pLenti-Myc T58A

Vector Name pLenti-Myc T58A
VectorType Lentiviral Vector
Antibiotic Information No selection marker needed for cell immortalization. Primary cells that are not successfully immortalized will die after several passage rounds.
Sequencing Primers CMV Sequencing Primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
SV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional Information No Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.
ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt
gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa
cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg
aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt
aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg
tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag
ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg
gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta
gcgaaagctcagatctggatctcccgatcccctatggtcgactctcagtacaatctgctc
tgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagta
gtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattaatgtagtct
tatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaa
ggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgcctta
ttaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgc
agagatattgtatttaagtgcctagctcgatacataaacgggtctctctggttagaccag
atctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagc
ttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagaga
tccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggact
tgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgc
gcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggag
gctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgc
gatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatag
tatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcag
aaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaac
ttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataa
aagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccg
cacagcaagcgccgctgatcttcagacctggaggaggagatatgagggacaattgagaag
tgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggc
aaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgg
gttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggc
cagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggc
gcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcct
ggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaa
actcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaaca
gatttggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagctt
aatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattatt
ggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggta
tataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgt
actttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccacct
cccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagaga
cagagacagatccattcgattagtgaacggatctcgacggtatcgataagcttgggagtt
ccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgccc
attgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacg
tcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatat
gccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgccca
gtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctat
taccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacg
gggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatca
acgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcg
tgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggag
acgccatccacgctgttttgacctccatagaagacaccggctagcgtttaaacttaagct
tggtaccggatccactagtgaattcggcacgaggcggctagggtggaagagccgggcgag
cagagctgcgctgcgggcgtcctgggaagggagatccggagcgaatagggggcttcgcct
ctggcccagccctcccgctgatcccccagccagcggtccgcaacccttgccgcatccacg
aaactttgcccatagcagcgggcgggcactttgcactggaacttacaacacccgagcaag
gacgcgactctcccgacgcggggaggctattctgcccatttggggacacttccccgccgc
tgccaggacccgcttctctgaaaggctctccttgcagctgcttagacgctggattttttt
cgggtagtggaaaaccagcctcccgcgacgatgcccctcaacgttagcttcaccaacagg
aactatgacctcgactacgactcggtgcagccgtatttctactgcgacgaggaggagaac
ttctaccagcagcagcagcagagcgagctgcagcccccggcgcccagcgaggatatctgg
aagaaattcgagctgctgcccgctccgcccctgtcccctagccgccgctccgggctctgc
tcgccctcctacgttgcggtcacacccttctcccttcggggagacaacgacggcggtggc
gggagcttctccacggccgaccagctggagatggtgaccgagctgctgggaggagacatg
gtgaaccagagtttcatctgcgacccggacgacgagaccttcatcaaaaacatcatcatc
caggactgtatgtggagcggcttctcggccgccgccaagctcgtctcagagaagctggcc
tcctaccaggctgcgcgcaaagacagcggcagcccgaaccccgcccgcggccacagcgtc
tgctccacctccagcttgtacctgcaggatctgagcgccgccgcctcagagtgcatcgac
ccctcggtggtcttcccctaccctctcaacgacagcagctcgcccaagtcctgcgcctcg
caagactccagcgccttctctccgtcctcggattctctgctctcctcgacggagtcctcc
ccgcagggcagccccgagcccctggtgctccatgaggagacaccgcccaccaccagcagc
gactctgaggaggaacaagaagatgaggaagaaatcgatgttgtttctgtggaaaagagg
