC 3120
      TCGATCGCTATAGTTGTTCAAACATGTTTTTTCAACCGTACAGTCGGTCTTTCCCGATAG

3121  TGCTCCCTTCGCCAAATTATCCCACAACAATGTCATGCTCGGAGAGCCCCGCCGCGAACT 3180
      ACGAGGGAAGCGGTTTAATAGGGTGTTGTTACAGTACGAGCCTCTCGGGGCGGCGCTTGA

3181  CTTTTTTGGTCGACTCGCTCATCAGCTCGGGCAGAGGCGAGGCAGGCGGCGGTGGTGGTG 3240
      GAAAAAACCAGCTGAGCGAGTAGTCGAGCCCGTCTCCGCTCCGTCCGCCGCCACCACCAC

3241  GCGCGGGGGGCGGCGGCGGTGGCGGTTACTACGCCCACGGCGGGGTCTACCTGCCGCCCG 3300
      CGCGCCCCCCGCCGCCGCCACCGCCAATGATGCGGGTGCCGCCCCAGATGGACGGCGGGC

                               PstI 
                               |
3301  CCGCCGACCTGCCCTACGGGCTGCAGAGCTGCGGGCTCTTCCCCACGCTGGGCGGCAAGC 3360
      GGCGGCTGGACGGGATGCCCGACGTCTCGACGCCCGAGAAGGGGTGCGACCCGCCGTTCG

3361  GCAATGAGGCAGCGTCGCCGGGCAGCGGTGGCGGTGGCGGGGGTCTAGGTCCCGGGGCGC 3420
      CGTTACTCCGTCGCAGCGGCCCGTCGCCACCGCCACCGCCCCCAGATCCAGGGCCCCGCG

3421  ACGGCTACGGGCCCTCGCCCATAGACCTGTGGCTAGACGCGCCCCGGTCTTGCCGGATGG 3480
      TGCCGATGCCCGGGAGCGGGTATCTGGACACCGATCTGCGCGGGGCCAGAACGGCCTACC

3481  AGCCGCCTGACGGGCCGCCGCCGCCGCCCCAGCAGCAGCCGCCGCCCCCGCCGCAACCAC 3540
      TCGGCGGACTGCCCGGCGGCGGCGGCGGGGTCGTCGTCGGCGGCGGGGGCGGCGTTGGTG

3541  CCCAGCCAGCGCCGCAGGCCACCTCGTGCTCTTTCGCGCAGAACATCAAAGAAGAGAGCT 3600
      GGGTCGGTCGCGGCGTCCGGTGGAGCACGAGAAAGCGCGTCTTGTAGTTTCTTCTCTCGA

3601  CCTACTGCCTCTACGACTCGGCGGACAAATGCCCCAAAGTCTCGGCCACCGCCGCCGAAC 3660
      GGATGACGGAGATGCTGAGCCGCCTGTTTACGGGGTTTCAGAGCCGGTGGCGGCGGCTTG

3661  TGGCTCCCTTCCCGCGGGGCCCGCCGCCCGACGGCTGCGCCCTGGGCACCTCCAGCGGGG 3720
      ACCGAGGGAAGGGCGCCCCGGGCGGCGGGCTGCCGACGCGGGACCCGTGGAGGTCGCCCC

                                       StuI 
                                       |
3721  TGCCAGTGCCTGGCTACTTCCGCCTTTCTCAGGCCTACGGCACCGCCAAGGGCTATGGCA 3780
      ACGGTCACGGACCGATGAAGGCGGAAAGAGTCCGGATGCCGTGGCGGTTCCCGATACCGT

3781  GCGGCGGCGGCGGCGCGCAGCAACTCGGGGCTGGCCCGTTCCCCGCGCAGCCCCCGGGGC 3840
      CGCCGCCGCCGCCGCGCGTCGTTGAGCCCCGACCGGGCAAGGGGCGCGTCGGGGGCCCCG

3841  GCGGTTTCGATCTCCCGCCCGCGCTAGCCTCCGGCTCGGCCGATGCGGCCCGGAAGGAGC 3900
      CGCCAAAGCTAGAGGGCGGGCGCGATCGGAGGCCGAGCCGGCTACGCCGGGCCTTCCTCG

3901  GAGCCCTCGATTCGCCGCCGCCCCCCACGCTGGCTTGCGGCAGCGGCGGGGGCTCGCAGG 3960
      CTCGGGAGCTAAGCGGCGGCGGGGGGTGCGACCGAACGCCGTCGCCGCCCCCGAGCGTCC

