pLenti-hTERT

Vector Name pLenti-hTERT
VectorType Lentiviral Vector
Antibiotic Information No selection marker needed for cell immortalization. Primary cells that are not successfully immortalized will die after several passage rounds.
Sequencing Primers CMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
SV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional Information No Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.
1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt aatgtagtct
661 tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca tgccttacaa
721 ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga tcgtgcctta
781 ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt gccgcattgc
841 agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg gttagaccag
901 atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc tcaataaagc
961 ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg taactagaga
1021 tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg aacagggact
1081 tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt gctgaagcgc
1141 gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg actagcggag
1201 gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga attagatcgc
1261 gatgggaaaa aattcggtta aggccagggg gaaagaaaaa atataaatta aaacatatag
1321 tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta gaaacatcag
1381 aaggctgtag acaaatactg ggacagctac aaccatccct tcagacagga tcagaagaac
1441 ttagatcatt atataataca gtagcaaccc tctattgtgt gcatcaaagg atagagataa
1501 aagacaccaa ggaagcttta gacaagatag aggaagagca aaacaaaagt aagaccaccg
1561 cacagcaagc gccgctgatc ttcagacctg gaggaggaga tatgagggac aattgagaag
1621 tgaattatat aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc
1681 aaagagaaga gtggtgcaga gagaaaaaag agcagtggga ataggagctt tgttccttgg
1741 gttcttggga gcagcaggaa gcactatggg cgcagcgtca atgacgctga cggtacaggc
1801 cagacaatta ttgtctggta tagtgcagca gcagaacaat ttgctgaggg ctattgaggc
1861 gcaacagcat ctgttgcaac tcacagtctg gggcatcaag cagctccagg caagaatcct
1921 ggctgtggaa agatacctaa aggatcaaca gctcctgggg atttggggtt gctctggaaa
1981 actcatttgc accactgctg tgccttggaa tgctagttgg agtaataaat ctctggaaca
2041 gatttggaat cacacgacct ggatggagtg ggacagagaa attaacaatt acacaagctt
2101 aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa aagaatgaac aagaattatt
2161 ggaattagat aaatgggcaa gtttgtggaa ttggtttaac ataacaaatt ggctgtggta
2221 tataaaatta ttcataatga tagtaggagg cttggtaggt ttaagaatag tttttgctgt
2281 actttctata gtgaatagag ttaggcaggg atattcacca ttatcgtttc agacccacct
2341 cccaaccccg aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagagaga
2401 cagagacaga tccattcgat tagtgaacgg atctcgacgg tatcgataag cttgggagtt
2461 ccgcgttaca taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc
2521 attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg
2581 tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat
2641 gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca
2701 gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat
2761 taccatggtg atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg
2821 gggatttcca agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca
2881 acgggacttt ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg
2941 tgtacggtgg gaggtctata taagcagagc tcgtttagtg aaccgtcaga tcgcctggag
3001 acgccatcca cgctgttttg acctccatag aagaaccgag tttaaactcc ctatcagtga
3061 tagagatctc cctatcagtg atagagagct agccccggga tcgatcaatt gagtacttac
3121 gtaggtaccc cagtgtggtg gcctgcaggt gaattccacc atgccgcgcg ctccccgctg
3181 ccgagccgtg cgctccctgc tgcgcagcca ctaccgcgag gtgctgccgc tggccacgtt
3241 cgtgcggcgc ctggggcccc agggctggcg gctggtgcag cgcggggacc cggcggcttt
3301 ccgcgcgctg gtggcccagt gcctggtgtg cgtgccctgg gacgcacggc cgccccccgc
3361 cgccccctcc ttccgccagg tgtcctgcct gaaggagctg gtggcccgag tgctgcagag
3421 gctgtgcgag cgcggcgcga agaacgtgct ggccttcggc ttcgcgctgc tggacggggc
3481 ccgcgggggc ccccccgagg ccttcaccac cagcgtgcgc agctacctgc ccaacacggt
3541 gaccgacgca ctgcggggga gcggggcgtg ggggctgctg ctgcgccgcg tgggcgacga
3601 cgtgctggtt cacctgctgg cacgctgcgc gctctttgtg ctggtggctc ccagctgcgc
3661 ctaccaggtg tgcgggccgc cgctgtacca gctcggcgct gccactcagg cccggccccc
3721 gccacacgct agtggacccc gaaggcgtct gggatgcgaa cgggcctgga accatagcgt
3781 cagggaggcc ggggtccccc tgggcctgcc agccccgggt gcgaggaggc gcgggggcag
3841 tgccagccga agtctgccgt tgcccaagag gcccaggcgt ggcgctgccc ctgagccgga
3901 gcggacgccc gttgggcagg ggtcctgggc ccacccgggc aggacgcgtg gaccgagtga
3961 ccgtggtttc tgtgtggtgt cacctgccag acccgccgaa gaagccacct ctttggaggg
4021 tgcgctctct ggcacgcgcc actcccaccc atccgtgggc cgccagcacc acgcgggccc
4081 cccatccaca tcgcggccac cacgtccctg ggacacgcct tgtcccccgg tgtacgccga
4141 gaccaagcac ttcctctact cctcaggcga caaggagcag ctgcggccct ccttcctact
4201 cagctctctg aggcccagcc tgactggcgc tcggaggctc gtggagacca tctttctggg
4261 ttccaggccc tggatgccag ggactccccg caggttgccc cgcctgcccc agcgctactg
4321 gcaaatgcgg cccctgtttc tggagctgct tgggaaccac gcgcagtgcc cctacggggt
4381 gctcctcaag acgcactgcc cgctgcgagc tgcggtcacc ccagcagccg gtgtctgtgc
4441 ccgggagaag ccccagggct ctgtggcggc ccccgaggag gaggacacag acccccgtcg
4501 cctggtgcag ctgctccgcc agcacagcag cccctggcag gtgtacggct tcgtgcgggc
4561 ctgcctgcgc cggctggtgc ccccaggcct ctggggctcc aggcacaacg aacgccgctt
4621 cctcaggaac accaagaagt tcatctccct ggggaagcat gccaagctct cgctgcagga
4681 gctgacgtgg aagatgagcg tgcgggactg cgcttggctg cgcaggagcc caggggttgg
4741 ctgtgttccg gccgcagagc accgtctgcg tgaggagatc ctggccaagt tcctgcactg
4801 gctgatgagt gtgtacgtcg tcgagctgct caggtctttc ttttatgtca cggagaccac
4861 gtttcaaaag aacaggctct ttttctaccg gaagagtgtc tggagcaagt tgcaaagcat
4921 tggaatcaga cagcacttga agagggtgca gctgcgggag ctgtcggaag cagaggtcag
4981 gcagcatcgg gaagccaggc ccgccctgct gacgtccaga ctccgcttca tccccaagcc
5041 tgacgggctg cggccgattg tgaacatgga ctacgtcgtg ggagccagaa cgttccgcag
5101 agaaaagagg gccgagcgtc tcacctcgag ggtgaaggca ctgttcagcg tgctcaacta
5161 cgagcgggcg cggcgccccg gcctcctggg cgcctctgtg ctgggcctgg acgatatcca
5221 cagggcctgg cgcaccttcg tgctgcgtgt gcgggcccag gacccgccgc ctgagctgta
5281 ctttgtcaag gtggatgtga cgggcgcgta cgacaccatc ccccaggaca ggctcacgga
5341 ggtcatcgcc agcatcatca aaccccagaa cacgtactgc gtgcgtcggt atgccgtggt
5401 ccagaaggcc gcccatgggc acgtccgcaa ggccttcaag agccacgtct ctaccttgac
5461 agacctccag ccgtacatgc gacagttcgt ggctcacctg caggagacca gcccgctgag
5521 ggatgccgtc gtcatcgagc agagctcctc cctgaatgag gccagcagtg gcctcttcga
5581 cgtcttccta cgcttcatgt gccaccacgc cgtgcgcatc aggggcaagt cctacgtcca
5641 gtgccagggg atcccgcagg gctccatcct ctccacgctg ctctgcagcc tgtgctacgg
5701 cgacatggag aacaagctgt ttgcggggat tcggcgggac gggctgctcc tgcgtttggt
5761 ggatgatttc ttgttggtga cacctcacct cacccacgcg aaaaccttcc tcaggaccct
5821 ggtccgaggt gtccctgagt atggctgcgt ggtgaacttg cggaagacag tggtgaactt
5881 ccctgtagaa gacgaggccc tgggtggcac ggcttttgtt cagatgccgg cccacggcct
5941 attcccctgg tgcggcctgc tgctggatac ccggaccctg gaggtgcaga gcgactactc
6001 cagctatgcc cggacctcca tcagagccag tctcaccttc aaccgcggct tcaaggctgg
6061 gaggaacatg cgtcgcaaac tctttggggt cttgcggctg aagtgtcaca gcctgtttct
6121 ggatttgcag gtgaacagcc tccagacggt gtgcaccaac atctacaaga tcctcctgct
6181 gcaggcgtac aggtttcacg catgtgtgct gcagctccca tttcatcagc aagtttggaa
6241 gaaccccaca tttttcctgc gcgtcatctc tgacacggcc tccctctgct actccatcct
6301 gaaagccaag aacgcaggga tgtcgctggg ggccaagggc gccgccggcc ctctgccctc
6361 cgaggccgtg cagtggctgt gccaccaagc attcctgctc aagctgactc gacaccgtgt
6421 cacctacgtg ccactcctgg ggtcactcag gacagcccag acgcagctga gtcggaagct