caggctcctggcaaaaggtcagagtctggatcaccttctgctggaggccacagcaaacct
cctcacagcccactggtcctcaagaggtgccacgtctccacacatcagcacaactacgca
gcgcctccctccactcggaaggactatcctgctgccaagagggtcaagttggacagtgtc
agagtcctgagacagatcagcaacaaccgaaaatgcaccagccccaggtcctcggacacc
gaggagaatgtcaagaggcgaacacacaacgtcttggagcgccagaggaggaacgagcta
aaacggagcttttttgccctgcgtgaccagatcccggagttggaaaacaatgaaaaggcc
cccaaggtagttatccttaaaaaagccacagcatacatcctgtccgtccaagcagaggag
caaaagctcatttctgaagaggacttgttgcggaaacgacgagaacagttgaaacacaaa
cttgaacagctacggaactcttgtgcgtaaggaaaagtaaggaaaacgattccttctaac
agaaatgtcctgagcaatcacctatgaacttgtttcaaatgcatgatcaaatgcaacctc
acaaccttggctgagtcttgagactgaaagatttagccataatgtaaactgcctcaaatt
ggactttgggcataaaagaacttttttatgcttaccatcttttttttttctttaacagat
ttgtatttaagaattgtttttaaaaaattttaagatttacacaatgtttctctgtaaata
ttgccattaaatgtaaataactttaataaaacgtttatagcagttacacagaatttcaat
cctagtatatagtacctagtattataggtactataaaccctaattttttttatttaagta
cattttgctttttaaagttgatttttttttattgtttttagaaaaaataaaataactggc
aaatataaaaaaaaaaaaaaaaaactcgactctagagcggccgcaccgcggagtactggg
ccccctaggctcgagcatcatcaccatcaccattgatgatccggctgtggaatgtgtgtc
agttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatc
tcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgc
aaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgc
ccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttattt
atgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggctttt
ttggaggcctagcgaccagatctaatgcgtgctagcacgcattagatcggtcgctagcga
ccagatctaatgcgtgctagcgaccagatctaatgcgtgctaggcttttgcaaaaagctt
gggctgcaggtcgaggcggatctgatcaagagacaggatgaggatcgtttcgcatgattg
aacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatg
actgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcagg
ggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacg
aggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacg
ttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcc
tgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggc
tgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagc
gagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatc
aggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgagg
atctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgct
tttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgt
tggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgc
tttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagt
tcttctgagcgggactctggggttcgatatctagcacgcattagatctggtcgctagcga
ccagatctaatgcgtgctagcacgcattagatctggtcgctagacaaggcagctgtagat
cttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaaga
caagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggag
ctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgctt
caagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttt
tagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtattta
taacttgcaaagaaatgaatatcagagagtgagaggaacttggggcctgaccagatctaa
tgcgtaggcctgaccagatctaatgcgtttaaaccgctgatcagcctcgactgtgccttc
tagttgccagccatctgttgttgcccgggcgcgatcgctgcccctcccccgtgccttcct
tgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgc
attgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaaggggg
aggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgagg
cggaaagaaccagcagatcgatctgcatctatgtcgggtgcggagaaagaggtaatgaaa
tggcattatgggtattatgggtctgcattaatgaatcggccaacgatcccggtgtgaaat
accgcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcac
tgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggt
aatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggcca
gcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgccc
ccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggact
ataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccct
gccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatag
ctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgca
cgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaa
cccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagc
gaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactag
aaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttgg
tagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagca
gcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtc
tgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaag
gatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatata
tgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgat
ctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacg
ggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggc
tccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgc
aactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttc
gccagttaatagtttgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacg
tagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatc
tggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatgg
cgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcg
ccctctggtaaggttgggaagccctgcaaagtaaactggatggctttctcgccgccaagg
atctgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatg
attgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggc
tatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcg
caggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaa
gacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctc
gacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggat
ctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcgg
cggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatc
gagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagag
catcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggc
gaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggc
cgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacata
gcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctc
gtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgac
gagttcttctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggc
cgaaatcggcaacatcccttataaatcaaaagaatagaccgcgatagggttgagtgttgt
tccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaa
aaccgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcg
gtcgaggtgccgtaaagctctaaatcggaaccctaaagggagcccccgatttagagcttg
acggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgc
tagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaat
gcgccgctacagggcgcgtccattcgccattcaggatcgaattaattcttaattaacatc
atcaataatatacctt
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
      1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt 
     61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa 
    121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg 
    181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt 
    241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg 
    301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag 
    361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 
    421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta 
    481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc 
    541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta 
    601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt aatgtagtct 
    661 tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca tgccttacaa 
    721 ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga tcgtgcctta 
    781 ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt gccgcattgc 
    841 agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg gttagaccag 
    901 atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc tcaataaagc 
    961 ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg taactagaga 
   1021 tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg aacagggact 
   1081 tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt gctgaagcgc 
   1141 gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg actagcggag 
   1201 gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga attagatcgc 
   1261 gatgggaaaa aattcggtta aggccagggg gaaagaaaaa atataaatta aaacatatag 
   1321 tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta gaaacatcag 
   1381 aaggctgtag acaaatactg ggacagctac aaccatccct tcagacagga tcagaagaac 
   1441 ttagatcatt atataataca gtagcaaccc tctattgtgt gcatcaaagg atagagataa 
   1501 aagacaccaa ggaagcttta gacaagatag aggaagagca aaacaaaagt aagaccaccg 
   1561 cacagcaagc gccgctgatc ttcagacctg gaggaggaga tatgagggac aattgagaag 
   1621 tgaattatat aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc 
   1681 aaagagaaga gtggtgcaga gagaaaaaag agcagtggga ataggagctt tgttccttgg 
   1741 gttcttggga gcagcaggaa gcactatggg cgcagcgtca atgacgctga cggtacaggc 
   1801 cagacaatta ttgtctggta tagtgcagca gcagaacaat ttgctgaggg ctattgaggc 
   1861 gcaacagcat ctgttgcaac tcacagtctg gggcatcaag cagctccagg caagaatcct 
   1921 ggctgtggaa agatacctaa aggatcaaca gctcctgggg atttggggtt gctctggaaa 
   1981 actcatttgc accactgctg tgccttggaa tgctagttgg agtaataaat ctctggaaca 
   2041 gatttggaat cacacgacct ggatggagtg ggacagagaa attaacaatt acacaagctt 
   2101 aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa aagaatgaac aagaattatt 
   2161 ggaattagat aaatgggcaa gtttgtggaa ttggtttaac ataacaaatt ggctgtggta 
   2221 tataaaatta ttcataatga tagtaggagg cttggtaggt ttaagaatag tttttgctgt 
   2281 actttctata gtgaatagag ttaggcaggg atattcacca ttatcgtttc agacccacct 
   2341 cccaaccccg aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagagaga 
   2401 cagagacaga tccattcgat tagtgaacgg atctcgacgg tatcgataag cttgggagtt 
   2461 ccgcgttaca taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc 
   2521 attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg 
   2581 tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat 
   2641 gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca 