3961  GCGACGAGGAGGCGCACGCGTCGTCCTCGGCCGCGGAGGAGCTCTCCCCGGCCCCTTCCG 4020
      CGCTGCTCCTCCGCGTGCGCAGCAGGAGCCGGCGCCTCCTCGAGAGGGGCCGGGGAAGGC

4021  AGAGCAGCAAAGCCTCGCCGGAGAAGGATTCCCTGGGCAATTCCAAAGGTGAAAACGCAG 4080
      TCTCGTCGTTTCGGAGCGGCCTCTTCCTAAGGGACCCGTTAAGGTTTCCACTTTTGCGTC

4081  CCAACTGGCTCACGGCAAAGAGTGGTCGGAAGAAGCGCTGCCCCTACACGAAGCACCAGA 4140
      GGTTGACCGAGTGCCGTTTCTCACCAGCCTTCTTCGCGACGGGGATGTGCTTCGTGGTCT

4141  CACTGGAGCTGGAGAAGGAGTTTCTGTTCAATATGTACCTTACTCGAGAGCGGCGCCTAG 4200
      GTGACCTCGACCTCTTCCTCAAAGACAAGTTATACATGGAATGAGCTCTCGCCGCGGATC

4201  AGATTAGCCGCAGCGTCCACCTCACGGACAGACAAGTGAAAATCTGGTTTCAGAACCGCA 4260
      TCTAATCGGCGTCGCAGGTGGAGTGCCTGTCTGTTCACTTTTAGACCAAAGTCTTGGCGT

                                        BamHI 
                                        |
4261  GGATGAAACTGAAGAAAATGAATCGAGAAAACCGGATCCGGGAGCTCACAGCCAACTTTA 4320
      CCTACTTTGACTTCTTTTACTTAGCTCTTTTGGCCTAGGCCCTCGAGTGTCGGTTGAAAT

4321  ATTTTTCCTGCCCAACTTTCTTGTACAAAGTGGTTGATATCCTCGAGTACCCATACGACG 4380
      TAAAAAGGACGGGTTGAAAGAACATGTTTCACCAACTATAGGAGCTCATGGGTATGCTGC

                                     SV40 prom(4412,4680)>>> 
                                     |
4381  TCCCAGACTACGCTTGAGTTTAAACACGCGTGGTGTGGAAAGTCCCCAGGCTCCCCAGCA 4440
      AGGGTCTGATGCGAACTCAAATTTGTGCGCACCACACCTTTCAGGGGTCCGAGGGGTCGT

4441  GGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCA 4500
      CCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTGGTCCACACCTTTCAGGGGT

4501  GGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTC 4560
      CCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTGGTATCAG

                        SV40 origin(4579,4656)>>> 
                        |
4561  CCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCC 4620
      GGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGCGGGTCAAGGCGGGTAAGAGGCGGG

                               ORF_2 rf(2)(4646,5314)>>> 
                               |
4621  CATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTA 4680
      GTACCGACTGATTAAAAAAAATAAATACGTCTCCGGCTCCGGCGGAGCCGGAGACTCGAT

                                        puro marker(4715,5314)>>> 
                                        |
4681  TTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCATGACCGAGTACAAGCCCACGGTGCG 4740
      AAGGTCTTCATCACTCCTCCGAAAAAACCTCCGGTACTGGCTCATGTTCGGGTGCCACGC

4741  CCTCGCCACCCGCGACGACGTCCCTCGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGA 4800
      GGAGCGGTGGGCGCTGCTGCAGGGAGCCCGGCATGCGTGGGAGCGGCGGCGCAAGCGGCT

4801  CTACCCCGCCACGCGCCACACCGTGGACCCGGACCGCCACATCGAGCGGGTCACCGAGCT 4860
      GATGGGGCGGTGCGCGGTGTGGCACCTGGGCCTGGCGGTGTAGCTCGCCCAGTGGCTCGA

4861  GCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGA 4920
      CGTTCTTGAGAAGGAGTGCGCGCAGCCCGAGCTGTAGCCGTTCCACACCCAGCGCCTGCT

4921  CGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGC 4980
      GCCGCGGCGCCACCGCCAGACCTGGTGCGGCCTCTCGCAGCTTCGCCCCCGCCACAAGCG

4981  CGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGAT 5040
      GCTCTAGCCGGGCGCGTACCGGCTCAACTCGCCAAGGGCCGACCGGCGCGTCGTTGTCTA

5041  GGAAGGGCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGG 5100
      CCTTCCCGAGGACCGCGGCGTGGCCGGGTTCCTCGGGCGCACCAAGGACCGGTGGCAGCC