6481 cccggggacg acgctgactg ccctggaggc cgcagccaac ccggcactgc cctcagactt
6541 caagaccatc ctggactgat ggccacccgc ccacagccag gccgagagca gacaccagca
6601 gccctgtcac gccgggctct acgtcccagg gagggagggg cggcccacac ccaggcccgc
6661 accgctggga gtctgaggcc tgagtgagtg tttggccgag gcctgcatgt ccggctgaag
6721 gctgagtgtc cggctgaggc ctgagcgagt gtccagccaa gggctgagtg tccagcacac
6781 ctgccgtctt cacttcccca caggctggcg ctcggcttag gctcgagcat catcaccatc
6841 accattgatg atccggctgt ggaatgtgtg tcagttaggg tgtggaaagt ccccaggctc
6901 cccagcaggc agaagtatgc aaagcatgca tctcaattag tcagcaacca ggtgtggaaa
6961 gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac
7021 catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt ccgcccattc
7081 tccgccccat ggctgactaa ttttttttat ttatgcagag gccgaggccg cctcggcctc
7141 tgagctattc cagaagtagt gaggaggctt ttttggaggc ctagtgacca gatctaatgc
7201 gttctaatgc gtaccagatc taatgcgtgc tagcgaccag atctaatgcg tgctaggccc
7261 ttttgcaaaa agcttgggct gcaggtcgag gcggatctga tcaagagaca ggatgaggat
7321 cgtttcgcat gcagaggccg aggccgcctc ggcctctgag ctattccaga agtagtgagg
7381 aggctttttt ggaggccatg accgagtaca agcccacggt gcgcctcgcc acccgcgacg
7441 acgtccctcg ggccgtacgc accctcgccg ccgcgttcgc cgactacccc gccacgcgcc
7501 acaccgtgga cccggaccgc cacatcgagc gggtcaccga gctgcaagaa ctcttcctca
7561 cgcgcgtcgg gctcgacatc ggcaaggtgt gggtcgcgga cgacggcgcc gcggtggcgg
7621 tctggaccac gccggagagc gtcgaagcgg gggcggtgtt cgccgagatc ggcccgcgca
7681 tggccgagtt gagcggttcc cggctggccg cgcagcaaca gatggaaggg ctcctggcgc
7741 cgcaccggcc caaggagccc gcgtggttcc tggccaccgt cggcgtctcg cccgaccacc
7801 agggcaaggg tctgggcagc gccgtcgtgc tccccggagt ggaggcggcc gagcgcgccg
7861 gggtgcccgc cttcctggag acctccgcgc cccgcaacct ccccttctac gagcggctcg
7921 gcttcaccgt caccgccgac gtcgaggtgc ccgaaggacc gcgcacctgg tgcatgaccc
7981 gcaagcccgg tgcctgaacg cgttccggaa atcaacctct ggattacaaa atttgtgaaa
8041 gattgactgg tattcttaac tatgttgctc cttttacgct atgtggatac gctgctttaa
8101 tgcctttgta tcatgctatt gcttcccgta tggctttcat tttctcctcc ttgtataaat
8161 cctggttgct gtctctttat gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt
8221 gcactgtgtt tgctgacgca acccccactg gttggggcat tgccaccacc tgtcagctcc
8281 tttccgggac tttcgctttc cccctcccta ttgccacggc ggaactcatc gccgcctgcc
8341 ttgcccgctg ctggacaggg gctcggctgt tgggcactga caattccgtg gtgttgtcgg
8401 ggaagctgac gtcctttcca tggctgctcg cctgtgttgc cacctggatt ctgcgcggga
8461 cgtccttctg ctacgtccct tcggccctca atccagcgga ccttccttcc cgcggcctgc
8521 tgccggctct gcggcctctt ccgcgtctcc gccttcgccc tcagacgagt cggatctccc
8581 tttggccgcc tccccgcctg gtacctttaa gaccaatgac ttacaaggca gctgtagatc
8641 ttagccactt tttaaaagaa aaggggggac tggaagggct aattcactcc caacgaagac
8701 aagatctgct ttttgcttgt actgggtctc tctggttaga ccagatctga gcctgggagc
8761 tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct tgagtgcttc
8821 aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc agaccctttt
8881 agtcagtgtg gaaaatctct agcagtagta gttcatgtca tcttattatt cagtatttat
8941 aacttgcaaa gaaatgaata tcagagagtg agaggaactt gggcctgacc agatctaatg
9001 cgtaggccgt ttaaaccgct gatcagcctc gactgtgcct tctagttgcc agccatctgt
9061 tgttgcccgg gcgcgatcgc tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca
9121 ctcccactgt cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc
9181 attctattct ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata
9241 gcaggcatgc tggggatgcg gtgggctcta tggcttctga ggcggaaaga accagcagat
9301 cgatctgcat ctatgtcggg tgcggagaaa gaggtaatga aatggcatta tgggtattat
9361 gggtctgcat taatgaatcg gccaacgatc ccggtgtgaa ataccgcaca gatgcgtaag
9421 gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt
9481 cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga
9541 atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg
9601 taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa
9661 aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt
9721 tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct
9781 gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct
9841 cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc
9901 cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt
9961 atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc
10021 tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat
10081 ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa
10141 acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa
10201 aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga
10261 aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct
10321 tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga
10381 cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc
10441 catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg
10501 ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat
10561 aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat
10621 ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg
10681 caacgttgtt gaaaaaggat cttcacctag atccttttca cgtagaaagc cagtccgcag
10741 aaacggtgct gaccccggat gaatgtcagc tactgggcta tctggacaag ggaaaacgca
10801 agcgcaaaga gaaagcaggt agcttgcagt gggcttacat ggcgatagct agactgggcg
10861 gttttatgga cagcaagcga accggaattg ccagctgggg cgccctctgg taaggttggg
10921 aagccctgca aagtaaactg gatggctttc tcgccgccaa ggatctgatg gcgcagggga
10981 tcaagctctg atcaagagac aggatgagga tcgtttcgca tgattgaaca agatggattg
11041 cacgcaggtt ctccggccgc ttgggtggag aggctattcg gctatgactg ggcacaacag
11101 acaatcggct gctctgatgc cgccgtgttc cggctgtcag cgcaggggcg cccggttctt
11161 tttgtcaaga ccgacctgtc cggtgccctg aatgaactgc aagacgaggc agcgcggcta
11221 tcgtggctgg ccacgacggg cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg
11281 ggaagggact ggctgctatt gggcgaagtg ccggggcagg atctcctgtc atctcacctt
11341 gctcctgccg agaaagtatc catcatggct gatgcaatgc ggcggctgca tacgcttgat
11401 ccggctacct gcccattcga ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg
11461 atggaagccg gtcttgtcga tcaggatgat ctggacgaag agcatcaggg gctcgcgcca
11521 gccgaactgt tcgccaggct caaggcgagc atgcccgacg gcgaggatct cgtcgtgacc
11581 catggcgatg cctgcttgcc gaatatcatg gtggaaaatg gccgcttttc tggattcatc
11641 gactgtggcc ggctgggtgt ggcggaccgc tatcaggaca tagcgttggc tacccgtgat
11701 attgctgaag agcttggcgg cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc
11761 gctcccgatt cgcagcgcat cgccttctat cgccttcttg acgagttctt ctgaattttg
11821 ttaaaatttt tgttaaatca gctcattttt taaccaatag gccgaaatcg gcaacatccc
11881 ttataaatca aaagaataga ccgcgatagg gttgagtgtt gttccagttt ggaacaagag
11941 tccactatta aagaacgtgg actccaacgt caaagggcga aaaaccgtct atcagggcga
12001 tggcccacta cgtgaaccat cacccaaatc aagttttttg cggtcgaggt gccgtaaagc
12061 tctaaatcgg aaccctaaag ggagcccccg atttagagct tgacggggaa agccggcgaa
12121 cgtggcgaga aaggaaggga agaaagcgaa aggagcgggc gctagggcgc tggcaagtgt
12181 agcggtcacg ctgcgcgtaa ccaccacacc cgcgcgctta atgcgccgct acagggcgcg
12241 tccattcgcc attcaggatc gaattaattc ttaattaaca tcatcaataa tatacctt
                            LOCUS       dna                     12298 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
Other Gene 880..1060
/gene="HIV-1_5_LTR other"
Other Gene 1171..1215
/gene="HIV-1_psi_pack other"
misc_binding 1257..1262
/dbxref="REBASE:NruI"
Regulatory_Seq 1723..1956
/gene="RRE reg"
ORF 1766..2449
/sequence="ORF_2 rf(2)"
misc_binding 2636..2641
/dbxref="REBASE:NdeI"
Promoter 2911..2992
/gene="CMV prom"
Regulatory_Seq 3048..3087
/gene="tetO reg"
ORF 3089..3775
/sequence="ORF_7 rf(4)"
misc_binding 3151..3156
/dbxref="REBASE:EcoRI"