   2701 gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat 
   2761 taccatggtg atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg 
   2821 gggatttcca agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca 
   2881 acgggacttt ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg 
   2941 tgtacggtgg gaggtctata taagcagagc tcgtttagtg aaccgtcaga tcgcctggag 
   3001 acgccatcca cgctgttttg acctccatag aagacaccgg ctagcgttta aacttaagct 
   3061 tggtaccgga tccactagtg aattcggcac gaggcggcta gggtggaaga gccgggcgag 
   3121 cagagctgcg ctgcgggcgt cctgggaagg gagatccgga gcgaataggg ggcttcgcct 
   3181 ctggcccagc cctcccgctg atcccccagc cagcggtccg caacccttgc cgcatccacg 
   3241 aaactttgcc catagcagcg ggcgggcact ttgcactgga acttacaaca cccgagcaag 
   3301 gacgcgactc tcccgacgcg gggaggctat tctgcccatt tggggacact tccccgccgc 
   3361 tgccaggacc cgcttctctg aaaggctctc cttgcagctg cttagacgct ggattttttt 
   3421 cgggtagtgg aaaaccagcc tcccgcgacg atgcccctca acgttagctt caccaacagg 
   3481 aactatgacc tcgactacga ctcggtgcag ccgtatttct actgcgacga ggaggagaac 
   3541 ttctaccagc agcagcagca gagcgagctg cagcccccgg cgcccagcga ggatatctgg 
   3601 aagaaattcg agctgctgcc cgctccgccc ctgtccccta gccgccgctc cgggctctgc 
   3661 tcgccctcct acgttgcggt cacacccttc tcccttcggg gagacaacga cggcggtggc 
   3721 gggagcttct ccacggccga ccagctggag atggtgaccg agctgctggg aggagacatg 
   3781 gtgaaccaga gtttcatctg cgacccggac gacgagacct tcatcaaaaa catcatcatc 
   3841 caggactgta tgtggagcgg cttctcggcc gccgccaagc tcgtctcaga gaagctggcc 
   3901 tcctaccagg ctgcgcgcaa agacagcggc agcccgaacc ccgcccgcgg ccacagcgtc 
   3961 tgctccacct ccagcttgta cctgcaggat ctgagcgccg ccgcctcaga gtgcatcgac 
   4021 ccctcggtgg tcttccccta ccctctcaac gacagcagct cgcccaagtc ctgcgcctcg 
   4081 caagactcca gcgccttctc tccgtcctcg gattctctgc tctcctcgac ggagtcctcc 
   4141 ccgcagggca gccccgagcc cctggtgctc catgaggaga caccgcccac caccagcagc 
   4201 gactctgagg aggaacaaga agatgaggaa gaaatcgatg ttgtttctgt ggaaaagagg 
   4261 caggctcctg gcaaaaggtc agagtctgga tcaccttctg ctggaggcca cagcaaacct 
   4321 cctcacagcc cactggtcct caagaggtgc cacgtctcca cacatcagca caactacgca 
   4381 gcgcctccct ccactcggaa ggactatcct gctgccaaga gggtcaagtt ggacagtgtc 
   4441 agagtcctga gacagatcag caacaaccga aaatgcacca gccccaggtc ctcggacacc 
   4501 gaggagaatg tcaagaggcg aacacacaac gtcttggagc gccagaggag gaacgagcta 
   4561 aaacggagct tttttgccct gcgtgaccag atcccggagt tggaaaacaa tgaaaaggcc 
   4621 cccaaggtag ttatccttaa aaaagccaca gcatacatcc tgtccgtcca agcagaggag 
   4681 caaaagctca tttctgaaga ggacttgttg cggaaacgac gagaacagtt gaaacacaaa 
   4741 cttgaacagc tacggaactc ttgtgcgtaa ggaaaagtaa ggaaaacgat tccttctaac 
   4801 agaaatgtcc tgagcaatca cctatgaact tgtttcaaat gcatgatcaa atgcaacctc 
   4861 acaaccttgg ctgagtcttg agactgaaag atttagccat aatgtaaact gcctcaaatt 
   4921 ggactttggg cataaaagaa cttttttatg cttaccatct tttttttttc tttaacagat 
   4981 ttgtatttaa gaattgtttt taaaaaattt taagatttac acaatgtttc tctgtaaata 
   5041 ttgccattaa atgtaaataa ctttaataaa acgtttatag cagttacaca gaatttcaat 
   5101 cctagtatat agtacctagt attataggta ctataaaccc taattttttt tatttaagta 
   5161 cattttgctt tttaaagttg attttttttt attgttttta gaaaaaataa aataactggc 
   5221 aaatataaaa aaaaaaaaaa aaaactcgac tctagagcgg ccgcaccgcg gagtactggg 
   5281 ccccctaggc tcgagcatca tcaccatcac cattgatgat ccggctgtgg aatgtgtgtc 
   5341 agttagggtg tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa agcatgcatc 
   5401 tcaattagtc agcaaccagg tgtggaaagt ccccaggctc cccagcaggc agaagtatgc 
   5461 aaagcatgca tctcaattag tcagcaacca tagtcccgcc cctaactccg cccatcccgc 
   5521 ccctaactcc gcccagttcc gcccattctc cgccccatgg ctgactaatt ttttttattt 
   5581 atgcagaggc cgaggccgcc tcggcctctg agctattcca gaagtagtga ggaggctttt 
   5641 ttggaggcct agcgaccaga tctaatgcgt gctagcacgc attagatcgg tcgctagcga 
   5701 ccagatctaa tgcgtgctag cgaccagatc taatgcgtgc taggcttttg caaaaagctt 
   5761 gggctgcagg tcgaggcgga tctgatcaag agacaggatg aggatcgttt cgcatgattg 
   5821 aacaagatgg attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg 
   5881 actgggcaca acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg 
   5941 ggcgcccggt tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaggacg 
   6001 aggcagcgcg gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg 
   6061 ttgtcactga agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc 
   6121 tgtcatctca ccttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc 
   6181 tgcatacgct tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc 
   6241 gagcacgtac tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc 
   6301 aggggctcgc gccagccgaa ctgttcgcca ggctcaaggc gcgcatgccc gacggcgagg 
   6361 atctcgtcgt gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct 
   6421 tttctggatt catcgactgt ggccggctgg gtgtggcgga ccgctatcag gacatagcgt 
