pAAV-G-MSCV-2A-Luc-Blank
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepAAV-G-MSCV-2A-Luc-Blank
VectorTypeAAV Plasmid
Antibiotic InformationBacterial: Kanamycin
Sequencing PrimersMSCV sequencing primer
5'--GCC CAC AAC CCC TCA CTT--3'
Additional InformationThe blank expression is driven by a MSCV promoter, with a Luciferase reporter (not fusion).
Vector size: 6189bp
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta acctgcgcgc tcgctcgctc     
      481 actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg     
      541 agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc cttgtagtta     
      601 atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat cgcctaggtg     
      661 aaagacccca cctgtaggtt tggcaagtta gcttaagtaa cgccattttg caaggcatgg     
      721 aaaatacata actgagaata gagaagttca gatcaaggtt aggaacagag agacagcaga     
      781 atatgggcca aacaggatat ctgtggtaag cagttcctgc cccggctcag ggccaagaac     
      841 agatggtccc cagatgcggt cccgccctca gcagtttcta gcgaaccatc agatgtttcc     
      901 agggtgcccc aaggacctga aatgaccctg tgccttattt gaactaacca atcagtttgc     
      961 ttcttgcttc tgtttgtgtg cttctgctcc ctgagctcaa taaaagagcc cacaacccct     
     1021 cacttggtgg gccagtcctc tgatagactg tgtcccctgg atacccgtat gctagcgata     
     1081 tcgagggcag aggaagtctt ctaacatgcg gtgacgtgga ggagaatccc ggccctgaat     
     1141 tcatggaaga tgccaaaaac attaagaagg gcccagcgcc attctaccca ctcgaagacg     
     1201 ggaccgccgg cgagcagctg cacaaagcca tgaagcgcta cgccctggtg cccggcacca     
     1261 tcgcctttac cgacgcacat atcgaggtgg acattaccta cgccgagtac ttcgagatga     
     1321 gcgttcggct ggcagaagct atgaagcgct atgggctgaa tacaaaccat cggatcgtgg     
     1381 tgtgcagcga gaatagcttg cagttcttca tgcccgtgtt gggtgccctg ttcatcggtg     
     1441 tggctgtggc cccagctaac gacatctaca acgagcgcga gctgctgaac agcatgggca     
     1501 tcagccagcc caccgtcgta ttcgtgagca agaaagggct gcaaaagatc ctcaacgtgc     
     1561 aaaagaagct accgatcata caaaagatca tcatcatgga tagcaagacc gactaccagg     
     1621 gcttccaaag catgtacacc ttcgtgactt cccatttgcc acccggcttc aacgagtacg     
     1681 acttcgtgcc cgagagcttc gaccgggaca aaaccatcgc cctgatcatg aacagtagtg     
     1741 gcagtaccgg attgcccaag ggcgtagccc taccgcaccg caccgcttgt gtccgattca     
     1801 gtcatgcccg cgaccccatc ttcggcaacc agatcatccc cgacaccgct atcctcagcg     
     1861 tggtgccatt tcaccacggc ttcggcatgt tcaccacgct gggctacttg atctgcggct     
     1921 ttcgggtcgt gctcatgtac cgcttcgagg aggagctatt cttgcgcagc ttgcaagact     
     1981 ataagattca atctgccctg ctggtgccca cactatttag cttcttcgct aagagcactc     
     2041 tcatcgacaa gtacgaccta agcaacttgc acgagatcgc cagcggcggg gcgccgctca     
     2101 gcaaggaggt aggtgaggcc gtggccaaac gcttccacct accaggcatc cgccagggct     
     2161 acggcctgac agaaacaacc agcgccattc tgatcacccc cgaaggggac gacaagcctg     
     2221 gcgcagtagg caaggtggtg cccttcttcg aggctaaggt ggtggacttg gacaccggta     
     2281 agacactggg tgtgaaccag cgcggcgagc tgtgcgtccg tggccccatg atcatgagcg     
     2341 gctacgttaa caaccccgag gctacaaacg ctctcatcga caaggacggc tggctgcaca     
     2401 gcggcgacat cgcctactgg gacgaggacg agcacttctt catcgtggac cggctgaaga     
     2461 gcctgatcaa atacaagggc taccaggtag ccccagccga actggagagc atcctgctgc     
     2521 aacaccccaa catcttcgac gccggggtcg ccggcctgcc cgacgacgat gccggcgagc     
     2581 tgcccgccgc agtcgtcgtg ctggaacacg gtaaaaccat gaccgagaag gagatcgtgg     
     2641 actatgtggc cagccaggtt acaaccgcca agaagctgcg cggtggtgtt gtgttcgtgg     
     2701 acgaggtgcc taaaggactg accggcaagt tggacgcccg caagatccgc gagattctca     
     2761 ttaaggccaa gaagggcggc aagatcgccg tgtaactcga gtacccatac gacgtcccag     