ORF 3161..6559
/sequence="ORF_3 rf(2)"
ORF 4196..5416
/sequence="ORF_6 rf(4)"
misc_binding 5213..5218
/dbxref="REBASE:EcoRV"
misc_binding 5649..5654
/dbxref="REBASE:BamHI"
Tag 6828..6845
/gene="6xHis tag"
Regulatory_Seq 6856..7092
/gene="SV40ER reg"
Promoter 6879..7147
/gene="SV40 prom"
Rep_Origin 7046..7123
/gene="SV40 origin"
ORF 7329..7997
/sequence="ORF_4 rf(3)"
Marker 7398..7997
/gene="puro marker"
ORF 8100..8750
/sequence="ORF_5 rf(3)"
Other Gene 8671..8723
/gene="delta_U3 other"
Other Gene 8724..8904
/gene="HIV-1_5_LTR other"
Rep_Origin 9610..10229
/gene="pBR322 origin"
Promoter 10882..10931
/gene="NEOKAN prom"
ORF 11020..11814
/sequence="ORF_1 rf(1)"
Marker 11023..11811
/gene="NTP_II marker"
Rep_Origin 11919..12224
/gene="f1 origin"
BASE COUNT 2715 a 3389 c 3549 g 2645 t 0 others
ORIGIN
1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt aatgtagtct
661 tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca tgccttacaa
721 ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga tcgtgcctta
781 ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt gccgcattgc
841 agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg gttagaccag
901 atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc tcaataaagc
961 ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg taactagaga
1021 tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg aacagggact
1081 tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt gctgaagcgc
1141 gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg actagcggag
1201 gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga attagatcgc
1261 gatgggaaaa aattcggtta aggccagggg gaaagaaaaa atataaatta aaacatatag
1321 tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta gaaacatcag
1381 aaggctgtag acaaatactg ggacagctac aaccatccct tcagacagga tcagaagaac
1441 ttagatcatt atataataca gtagcaaccc tctattgtgt gcatcaaagg atagagataa
1501 aagacaccaa ggaagcttta gacaagatag aggaagagca aaacaaaagt aagaccaccg
1561 cacagcaagc gccgctgatc ttcagacctg gaggaggaga tatgagggac aattgagaag
1621 tgaattatat aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc
1681 aaagagaaga gtggtgcaga gagaaaaaag agcagtggga ataggagctt tgttccttgg
1741 gttcttggga gcagcaggaa gcactatggg cgcagcgtca atgacgctga cggtacaggc
1801 cagacaatta ttgtctggta tagtgcagca gcagaacaat ttgctgaggg ctattgaggc
1861 gcaacagcat ctgttgcaac tcacagtctg gggcatcaag cagctccagg caagaatcct
1921 ggctgtggaa agatacctaa aggatcaaca gctcctgggg atttggggtt gctctggaaa
1981 actcatttgc accactgctg tgccttggaa tgctagttgg agtaataaat ctctggaaca
2041 gatttggaat cacacgacct ggatggagtg ggacagagaa attaacaatt acacaagctt
2101 aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa aagaatgaac aagaattatt
2161 ggaattagat aaatgggcaa gtttgtggaa ttggtttaac ataacaaatt ggctgtggta
2221 tataaaatta ttcataatga tagtaggagg cttggtaggt ttaagaatag tttttgctgt
2281 actttctata gtgaatagag ttaggcaggg atattcacca ttatcgtttc agacccacct
2341 cccaaccccg aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagagaga
2401 cagagacaga tccattcgat tagtgaacgg atctcgacgg tatcgataag cttgggagtt
2461 ccgcgttaca taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc
2521 attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg
2581 tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat
2641 gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca
2701 gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat
2761 taccatggtg atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg
2821 gggatttcca agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca
2881 acgggacttt ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg
2941 tgtacggtgg gaggtctata taagcagagc tcgtttagtg aaccgtcaga tcgcctggag
3001 acgccatcca cgctgttttg acctccatag aagaaccgag tttaaactcc ctatcagtga
3061 tagagatctc cctatcagtg atagagagct agccccggga tcgatcaatt gagtacttac
3121 gtaggtaccc cagtgtggtg gcctgcaggt gaattccacc atgccgcgcg ctccccgctg
3181 ccgagccgtg cgctccctgc tgcgcagcca ctaccgcgag gtgctgccgc tggccacgtt
3241 cgtgcggcgc ctggggcccc agggctggcg gctggtgcag cgcggggacc cggcggcttt
3301 ccgcgcgctg gtggcccagt gcctggtgtg cgtgccctgg gacgcacggc cgccccccgc
3361 cgccccctcc ttccgccagg tgtcctgcct gaaggagctg gtggcccgag tgctgcagag
3421 gctgtgcgag cgcggcgcga agaacgtgct ggccttcggc ttcgcgctgc tggacggggc
3481 ccgcgggggc ccccccgagg ccttcaccac cagcgtgcgc agctacctgc ccaacacggt
3541 gaccgacgca ctgcggggga gcggggcgtg ggggctgctg ctgcgccgcg tgggcgacga
3601 cgtgctggtt cacctgctgg cacgctgcgc gctctttgtg ctggtggctc ccagctgcgc
3661 ctaccaggtg tgcgggccgc cgctgtacca gctcggcgct gccactcagg cccggccccc
3721 gccacacgct agtggacccc gaaggcgtct gggatgcgaa cgggcctgga accatagcgt
3781 cagggaggcc ggggtccccc tgggcctgcc agccccgggt gcgaggaggc gcgggggcag
3841 tgccagccga agtctgccgt tgcccaagag gcccaggcgt ggcgctgccc ctgagccgga
3901 gcggacgccc gttgggcagg ggtcctgggc ccacccgggc aggacgcgtg gaccgagtga
3961 ccgtggtttc tgtgtggtgt cacctgccag acccgccgaa gaagccacct ctttggaggg
4021 tgcgctctct ggcacgcgcc actcccaccc atccgtgggc cgccagcacc acgcgggccc
4081 cccatccaca tcgcggccac cacgtccctg ggacacgcct tgtcccccgg tgtacgccga
4141 gaccaagcac ttcctctact cctcaggcga caaggagcag ctgcggccct ccttcctact
4201 cagctctctg aggcccagcc tgactggcgc tcggaggctc gtggagacca tctttctggg
4261 ttccaggccc tggatgccag ggactccccg caggttgccc cgcctgcccc agcgctactg
4321 gcaaatgcgg cccctgtttc tggagctgct tgggaaccac gcgcagtgcc cctacggggt
4381 gctcctcaag acgcactgcc cgctgcgagc tgcggtcacc ccagcagccg gtgtctgtgc
4441 ccgggagaag ccccagggct ctgtggcggc ccccgaggag gaggacacag acccccgtcg
4501 cctggtgcag ctgctccgcc agcacagcag cccctggcag gtgtacggct tcgtgcgggc
4561 ctgcctgcgc cggctggtgc ccccaggcct ctggggctcc aggcacaacg aacgccgctt
4621 cctcaggaac accaagaagt tcatctccct ggggaagcat gccaagctct cgctgcagga
4681 gctgacgtgg aagatgagcg tgcgggactg cgcttggctg cgcaggagcc caggggttgg
4741 ctgtgttccg gccgcagagc accgtctgcg tgaggagatc ctggccaagt tcctgcactg
4801 gctgatgagt gtgtacgtcg tcgagctgct caggtctttc ttttatgtca cggagaccac
4861 gtttcaaaag aacaggctct ttttctaccg gaagagtgtc tggagcaagt tgcaaagcat
4921 tggaatcaga cagcacttga agagggtgca gctgcgggag ctgtcggaag cagaggtcag
4981 gcagcatcgg gaagccaggc ccgccctgct gacgtccaga ctccgcttca tccccaagcc
5041 tgacgggctg cggccgattg tgaacatgga ctacgtcgtg ggagccagaa cgttccgcag
5101 agaaaagagg gccgagcgtc tcacctcgag ggtgaaggca ctgttcagcg tgctcaacta
5161 cgagcgggcg cggcgccccg gcctcctggg cgcctctgtg ctgggcctgg acgatatcca
5221 cagggcctgg cgcaccttcg tgctgcgtgt gcgggcccag gacccgccgc ctgagctgta
5281 ctttgtcaag gtggatgtga cgggcgcgta cgacaccatc ccccaggaca ggctcacgga
5341 ggtcatcgcc agcatcatca aaccccagaa cacgtactgc gtgcgtcggt atgccgtggt
5401 ccagaaggcc gcccatgggc acgtccgcaa ggccttcaag agccacgtct ctaccttgac
5461 agacctccag ccgtacatgc gacagttcgt ggctcacctg caggagacca gcccgctgag
5521 ggatgccgtc gtcatcgagc agagctcctc cctgaatgag gccagcagtg gcctcttcga
5581 cgtcttccta cgcttcatgt gccaccacgc cgtgcgcatc aggggcaagt cctacgtcca
5641 gtgccagggg atcccgcagg gctccatcct ctccacgctg ctctgcagcc tgtgctacgg
5701 cgacatggag aacaagctgt ttgcggggat tcggcgggac gggctgctcc tgcgtttggt
5761 ggatgatttc ttgttggtga cacctcacct cacccacgcg aaaaccttcc tcaggaccct
5821 ggtccgaggt gtccctgagt atggctgcgt ggtgaacttg cggaagacag tggtgaactt
5881 ccctgtagaa gacgaggccc tgggtggcac ggcttttgtt cagatgccgg cccacggcct
5941 attcccctgg tgcggcctgc tgctggatac ccggaccctg gaggtgcaga gcgactactc
6001 cagctatgcc cggacctcca tcagagccag tctcaccttc aaccgcggct tcaaggctgg
6061 gaggaacatg cgtcgcaaac tctttggggt cttgcggctg aagtgtcaca gcctgtttct