5101  CGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGA 5160
      GCAGAGCGGGCTGGTGGTCCCGTTCCCAGACCCGTCGCGGCAGCACGAGGGGCCTCACCT

5161  GGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCC 5220
      CCGCCGGCTCGCGCGGCCCCACGGGCGGAAGGACCTCTGGAGGCGCGGGGCGTTGGAGGG

5221  CTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCG 5280
      GAAGATGCTCGCCGAGCCGAAGTGGCAGTGGCGGCTGCAGCTCCACGGGCTTCCTGGCGC

5281  CACCTGGTGCATGACCCGCAAGCCCGGTGCCTGAACGCGTTCCGGAAATCAACCTCTGGA 5340
      GTGGACCACGTACTGGGCGTTCGGGCCACGGACTTGCGCAAGGCCTTTAGTTGGAGACCT

5341  TTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATG 5400
      AATGTTTTAAACACTTTCTAACTGACCATAAGAATTGATACAACGAGGAAAATGCGATAC

5401  TGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTT 5460
      ACCTATGCGACGAAATTACGGAAACATAGTACGATAACGAAGGGCATACCGAAAGTAAAA

5461  CTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAG 5520
      GAGGAGGAACATATTTAGGACCAACGACAGAGAAATACTCCTCAACACCGGGCAACAGTC

5521  GCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGC 5580
      CGTTGCACCGCACCACACGTGACACAAACGACTGCGTTGGGGGTGACCAACCCCGTAACG

5581  CACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGA 5640
      GTGGTGGACAGTCGAGGAAAGGCCCTGAAAGCGAAAGGGGGAGGGATAACGGTGCCGCCT

5641  ACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAA 5700
      TGAGTAGCGGCGGACGGAACGGGCGACGACCTGTCCCCGAGCCGACAACCCGTGACTGTT

5701  TTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCAC 5760
      AAGGCACCACAACAGCCCCTTCGACTGCAGGAAAGGTACCGACGAGCGGACACAACGGTG

5761  CTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCT 5820
      GACCTAAGACGCGCCCTGCAGGAAGACGATGCAGGGAAGCCGGGAGTTAGGTCGCCTGGA

5821  TCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTCGCCTTCGCCCTCAG 5880
      AGGAAGGGCGCCGGACGACGGCCGAGACGCCGGAGAAGGCGCAGAGCGGAAGCGGGAGTC

                                                 delta_U3 other(5924,5976)>>> 
                                                 |
5881  ACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGTCCGGATGGAAGGGCTAATTCAC 5940
      TGCTCAGCCTAGAGGGAAACCCGGCGGAGGGGCGGACAGGCCTACCTTCCCGATTAAGTG

                                          HIV-1_5_LTR other(5977,6157)>>> 
                                          |
5941  TCCCAACGAATACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATC 6000
      AGGGTTGCTTATGTTCTAGACGAAAAACGAACATGACCCAGAGAGACCAATCTGGTCTAG

6001  TGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTG 6060
      ACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAATTCGGAGTTATTTCGAAC

6061  CCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCC 6120
      GGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTGAGACCATTGATCTCTAGG

6121  CTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATT 6180
      GAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCATCATCAAGTACAGTAGAATAA

6181  ATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATT 6240
      TAAGTCATAAATATTGAACGTTTCTTTACTTATAGTCTCTCACTCTCCTTGAACAAATAA

6241  GCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTT 6300
      CGTCGAATATTACCAATGTTTATTTCGTTATCGTAGTGTTTAAAGTGTTTATTTCGTAAA

6301  TTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGG 6360
      AAAAGTGACGTAAGATCAACACCAAACAGGTTTGAGTAGTTACATAGAATAGTACAGACC

6361  CATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGGCATTATGGGTATTATGGGTCTG 6420
      GTAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGTAATACCCATAATACCCAGAC

6421  CATTAATGAATCGGCCAACGATCCCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAA 6480
      GTAATTACTTAGCCGGTTGCTAGGGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTT

6481  TACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGG 6540
      ATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCC

6541  CTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGG 6600
      GACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCC

6601  GATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAG 6660
      CTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTC

        pBR322 origin(6663,7282)<<< 
        |
6661  GCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGA 6720
      CGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCT

6721  CGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCT 6780
      GCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGA

6781  GGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCC 6840
      CCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGG

6841  TTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCG 6900
      AAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGC

6901  GTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGC 6960
      CACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCG

6961  TGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCA 7020
      ACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGT

7021  CTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAG 7080
      GACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTC

7081  TTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCT 7140
      AAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCGA

7141  CTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACC 7200
      GACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGG

7201  ACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGA 7260
      TGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCT

7261  TCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCA 7320
      AGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGT

7321  CGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAAT 7380
      GCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTA

7381  TAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTAC 7440
      ATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAATG

7441  CAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTT 7500
      GTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAA

7501  GCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGT 7560
      CGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCA

7561  GCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAG 7620
      CGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTC

7621  CCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCT 7680
      GGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGA

7681  ATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTT 7740
      TAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAA

7741  GTTGAAAAAGGATCTTCACCTAGATCCTTTTCACGTAGAAAGCCAGTCCGCAGAAACGGT 7800
      CAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCA

7801  GCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAA 7860
      CGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTT

7861  AGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTAT 7920
      TCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAAATA

                    NEOKAN prom(7935,7984)>>> 
                    |
7921  GGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCT 7980
      CCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGA

7981  GCAAAGTAAACTGGATGGCTTTCTCGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGCT 8040
      CGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGA

                                         NTP_II marker(8076,8864)>>> 
                                         |
        BclI                          ORF_4 rf(3)(8073,8867)>>> 
        |                             |  |
8041  CTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAG 8100
      GACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTC

8101  GTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCG 8160
      CAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGC

8161  GCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCA 8220
      CGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGT

8221  AGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGC 8280
      TCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCG

8281  TGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGG 8340
      ACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCC

8341  ACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTG 8400
      TGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGAC

8401  CCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTA 8460
      GGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCCGAT

8461  CCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAG 8520
      GGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTC

8521  CCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAAC 8580
      GGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTG

8581  TGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCG 8640
      ACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGC

8641  ATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTG 8700
      TACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACAC

8701  GCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTG 8760
      CGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAACGAC

8761  AAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCG 8820
      TTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGC

8821  ATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTTTGTTAAAAT 8880
      TAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTA

8881  TTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAACATCCCTTATAAA 8940
      AAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTT

                                     f1 origin(8972,9277)<<< 
                                     |
8941  TCAAAAGAATAGACCGCGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTA 9000
      AGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGAT

9001  TTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCA 9060
      AATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGT

9061  CTACGTGAACCATCACCCAAATCAAGTTTTTTGCGGTCGAGGTGCCGTAAAGCTCTAAAT 9120
      GATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTA

9121  CGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCG 9180
      GCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGC

9181  AGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTC 9240
      TCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAG

9241  ACGCTGCGCGTAACCACCACACCCGCGCGCTTAATGCGCCGCTACAGGGCGCGTCCATTC 9300
      TGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAG

9301  GCCATTCAGGATCGAATTAATTCTTAATTAACATCATCAATAATATACCTT 9351
      CGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA
                            LOCUS       dna                      9351 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    457..462
                     /dbxref="REBASE:HpaI"
     Other Gene      715..895
                     /gene="HIV-1_5_LTR other"
     Other Gene      1006..1050
                     /gene="HIV-1_psi_pack other"
     misc_binding    1092..1097
                     /dbxref="REBASE:NruI"
     Regulatory_Seq  1557..1790
                     /gene="RRE reg"
     ORF             1600..2301
                     /sequence="ORF_1 rf(1)"
     misc_binding    2611..2616
                     /dbxref="REBASE:NdeI"
     Promoter        2885..2966
                     /gene="CMV prom"
     ORF             2901..4397
                     /sequence="ORF_3 rf(3)"
     Regulatory_Seq  3022..3061
                     /gene="tetO reg"
     misc_binding    3321..3326
                     /dbxref="REBASE:PstI"
     misc_binding    3751..3756
                     /dbxref="REBASE:StuI"
     misc_binding    4294..4299
                     /dbxref="REBASE:BamHI"
     Promoter        4412..4680
                     /gene="SV40 prom"
     Rep_Origin      4579..4656
                     /gene="SV40 origin"
     ORF             4646..5314
                     /sequence="ORF_2 rf(2)"
     Marker          4715..5314
                     /gene="puro marker"
     Other Gene      5924..5976
                     /gene="delta_U3 other"
     Other Gene      5977..6157
                     /gene="HIV-1_5_LTR other"
     Rep_Origin      6663..7282
                     /gene="pBR322 origin"
     Promoter        7935..7984
                     /gene="NEOKAN prom"
     misc_binding    8042..8047
                     /dbxref="REBASE:BclI"
     ORF             8073..8867
                     /sequence="ORF_4 rf(3)"
     Marker          8076..8864
                     /gene="NTP_II marker"
     Rep_Origin      8972..9277
                     /gene="f1 origin"
BASE COUNT    2271 a   2426 c   2584 g   2070 t    0 others