   6481 tggctacccg tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc 
   6541 tttacggtat cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt 
   6601 tcttctgagc gggactctgg ggttcgatat ctagcacgca ttagatctgg tcgctagcga 
   6661 ccagatctaa tgcgtgctag cacgcattag atctggtcgc tagacaaggc agctgtagat 
   6721 cttagccact ttttaaaaga aaagggggga ctggaagggc taattcactc ccaacgaaga 
   6781 caagatctgc tttttgcttg tactgggtct ctctggttag accagatctg agcctgggag 
   6841 ctctctggct aactagggaa cccactgctt aagcctcaat aaagcttgcc ttgagtgctt 
   6901 caagtagtgt gtgcccgtct gttgtgtgac tctggtaact agagatccct cagacccttt 
   6961 tagtcagtgt ggaaaatctc tagcagtagt agttcatgtc atcttattat tcagtattta 
   7021 taacttgcaa agaaatgaat atcagagagt gagaggaact tggggcctga ccagatctaa 
   7081 tgcgtaggcc tgaccagatc taatgcgttt aaaccgctga tcagcctcga ctgtgccttc 
   7141 tagttgccag ccatctgttg ttgcccgggc gcgatcgctg cccctccccc gtgccttcct 
   7201 tgaccctgga aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc 
   7261 attgtctgag taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg 
   7321 aggattggga agacaatagc aggcatgctg gggatgcggt gggctctatg gcttctgagg 
   7381 cggaaagaac cagcagatcg atctgcatct atgtcgggtg cggagaaaga ggtaatgaaa 
   7441 tggcattatg ggtattatgg gtctgcatta atgaatcggc caacgatccc ggtgtgaaat 
   7501 accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac 
   7561 tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt 
   7621 aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca 
   7681 gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc 
   7741 ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 
   7801 ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 
   7861 gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 
   7921 ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 
   7981 cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 
   8041 cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc 
   8101 gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag 
   8161 aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg 
   8221 tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca 
   8281 gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc 
   8341 tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag 
   8401 gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata 
   8461 tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat 
   8521 ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg 
   8581 ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc 
   8641 tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc 
   8701 aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc 
   8761 gccagttaat agtttgcgca acgttgttga aaaaggatct tcacctagat ccttttcacg 
   8821 tagaaagcca gtccgcagaa acggtgctga ccccggatga atgtcagcta ctgggctatc 
   8881 tggacaaggg aaaacgcaag cgcaaagaga aagcaggtag cttgcagtgg gcttacatgg 
   8941 cgatagctag actgggcggt tttatggaca gcaagcgaac cggaattgcc agctggggcg 
   9001 ccctctggta aggttgggaa gccctgcaaa gtaaactgga tggctttctc gccgccaagg 
   9061 atctgatggc gcaggggatc aagctctgat caagagacag gatgaggatc gtttcgcatg 
   9121 attgaacaag atggattgca cgcaggttct ccggccgctt gggtggagag gctattcggc 
   9181 tatgactggg cacaacagac aatcggctgc tctgatgccg ccgtgttccg gctgtcagcg 
   9241 caggggcgcc cggttctttt tgtcaagacc gacctgtccg gtgccctgaa tgaactgcaa 
   9301 gacgaggcag cgcggctatc gtggctggcc acgacgggcg ttccttgcgc agctgtgctc 
   9361 gacgttgtca ctgaagcggg aagggactgg ctgctattgg gcgaagtgcc ggggcaggat 
   9421 ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca tcatggctga tgcaatgcgg 
   9481 cggctgcata cgcttgatcc ggctacctgc ccattcgacc accaagcgaa acatcgcatc 
   9541 gagcgagcac gtactcggat ggaagccggt cttgtcgatc aggatgatct ggacgaagag 
   9601 catcaggggc tcgcgccagc cgaactgttc gccaggctca aggcgagcat gcccgacggc 
   9661 gaggatctcg tcgtgaccca tggcgatgcc tgcttgccga atatcatggt ggaaaatggc 
   9721 cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg cggaccgcta tcaggacata 
   9781 gcgttggcta cccgtgatat tgctgaagag cttggcggcg aatgggctga ccgcttcctc 
   9841 gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg ccttctatcg ccttcttgac 
   9901 gagttcttct gaattttgtt aaaatttttg ttaaatcagc tcatttttta accaataggc 
   9961 cgaaatcggc aacatccctt ataaatcaaa agaatagacc gcgatagggt tgagtgttgt 
  10021 tccagtttgg aacaagagtc cactattaaa gaacgtggac tccaacgtca aagggcgaaa 
  10081 aaccgtctat cagggcgatg gcccactacg tgaaccatca cccaaatcaa gttttttgcg 
  10141 gtcgaggtgc cgtaaagctc taaatcggaa ccctaaaggg agcccccgat ttagagcttg 
  10201 acggggaaag ccggcgaacg tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc 
  10261 tagggcgctg gcaagtgtag cggtcacgct gcgcgtaacc accacacccg cgcgcttaat 
  10321 gcgccgctac agggcgcgtc cattcgccat tcaggatcga attaattctt aattaacatc 
  10381 atcaataata tacctt