6121 ggatttgcag gtgaacagcc tccagacggt gtgcaccaac atctacaaga tcctcctgct
6181 gcaggcgtac aggtttcacg catgtgtgct gcagctccca tttcatcagc aagtttggaa
6241 gaaccccaca tttttcctgc gcgtcatctc tgacacggcc tccctctgct actccatcct
6301 gaaagccaag aacgcaggga tgtcgctggg ggccaagggc gccgccggcc ctctgccctc
6361 cgaggccgtg cagtggctgt gccaccaagc attcctgctc aagctgactc gacaccgtgt
6421 cacctacgtg ccactcctgg ggtcactcag gacagcccag acgcagctga gtcggaagct
6481 cccggggacg acgctgactg ccctggaggc cgcagccaac ccggcactgc cctcagactt
6541 caagaccatc ctggactgat ggccacccgc ccacagccag gccgagagca gacaccagca
6601 gccctgtcac gccgggctct acgtcccagg gagggagggg cggcccacac ccaggcccgc
6661 accgctggga gtctgaggcc tgagtgagtg tttggccgag gcctgcatgt ccggctgaag
6721 gctgagtgtc cggctgaggc ctgagcgagt gtccagccaa gggctgagtg tccagcacac
6781 ctgccgtctt cacttcccca caggctggcg ctcggcttag gctcgagcat catcaccatc
6841 accattgatg atccggctgt ggaatgtgtg tcagttaggg tgtggaaagt ccccaggctc
6901 cccagcaggc agaagtatgc aaagcatgca tctcaattag tcagcaacca ggtgtggaaa
6961 gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac
7021 catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt ccgcccattc
7081 tccgccccat ggctgactaa ttttttttat ttatgcagag gccgaggccg cctcggcctc
7141 tgagctattc cagaagtagt gaggaggctt ttttggaggc ctagtgacca gatctaatgc
7201 gttctaatgc gtaccagatc taatgcgtgc tagcgaccag atctaatgcg tgctaggccc
7261 ttttgcaaaa agcttgggct gcaggtcgag gcggatctga tcaagagaca ggatgaggat
7321 cgtttcgcat gcagaggccg aggccgcctc ggcctctgag ctattccaga agtagtgagg
7381 aggctttttt ggaggccatg accgagtaca agcccacggt gcgcctcgcc acccgcgacg
7441 acgtccctcg ggccgtacgc accctcgccg ccgcgttcgc cgactacccc gccacgcgcc
7501 acaccgtgga cccggaccgc cacatcgagc gggtcaccga gctgcaagaa ctcttcctca
7561 cgcgcgtcgg gctcgacatc ggcaaggtgt gggtcgcgga cgacggcgcc gcggtggcgg
7621 tctggaccac gccggagagc gtcgaagcgg gggcggtgtt cgccgagatc ggcccgcgca
7681 tggccgagtt gagcggttcc cggctggccg cgcagcaaca gatggaaggg ctcctggcgc
7741 cgcaccggcc caaggagccc gcgtggttcc tggccaccgt cggcgtctcg cccgaccacc
7801 agggcaaggg tctgggcagc gccgtcgtgc tccccggagt ggaggcggcc gagcgcgccg
7861 gggtgcccgc cttcctggag acctccgcgc cccgcaacct ccccttctac gagcggctcg
7921 gcttcaccgt caccgccgac gtcgaggtgc ccgaaggacc gcgcacctgg tgcatgaccc
7981 gcaagcccgg tgcctgaacg cgttccggaa atcaacctct ggattacaaa atttgtgaaa
8041 gattgactgg tattcttaac tatgttgctc cttttacgct atgtggatac gctgctttaa
8101 tgcctttgta tcatgctatt gcttcccgta tggctttcat tttctcctcc ttgtataaat
8161 cctggttgct gtctctttat gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt
8221 gcactgtgtt tgctgacgca acccccactg gttggggcat tgccaccacc tgtcagctcc
8281 tttccgggac tttcgctttc cccctcccta ttgccacggc ggaactcatc gccgcctgcc
8341 ttgcccgctg ctggacaggg gctcggctgt tgggcactga caattccgtg gtgttgtcgg
8401 ggaagctgac gtcctttcca tggctgctcg cctgtgttgc cacctggatt ctgcgcggga
8461 cgtccttctg ctacgtccct tcggccctca atccagcgga ccttccttcc cgcggcctgc
8521 tgccggctct gcggcctctt ccgcgtctcc gccttcgccc tcagacgagt cggatctccc
8581 tttggccgcc tccccgcctg gtacctttaa gaccaatgac ttacaaggca gctgtagatc
8641 ttagccactt tttaaaagaa aaggggggac tggaagggct aattcactcc caacgaagac
8701 aagatctgct ttttgcttgt actgggtctc tctggttaga ccagatctga gcctgggagc
8761 tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct tgagtgcttc
8821 aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc agaccctttt
8881 agtcagtgtg gaaaatctct agcagtagta gttcatgtca tcttattatt cagtatttat
8941 aacttgcaaa gaaatgaata tcagagagtg agaggaactt gggcctgacc agatctaatg
9001 cgtaggccgt ttaaaccgct gatcagcctc gactgtgcct tctagttgcc agccatctgt
9061 tgttgcccgg gcgcgatcgc tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca
9121 ctcccactgt cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc
9181 attctattct ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata
9241 gcaggcatgc tggggatgcg gtgggctcta tggcttctga ggcggaaaga accagcagat
9301 cgatctgcat ctatgtcggg tgcggagaaa gaggtaatga aatggcatta tgggtattat
9361 gggtctgcat taatgaatcg gccaacgatc ccggtgtgaa ataccgcaca gatgcgtaag
9421 gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt
9481 cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga
9541 atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg
9601 taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa
9661 aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt
9721 tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct
9781 gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct
9841 cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc
9901 cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt
9961 atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc
10021 tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat
10081 ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa
10141 acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa
10201 aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga
10261 aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct
10321 tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga
10381 cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc
10441 catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg
10501 ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat
10561 aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat
10621 ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg
10681 caacgttgtt gaaaaaggat cttcacctag atccttttca cgtagaaagc cagtccgcag
10741 aaacggtgct gaccccggat gaatgtcagc tactgggcta tctggacaag ggaaaacgca
10801 agcgcaaaga gaaagcaggt agcttgcagt gggcttacat ggcgatagct agactgggcg
10861 gttttatgga cagcaagcga accggaattg ccagctgggg cgccctctgg taaggttggg
10921 aagccctgca aagtaaactg gatggctttc tcgccgccaa ggatctgatg gcgcagggga
10981 tcaagctctg atcaagagac aggatgagga tcgtttcgca tgattgaaca agatggattg
11041 cacgcaggtt ctccggccgc ttgggtggag aggctattcg gctatgactg ggcacaacag
11101 acaatcggct gctctgatgc cgccgtgttc cggctgtcag cgcaggggcg cccggttctt
11161 tttgtcaaga ccgacctgtc cggtgccctg aatgaactgc aagacgaggc agcgcggcta
11221 tcgtggctgg ccacgacggg cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg
11281 ggaagggact ggctgctatt gggcgaagtg ccggggcagg atctcctgtc atctcacctt
11341 gctcctgccg agaaagtatc catcatggct gatgcaatgc ggcggctgca tacgcttgat
11401 ccggctacct gcccattcga ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg
11461 atggaagccg gtcttgtcga tcaggatgat ctggacgaag agcatcaggg gctcgcgcca
11521 gccgaactgt tcgccaggct caaggcgagc atgcccgacg gcgaggatct cgtcgtgacc
11581 catggcgatg cctgcttgcc gaatatcatg gtggaaaatg gccgcttttc tggattcatc
11641 gactgtggcc ggctgggtgt ggcggaccgc tatcaggaca tagcgttggc tacccgtgat
11701 attgctgaag agcttggcgg cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc
11761 gctcccgatt cgcagcgcat cgccttctat cgccttcttg acgagttctt ctgaattttg
11821 ttaaaatttt tgttaaatca gctcattttt taaccaatag gccgaaatcg gcaacatccc
11881 ttataaatca aaagaataga ccgcgatagg gttgagtgtt gttccagttt ggaacaagag
11941 tccactatta aagaacgtgg actccaacgt caaagggcga aaaaccgtct atcagggcga
12001 tggcccacta cgtgaaccat cacccaaatc aagttttttg cggtcgaggt gccgtaaagc
12061 tctaaatcgg aaccctaaag ggagcccccg atttagagct tgacggggaa agccggcgaa
12121 cgtggcgaga aaggaaggga agaaagcgaa aggagcgggc gctagggcgc tggcaagtgt
12181 agcggtcacg ctgcgcgtaa ccaccacacc cgcgcgctta atgcgccgct acagggcgcg
12241 tccattcgcc attcaggatc gaattaattc ttaattaaca tcatcaataa tatacctt
//
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaagctcagatctggatctcccgatcccctatggtcgactctcagtacaatctgctc 540
CGCTTTCGAGTCTAGACCTAGAGGGCTAGGGGATACCAGCTGAGAGTCATGTTAGACGAG

541 tgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagta 600
ACTACGGCGTATCAATTCGGTCATAGACGAGGGACGAACACACAACCTCCAGCGACTCAT

601 gtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattaatgtagtct 660
CACGCGCTCGTTTTAAATTCGATGTTGTTCCGTTCCGAACTGGCTGTTAATTACATCAGA

661 tatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaa 720
ATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATCGTTGTACGGAATGTT

721 ggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgcctta 780
CCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACCATGCTAGCACGGAAT

781 ttaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgc 840
AATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGACTTAACGGCGTAACG

HIV-1_5_LTR other(880,1060)>>>
|
841 agagatattgtatttaagtgcctagctcgatacataaacgggtctctctggttagaccag 900
TCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGAGAGACCAATCTGGTC

901 atctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagc 960
TAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAATTCGGAGTTATTTCG

961 ttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagaga 1020
AACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTGAGACCATTGATCTCT

1021 tccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggact 1080
AGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCGCGGGCTTGTCCCTGA

1081 tgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgc 1140
ACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAGCCGAACGACTTCGCG

HIV-1_psi_pack other(1171,1215)>>>
|
1141 gcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggag 1200
CGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTTAAAACTGATCGCCTC

1201 gctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgc 1260
CGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCCCCTCTTAATCTAGCG

NruI
|
1261 gatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatag 1320
CTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATATTTAATTTTGTATATC

1321 tatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcag 1380
ATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGGACAATCTTTGTAGTC

1381 aaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaac 1440
TTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCTGTCCTAGTCTTCTTG

1441 ttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataa 1500
AATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAGTTTCCTATCTCTATT

1501 aagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccg 1560
TTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGTTTTCATTCTGGTGGC

1561 cacagcaagcgccgctgatcttcagacctggaggaggagatatgagggacaattgagaag 1620
GTGTCGTTCGCGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTCCCTGTTAACTCTTC

1621 tgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggc 1680
ACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCATCGTGGGTGGTTCCG

RRE reg(1723,1956)>>>
|
1681 aaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgg 1740
TTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCTCGAAACAAGGAACC

ORF_2 rf(2)(1766,2449)>>>
|
1741 gttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggc 1800
CAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGCGACTGCCATGTCCG

1801 cagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggc 1860
GTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGACTCCCGATAACTCCG

1861 gcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcct 1920
CGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAGGTCCGTTCTTAGGA

1921 ggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaa 1980
CCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACCCCAACGAGACCTTT

1981 actcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaaca 2040
TGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTATTTAGAGACCTTGT

2041 gatttggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagctt 2100
CTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTGTTAATGTGTTCGAA

2101 aatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattatt 2160
TTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTACTTGTTCTTAATAA

2161 ggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggta 2220
CCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGTTTAACCGACACCAT

2221 tataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgt 2280
ATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCTTATCAAAAACGACA

2281 actttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccacct 2340
TGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGCAAAGTCTGGGTGGA

2341 cccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagaga 2400
GGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTTCCACCTCTCTCTCT

2401 cagagacagatccattcgattagtgaacggatctcgacggtatcgataagcttgggagtt 2460
GTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCTATTCGAACCCTCAA

2461 ccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgccc 2520
GGCGCAATGTATTGAATGCCATTTACCGGGCGGACCGACTGGCGGGTTGCTGGGGGCGGG

2521 attgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacg 2580
TAACTGCAGTTATTACTGCATACAAGGGTATCATTGCGGTTATCCCTGAAAGGTAACTGC

NdeI
|
2581 tcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatat 2640
AGTTACCCACCTCATAAATGCCATTTGACGGGTGAACCGTCATGTAGTTCACATAGTATA

2641 gccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgccca 2700
CGGTTCATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGACCGTAATACGGGT

2701 gtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctat 2760
CATGTACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCATAATCAGTAGCGATA

2761 taccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacg 2820
ATGGTACCACTACGCCAAAACCGTCATGTAGTTACCCGCACCTATCGCCAAACTGAGTGC

2821 gggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatca 2880
CCCTAAAGGTTCAGAGGTGGGGTAACTGCAGTTACCCTCAAACAAAACCGTGGTTTTAGT

CMV prom(2911,2992)>>>
|
2881 acgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcg 2940
TGCCCTGAAAGGTTTTACAGCATTGTTGAGGCGGGGTAACTGCGTTTACCCGCCATCCGC

2941 tgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggag 3000
ACATGCCACCCTCCAGATATATTCGTCTCGAGCAAATCACTTGGCAGTCTAGCGGACCTC

tetO reg(3048,3087)>>>
|
3001 acgccatccacgctgttttgacctccatagAAGAACCGAGTTTAAACTCCCTATCAGTGA 3060
TGCGGTAGGTGCGACAAAACTGGAGGTATCTTCTTGGCTCAAATTTGAGGGATAGTCACT

ORF_7 rf(4)(3089,3775)<<<
|
3061 TAGAGATCTCCCTATCAGTGATAGAGAGCTAGCCCCGGGATCGATCAATTGAGTACTTAC 3120
ATCTCTAGAGGGATAGTCACTATCTCTCGATCGGGGCCCTAGCTAGTTAACTCATGAATG

EcoRI ORF_3 rf(2)(3161,6559)>>>
| |
3121 GTAGGTACCCCAGTGTGGTGGCCTGCAGGTGAATTCCACCatgccgcgcgctccccgctg 3180
CATCCATGGGGTCACACCACCGGACGTCCACTTAAGGTGGTACGGCGCGCGAGGGGCGAC

3181 ccgagccgtgcgctccctgctgcgcagccactaccgcgaggtgctgccgctggccacgtt 3240
GGCTCGGCACGCGAGGGACGACGCGTCGGTGATGGCGCTCCACGACGGCGACCGGTGCAA

3241 cgtgcggcgcctggggccccagggctggcggctggtgcagcgcggggacccggcggcttt 3300
GCACGCCGCGGACCCCGGGGTCCCGACCGCCGACCACGTCGCGCCCCTGGGCCGCCGAAA

3301 ccgcgcgctggtggcccagtgcctggtgtgcgtgccctgggacgcacggccgccccccgc 3360
GGCGCGCGACCACCGGGTCACGGACCACACGCACGGGACCCTGCGTGCCGGCGGGGGGCG

3361 cgccccctccttccgccaggtgtcctgcctgaaggagctggtggcccgagtgctgcagag 3420
GCGGGGGAGGAAGGCGGTCCACAGGACGGACTTCCTCGACCACCGGGCTCACGACGTCTC

3421 gctgtgcgagcgcggcgcgaagaacgtgctggccttcggcttcgcgctgctggacggggc 3480
CGACACGCTCGCGCCGCGCTTCTTGCACGACCGGAAGCCGAAGCGCGACGACCTGCCCCG

3481 ccgcgggggcccccccgaggccttcaccaccagcgtgcgcagctacctgcccaacacggt 3540
GGCGCCCCCGGGGGGGCTCCGGAAGTGGTGGTCGCACGCGTCGATGGACGGGTTGTGCCA

3541 gaccgacgcactgcgggggagcggggcgtgggggctgctgctgcgccgcgtgggcgacga 3600
CTGGCTGCGTGACGCCCCCTCGCCCCGCACCCCCGACGACGACGCGGCGCACCCGCTGCT

3601 cgtgctggttcacctgctggcacgctgcgcgctctttgtgctggtggctcccagctgcgc 3660
GCACGACCAAGTGGACGACCGTGCGACGCGCGAGAAACACGACCACCGAGGGTCGACGCG

3661 ctaccaggtgtgcgggccgccgctgtaccagctcggcgctgccactcaggcccggccccc 3720
GATGGTCCACACGCCCGGCGGCGACATGGTCGAGCCGCGACGGTGAGTCCGGGCCGGGGG

3721 gccacacgctagtggaccccgaaggcgtctgggatgcgaacgggcctggaaccatagcgt 3780
CGGTGTGCGATCACCTGGGGCTTCCGCAGACCCTACGCTTGCCCGGACCTTGGTATCGCA

3781 cagggaggccggggtccccctgggcctgccagccccgggtgcgaggaggcgcgggggcag 3840
GTCCCTCCGGCCCCAGGGGGACCCGGACGGTCGGGGCCCACGCTCCTCCGCGCCCCCGTC

3841 tgccagccgaagtctgccgttgcccaagaggcccaggcgtggcgctgcccctgagccgga 3900
ACGGTCGGCTTCAGACGGCAACGGGTTCTCCGGGTCCGCACCGCGACGGGGACTCGGCCT

3901 gcggacgcccgttgggcaggggtcctgggcccacccgggcaggacgcgtggaccgagtga 3960
CGCCTGCGGGCAACCCGTCCCCAGGACCCGGGTGGGCCCGTCCTGCGCACCTGGCTCACT

3961 ccgtggtttctgtgtggtgtcacctgccagacccgccgaagaagccacctctttggaggg 4020
GGCACCAAAGACACACCACAGTGGACGGTCTGGGCGGCTTCTTCGGTGGAGAAACCTCCC

4021 tgcgctctctggcacgcgccactcccacccatccgtgggccgccagcaccacgcgggccc 4080
ACGCGAGAGACCGTGCGCGGTGAGGGTGGGTAGGCACCCGGCGGTCGTGGTGCGCCCGGG

4081 cccatccacatcgcggccaccacgtccctgggacacgccttgtcccccggtgtacgccga 4140
GGGTAGGTGTAGCGCCGGTGGTGCAGGGACCCTGTGCGGAACAGGGGGCCACATGCGGCT

ORF_6 rf(4)(4196,5416)<<<
|
4141 gaccaagcacttcctctactcctcaggcgacaaggagcagctgcggccctccttcctact 4200
CTGGTTCGTGAAGGAGATGAGGAGTCCGCTGTTCCTCGTCGACGCCGGGAGGAAGGATGA

4201 cagctctctgaggcccagcctgactggcgctcggaggctcgtggagaccatctttctggg 4260
GTCGAGAGACTCCGGGTCGGACTGACCGCGAGCCTCCGAGCACCTCTGGTAGAAAGACCC

4261 ttccaggccctggatgccagggactccccgcaggttgccccgcctgccccagcgctactg 4320
AAGGTCCGGGACCTACGGTCCCTGAGGGGCGTCCAACGGGGCGGACGGGGTCGCGATGAC

4321 gcaaatgcggcccctgtttctggagctgcttgggaaccacgcgcagtgcccctacggggt 4380
CGTTTACGCCGGGGACAAAGACCTCGACGAACCCTTGGTGCGCGTCACGGGGATGCCCCA

4381 gctcctcaagacgcactgcccgctgcgagctgcggtcaccccagcagccggtgtctgtgc 4440
CGAGGAGTTCTGCGTGACGGGCGACGCTCGACGCCAGTGGGGTCGTCGGCCACAGACACG

4441 ccgggagaagccccagggctctgtggcggcccccgaggaggaggacacagacccccgtcg 4500
GGCCCTCTTCGGGGTCCCGAGACACCGCCGGGGGCTCCTCCTCCTGTGTCTGGGGGCAGC

4501 cctggtgcagctgctccgccagcacagcagcccctggcaggtgtacggcttcgtgcgggc 4560
GGACCACGTCGACGAGGCGGTCGTGTCGTCGGGGACCGTCCACATGCCGAAGCACGCCCG

4561 ctgcctgcgccggctggtgcccccaggcctctggggctccaggcacaacgaacgccgctt 4620
GACGGACGCGGCCGACCACGGGGGTCCGGAGACCCCGAGGTCCGTGTTGCTTGCGGCGAA

4621 cctcaggaacaccaagaagttcatctccctggggaagcatgccaagctctcgctgcagga 4680
GGAGTCCTTGTGGTTCTTCAAGTAGAGGGACCCCTTCGTACGGTTCGAGAGCGACGTCCT

4681 gctgacgtggaagatgagcgtgcgggactgcgcttggctgcgcaggagcccaggggttgg 4740
CGACTGCACCTTCTACTCGCACGCCCTGACGCGAACCGACGCGTCCTCGGGTCCCCAACC

4741 ctgtgttccggccgcagagcaccgtctgcgtgaggagatcctggccaagttcctgcactg 4800
GACACAAGGCCGGCGTCTCGTGGCAGACGCACTCCTCTAGGACCGGTTCAAGGACGTGAC

4801 gctgatgagtgtgtacgtcgtcgagctgctcaggtctttcttttatgtcacggagaccac 4860
CGACTACTCACACATGCAGCAGCTCGACGAGTCCAGAAAGAAAATACAGTGCCTCTGGTG

4861 gtttcaaaagaacaggctctttttctaccggaagagtgtctggagcaagttgcaaagcat 4920
CAAAGTTTTCTTGTCCGAGAAAAAGATGGCCTTCTCACAGACCTCGTTCAACGTTTCGTA

4921 tggaatcagacagcacttgaagagggtgcagctgcgggagctgtcggaagcagaggtcag 4980
ACCTTAGTCTGTCGTGAACTTCTCCCACGTCGACGCCCTCGACAGCCTTCGTCTCCAGTC

4981 gcagcatcgggaagccaggcccgccctgctgacgtccagactccgcttcatccccaagcc 5040
CGTCGTAGCCCTTCGGTCCGGGCGGGACGACTGCAGGTCTGAGGCGAAGTAGGGGTTCGG

5041 tgacgggctgcggccgattgtgaacatggactacgtcgtgggagccagaacgttccgcag 5100
ACTGCCCGACGCCGGCTAACACTTGTACCTGATGCAGCACCCTCGGTCTTGCAAGGCGTC

5101 agaaaagagggccgagcgtctcacctcgagggtgaaggcactgttcagcgtgctcaacta 5160
TCTTTTCTCCCGGCTCGCAGAGTGGAGCTCCCACTTCCGTGACAAGTCGCACGAGTTGAT

EcoRV
|
5161 cgagcgggcgcggcgccccggcctcctgggcgcctctgtgctgggcctggacgatatcca 5220
GCTCGCCCGCGCCGCGGGGCCGGAGGACCCGCGGAGACACGACCCGGACCTGCTATAGGT

5221 cagggcctggcgcaccttcgtgctgcgtgtgcgggcccaggacccgccgcctgagctgta 5280
GTCCCGGACCGCGTGGAAGCACGACGCACACGCCCGGGTCCTGGGCGGCGGACTCGACAT

5281 ctttgtcaaggtggatgtgacgggcgcgtacgacaccatcccccaggacaggctcacgga 5340
GAAACAGTTCCACCTACACTGCCCGCGCATGCTGTGGTAGGGGGTCCTGTCCGAGTGCCT

5341 ggtcatcgccagcatcatcaaaccccagaacacgtactgcgtgcgtcggtatgccgtggt 5400
CCAGTAGCGGTCGTAGTAGTTTGGGGTCTTGTGCATGACGCACGCAGCCATACGGCACCA

5401 ccagaaggccgcccatgggcacgtccgcaaggccttcaagagccacgtctctaccttgac 5460
GGTCTTCCGGCGGGTACCCGTGCAGGCGTTCCGGAAGTTCTCGGTGCAGAGATGGAACTG

5461 agacctccagccgtacatgcgacagttcgtggctcacctgcaggagaccagcccgctgag 5520
TCTGGAGGTCGGCATGTACGCTGTCAAGCACCGAGTGGACGTCCTCTGGTCGGGCGACTC

5521 ggatgccgtcgtcatcgagcagagctcctccctgaatgaggccagcagtggcctcttcga 5580
CCTACGGCAGCAGTAGCTCGTCTCGAGGAGGGACTTACTCCGGTCGTCACCGGAGAAGCT

5581 cgtcttcctacgcttcatgtgccaccacgccgtgcgcatcaggggcaagtcctacgtcca 5640
GCAGAAGGATGCGAAGTACACGGTGGTGCGGCACGCGTAGTCCCCGTTCAGGATGCAGGT

BamHI
|
5641 gtgccaggggatcccgcagggctccatcctctccacgctgctctgcagcctgtgctacgg 5700
CACGGTCCCCTAGGGCGTCCCGAGGTAGGAGAGGTGCGACGAGACGTCGGACACGATGCC

5701 cgacatggagaacaagctgtttgcggggattcggcgggacgggctgctcctgcgtttggt 5760
GCTGTACCTCTTGTTCGACAAACGCCCCTAAGCCGCCCTGCCCGACGAGGACGCAAACCA

5761 ggatgatttcttgttggtgacacctcacctcacccacgcgaaaaccttcctcaggaccct 5820
CCTACTAAAGAACAACCACTGTGGAGTGGAGTGGGTGCGCTTTTGGAAGGAGTCCTGGGA

5821 ggtccgaggtgtccctgagtatggctgcgtggtgaacttgcggaagacagtggtgaactt 5880
CCAGGCTCCACAGGGACTCATACCGACGCACCACTTGAACGCCTTCTGTCACCACTTGAA

5881 ccctgtagaagacgaggccctgggtggcacggcttttgttcagatgccggcccacggcct 5940
GGGACATCTTCTGCTCCGGGACCCACCGTGCCGAAAACAAGTCTACGGCCGGGTGCCGGA

5941 attcccctggtgcggcctgctgctggatacccggaccctggaggtgcagagcgactactc 6000
TAAGGGGACCACGCCGGACGACGACCTATGGGCCTGGGACCTCCACGTCTCGCTGATGAG

6001 cagctatgcccggacctccatcagagccagtctcaccttcaaccgcggcttcaaggctgg 6060
GTCGATACGGGCCTGGAGGTAGTCTCGGTCAGAGTGGAAGTTGGCGCCGAAGTTCCGACC

6061 gaggaacatgcgtcgcaaactctttggggtcttgcggctgaagtgtcacagcctgtttct 6120
CTCCTTGTACGCAGCGTTTGAGAAACCCCAGAACGCCGACTTCACAGTGTCGGACAAAGA

6121 ggatttgcaggtgaacagcctccagacggtgtgcaccaacatctacaagatcctcctgct 6180
CCTAAACGTCCACTTGTCGGAGGTCTGCCACACGTGGTTGTAGATGTTCTAGGAGGACGA

6181 gcaggcgtacaggtttcacgcatgtgtgctgcagctcccatttcatcagcaagtttggaa 6240
CGTCCGCATGTCCAAAGTGCGTACACACGACGTCGAGGGTAAAGTAGTCGTTCAAACCTT

6241 gaaccccacatttttcctgcgcgtcatctctgacacggcctccctctgctactccatcct 6300
CTTGGGGTGTAAAAAGGACGCGCAGTAGAGACTGTGCCGGAGGGAGACGATGAGGTAGGA

6301 gaaagccaagaacgcagggatgtcgctgggggccaagggcgccgccggccctctgccctc 6360
CTTTCGGTTCTTGCGTCCCTACAGCGACCCCCGGTTCCCGCGGCGGCCGGGAGACGGGAG

6361 cgaggccgtgcagtggctgtgccaccaagcattcctgctcaagctgactcgacaccgtgt 6420
GCTCCGGCACGTCACCGACACGGTGGTTCGTAAGGACGAGTTCGACTGAGCTGTGGCACA

6421 cacctacgtgccactcctggggtcactcaggacagcccagacgcagctgagtcggaagct 6480
GTGGATGCACGGTGAGGACCCCAGTGAGTCCTGTCGGGTCTGCGTCGACTCAGCCTTCGA

6481 cccggggacgacgctgactgccctggaggccgcagccaacccggcactgccctcagactt 6540
GGGCCCCTGCTGCGACTGACGGGACCTCCGGCGTCGGTTGGGCCGTGACGGGAGTCTGAA

6541 caagaccatcctggactgatggccacccgcccacagccaggccgagagcagacaccagca 6600
GTTCTGGTAGGACCTGACTACCGGTGGGCGGGTGTCGGTCCGGCTCTCGTCTGTGGTCGT

6601 gccctgtcacgccgggctctacgtcccagggagggaggggcggcccacacccaggcccgc 6660
CGGGACAGTGCGGCCCGAGATGCAGGGTCCCTCCCTCCCCGCCGGGTGTGGGTCCGGGCG

6661 accgctgggagtctgaggcctgagtgagtgtttggccgaggcctgcatgtccggctgaag 6720
TGGCGACCCTCAGACTCCGGACTCACTCACAAACCGGCTCCGGACGTACAGGCCGACTTC

6721 gctgagtgtccggctgaggcctgagcgagtgtccagccaagggctgagtgtccagcacac 6780
CGACTCACAGGCCGACTCCGGACTCGCTCACAGGTCGGTTCCCGACTCACAGGTCGTGTG

6xHis tag(6828,6845)>>>
|
6781 ctgccgtcttcacttccccacaggctggcgctcggcttaggctcgagcatcatcaccatc 6840
GACGGCAGAAGTGAAGGGGTGTCCGACCGCGAGCCGAATCCGAGCTCGTAGTAGTGGTAG

SV40 prom(6879,7147)>>>
|
SV40ER reg(6856,7092)<<<
| |
6841 accattgatgatccggctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctc 6900
TGGTAACTACTAGGCCGACACCTTACACACAGTCAATCCCACACCTTTCAGGGGTCCGAG

6901 cccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaa 6960
GGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTGGTCCACACCTTT

6961 gtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaac 7020
CAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTG

SV40 origin(7046,7123)>>>
|
7021 catagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattc 7080
GTATCAGGGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGCGGGTCAAGGCGGGTAAG

7081 tccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctc 7140
AGGCGGGGTACCGACTGATTAAAAAAAATAAATACGTCTCCGGCTCCGGCGGAGCCGGAG

7141 tgagctattccagaagtagtgaggaggcttttttggaggcctagtgaccagatctaatgc 7200
ACTCGATAAGGTCTTCATCACTCCTCCGAAAAAACCTCCGGATCACTGGTCTAGATTACG

7201 gttctaatgcgtaccagatctaatgcgtgctagcgaccagatctaatgcgtgctaggccc 7260
CAAGATTACGCATGGTCTAGATTACGCACGATCGCTGGTCTAGATTACGCACGATCCGGG

7261 ttttgcaaaaagcttgggctgcaggtcgaggcggatctgatcaagagacaggatgaggat 7320
AAAACGTTTTTCGAACCCGACGTCCAGCTCCGCCTAGACTAGTTCTCTGTCCTACTCCTA

ORF_4 rf(3)(7329,7997)>>>
|
7321 cgtttcgcatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgagg 7380
GCAAAGCGTACGTCTCCGGCTCCGGCGGAGCCGGAGACTCGATAAGGTCTTCATCACTCC

puro marker(7398,7997)>>>
|
7381 aggcttttttggaggccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacg 7440
TCCGAAAAAACCTCCGGTACTGGCTCATGTTCGGGTGCCACGCGGAGCGGTGGGCGCTGC

7441 acgtccctcgggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgcc 7500
TGCAGGGAGCCCGGCATGCGTGGGAGCGGCGGCGCAAGCGGCTGATGGGGCGGTGCGCGG

7501 acaccgtggacccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctca 7560
TGTGGCACCTGGGCCTGGCGGTGTAGCTCGCCCAGTGGCTCGACGTTCTTGAGAAGGAGT

7561 cgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcgg 7620
GCGCGCAGCCCGAGCTGTAGCCGTTCCACACCCAGCGCCTGCTGCCGCGGCGCCACCGCC

7621 tctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgca 7680
AGACCTGGTGCGGCCTCTCGCAGCTTCGCCCCCGCCACAAGCGGCTCTAGCCGGGCGCGT

7681 tggccgagttgagcggttcccggctggccgcgcagcaacagatggaagggctcctggcgc 7740
ACCGGCTCAACTCGCCAAGGGCCGACCGGCGCGTCGTTGTCTACCTTCCCGAGGACCGCG

7741 cgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccacc 7800
GCGTGGCCGGGTTCCTCGGGCGCACCAAGGACCGGTGGCAGCCGCAGAGCGGGCTGGTGG

7801 agggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccg 7860
TCCCGTTCCCAGACCCGTCGCGGCAGCACGAGGGGCCTCACCTCCGCCGGCTCGCGCGGC

7861 gggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcg 7920
CCCACGGGCGGAAGGACCTCTGGAGGCGCGGGGCGTTGGAGGGGAAGATGCTCGCCGAGC

7921 gcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgaccc 7980
CGAAGTGGCAGTGGCGGCTGCAGCTCCACGGGCTTCCTGGCGCGTGGACCACGTACTGGG

7981 gcaagcccggtgcctgaacgcgttccggaaatcaacctctggattacaaaatttgtgaaa 8040
CGTTCGGGCCACGGACTTGCGCAAGGCCTTTAGTTGGAGACCTAATGTTTTAAACACTTT

8041 gattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaa 8100
CTAACTGACCATAAGAATTGATACAACGAGGAAAATGCGATACACCTATGCGACGAAATT

ORF_5 rf(3)(8100,8750)>>>
|
8101 tgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaat 8160
ACGGAAACATAGTACGATAACGAAGGGCATACCGAAAGTAAAAGAGGAGGAACATATTTA

8161 cctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgt 8220
GGACCAACGACAGAGAAATACTCCTCAACACCGGGCAACAGTCCGTTGCACCGCACCACA

8221 gcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcc 8280
CGTGACACAAACGACTGCGTTGGGGGTGACCAACCCCGTAACGGTGGTGGACAGTCGAGG

8281 tttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgcc 8340
AAAGGCCCTGAAAGCGAAAGGGGGAGGGATAACGGTGCCGCCTTGAGTAGCGGCGGACGG

8341 ttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcgg 8400
AACGGGCGACGACCTGTCCCCGAGCCGACAACCCGTGACTGTTAAGGCACCACAACAGCC

8401 ggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcggga 8460
CCTTCGACTGCAGGAAAGGTACCGACGAGCGGACACAACGGTGGACCTAAGACGCGCCCT

8461 cgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgc 8520
GCAGGAAGACGATGCAGGGAAGCCGGGAGTTAGGTCGCCTGGAAGGAAGGGCGCCGGACG

8521 tgccggctctgcggcctcttccgcgtctccgccttcgccctcagacgagtcggatctccc 8580
ACGGCCGAGACGCCGGAGAAGGCGCAGAGGCGGAAGCGGGAGTCTGCTCAGCCTAGAGGG

8581 tttggccgcctccccgcctggtacctttaagaccaatgacttacaaggcagctgtagatc 8640
AAACCGGCGGAGGGGCGGACCATGGAAATTCTGGTTACTGAATGTTCCGTCGACATCTAG

delta_U3 other(8671,8723)>>>
|
8641 ttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagac 8700
AATCGGTGAAAAATTTTCTTTTCCCCCCTGACCTTCCCGATTAAGTGAGGGTTGCTTCTG

HIV-1_5_LTR other(8724,8904)>>>
|
8701 aagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagc 8760
TTCTAGACGAAAAACGAACATGACCCAGAGAGACCAATCTGGTCTAGACTCGGACCCTCG

8761 tctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttc 8820
AGAGACCGATTGATCCCTTGGGTGACGAATTCGGAGTTATTTCGAACGGAACTCACGAAG

8821 aagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagaccctttt 8880
TTCATCACACACGGGCAGACAACACACTGAGACCATTGATCTCTAGGGAGTCTGGGAAAA

8881 agtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttat 8940
TCAGTCACACCTTTTAGAGATCGTCATCATCAAGTACAGTAGAATAATAAGTCATAAATA

8941 aacttgcaaagaaatgaatatcagagagtgagaggaacttgggcctgaccagatctaatg 9000
TTGAACGTTTCTTTACTTATAGTCTCTCACTCTCCTTGAACCCGGACTGGTCTAGATTAC

9001 cgtaggccgtttaaaccgctgatcagcctcgactgtgccttctagttgccagccatctgt 9060
GCATCCGGCAAATTTGGCGACTAGTCGGAGCTGACACGGAAGATCAACGGTCGGTAGACA

9061 tgttgcccgggcgcgatcgctgcccctcccccgtgccttccttgaccctggaaggtgcca 9120
ACAACGGGCCCGCGCTAGCGACGGGGAGGGGGCACGGAAGGAACTGGGACCTTCCACGGT

9121 ctcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtc 9180
GAGGGTGACAGGAAAGGATTATTTTACTCCTTTAACGTAGCGTAACAGACTCATCCACAG

9181 attctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaata 9240
TAAGATAAGACCCCCCACCCCACCCCGTCCTGTCGTTCCCCCTCCTAACCCTTCTGTTAT

9241 gcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagcagat 9300
CGTCCGTACGACCCCTACGCCACCCGAGATACCGAAGACTCCGCCTTTCTTGGTCGTCTA

9301 cgatctgcatctatgtcgggtgcggagaaagaggtaatgaaatggcattatgggtattat 9360
GCTAGACGTAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGTAATACCCATAATA

9361 gggtctgcattaatgaatcggccaacgatcccggtgtgaaataccgcacagatgcgtaag 9420
CCCAGACGTAATTACTTAGCCGGTTGCTAGGGCCACACTTTATGGCGTGTCTACGCATTC

9421 gagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggt 9480
CTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCA

9481 cgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacaga 9540
GCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCT

9541 atcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccg 9600
TAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGC

pBR322 origin(9610,10229)<<<
|
9601 taaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaa 9660
ATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTT

9661 aaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtt 9720
TTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAA

9721 tccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacct 9780
AGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGA

9781 gtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatct 9840
CAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGA

9841 cagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcc 9900
GTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGG

9901 cgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgactt 9960
GCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAA

9961 atcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgc 10020
TAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACG

10021 tacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtat 10080
ATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATA

10081 ctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaa 10140
GACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTT

10141 acaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaa 10200
TGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTT

10201 aaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacga 10260
TTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCT

10261 aaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatcct 10320
TTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGA

10321 tttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga 10380
AAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAGACT

10381 cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatc 10440
GTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAG

10441 catagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctgg 10500
GTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACC

10501 ccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaat 10560
GGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTA

10561 aaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccat 10620
TTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTA

10621 ccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcg 10680
GGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGC

10681 caacgttgttgaaaaaggatcttcacctagatccttttcacgtagaaagccagtccgcag 10740
GTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTC

10741 aaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgca 10800
TTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGT

10801 agcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcg 10860
TCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGC

NEOKAN prom(10882,10931)>>>
|
10861 gttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttggg 10920
CAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCC

10921 aagccctgcaaagtaaactggatggctttctcgccgccaaggatctgatggcgcagggga 10980
TTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCT

NTP_II marker(11023,11811)>>>
|
ORF_1 rf(1)(11020,11814)>>>
| |
10981 tcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattg 11040
AGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAAC

11041 cacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacag 11100
GTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTC

11101 acaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctt 11160
TGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAA

11161 tttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggcta 11220
AAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGAT

11221 tcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcg 11280
AGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGC

11281 ggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcacctt 11340
CCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAA

11341 gctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgat 11400
CGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTA

11401 ccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcgg 11460
GGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCC

11461 atggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgcca 11520
TACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGT

11521 gccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacc 11580
CGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGG

11581 catggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatc 11640
GTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAG

11641 gactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgat 11700
CTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTA

11701 attgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgcc 11760
TAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGG

11761 gctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattttg 11820
CGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAAC

11821 ttaaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaacatccc 11880
AATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGG

f1 origin(11919,12224)<<<
|
11881 ttataaatcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaagag 11940
AATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTC

11941 tccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcga 12000
AGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCT

12001 tggcccactacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaaagc 12060
ACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCG

12061 tctaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaa 12120
AGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTT

12121 cgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgt 12180
GCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACA

12181 agcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacagggcgcg 12240
TCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGC

12241 tccattcgccattcaggatcgaattaattcttaattaacatcatcaataatatacctt 12298
AGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA
                            LOCUS       dna                     12298 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
Other Gene 880..1060
/gene="HIV-1_5_LTR other"
Other Gene 1171..1215
/gene="HIV-1_psi_pack other"
misc_binding 1257..1262
/dbxref="REBASE:NruI"
Regulatory_Seq 1723..1956
/gene="RRE reg"
ORF 1766..2449
/sequence="ORF_2 rf(2)"
misc_binding 2636..2641
/dbxref="REBASE:NdeI"
Promoter 2911..2992
/gene="CMV prom"
Regulatory_Seq 3048..3087
/gene="tetO reg"
ORF 3089..3775
/sequence="ORF_7 rf(4)"
misc_binding 3151..3156
/dbxref="REBASE:EcoRI"
ORF 3161..6559
/sequence="ORF_3 rf(2)"
ORF 4196..5416
/sequence="ORF_6 rf(4)"
misc_binding 5213..5218
/dbxref="REBASE:EcoRV"
misc_binding 5649..5654
/dbxref="REBASE:BamHI"
Tag 6828..6845
/gene="6xHis tag"
Regulatory_Seq 6856..7092
/gene="SV40ER reg"
Promoter 6879..7147
/gene="SV40 prom"
Rep_Origin 7046..7123
/gene="SV40 origin"
ORF 7329..7997
/sequence="ORF_4 rf(3)"
Marker 7398..7997
/gene="puro marker"
ORF 8100..8750
/sequence="ORF_5 rf(3)"
Other Gene 8671..8723
/gene="delta_U3 other"
Other Gene 8724..8904
/gene="HIV-1_5_LTR other"
Rep_Origin 9610..10229
/gene="pBR322 origin"
Promoter 10882..10931
/gene="NEOKAN prom"
ORF 11020..11814
/sequence="ORF_1 rf(1)"
Marker 11023..11811
/gene="NTP_II marker"
Rep_Origin 11919..12224
/gene="f1 origin"
BASE COUNT 2715 a 3389 c 3549 g 2645 t 0 others