     2821 actacgctac gcgtcttaag gcgatcgcag acatgataag atacattgat gagtttggac     
     2881 aaaccacaac tagaatgcag tgaaaaaaat gctttatttg tgaaatttgt gatgctattg     
     2941 ctttatttgt aaccattata agctgcaata aacaagttaa taacaacaat tccattcatt     
     3001 ttatgtttca ggttcagggg gagatgtggg aggtttttta aagcaagtaa aacctctaca     
     3061 aatgtggtag tcgaaattcc cgataaggat cttcctagag catggctacg tagataagta     
     3121 gcatggcggg ttaatcatta actacaagga acccctagtg atggagttgg ccactccctc     
     3181 tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag gtcgcccgac gcccgggctt     
     3241 tgcccgggcg gcctcagtga gcgagcgagc gcgcagggat cccggtgtga aataccgcac     
     3301 agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg cttcctcgct cactgactcg     
     3361 ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg     
     3421 ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag     
     3481 gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac     
     3541 gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga     
     3601 taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt     
     3661 accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc     
     3721 tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc     
     3781 cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta     
     3841 agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat     
     3901 gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca     
     3961 gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct     
     4021 tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt     
     4081 acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct     
     4141 cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc     
     4201 acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa     
     4261 acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta     
     4321 tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc     
     4381 ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat     
     4441 ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta     
     4501 tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt     
     4561 aatagtttgc gcaacgttgt tgaaaaagga tcttcaccta gatccttttc acgtagaaag     
     4621 ccagtccgca gaaacggtgc tgaccccgga tgaatgtcag ctactgggct atctggacaa     
     4681 gggaaaacgc aagcgcaaag agaaagcagg tagcttgcag tgggcttaca tggcgatagc     
     4741 tagactgggc ggttttatgg acagcaagcg aaccggaatt gccagctggg gcgccctctg     
     4801 gtaaggttgg gaagccctgc aaagtaaact ggatggcttt ctcgccgcca aggatctgat     
     4861 ggcgcagggg atcaagctct gatcaagaga caggatgagg atcgtttcgc atgattgaac     
     4921 aagatggatt gcacgcaggt tctccggccg cttgggtgga gaggctattc ggctatgact     
     4981 gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca gcgcaggggc     
     5041 gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactg caagacgagg     
     5101 cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg ctcgacgttg     
     5161 tcactgaagc gggaagggac tggctgctat tgggcgaagt gccggggcag gatctcctgt     
     5221 catctcacct tgctcctgcc gagaaagtat ccatcatggc tgatgcaatg cggcggctgc     
     5281 atacgcttga tccggctacc tgcccattcg accaccaagc gaaacatcgc atcgagcgag     
     5341 cacgtactcg gatggaagcc ggtcttgtcg atcaggatga tctggacgaa gagcatcagg     
     5401 ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgag catgcccgac ggcgaggatc     
     5461 tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat ggtggaaaat ggccgctttt     
     5521 ctggattcat cgactgtggc cggctgggtg tggcggaccg ctatcaggac atagcgttgg     
     5581 ctacccgtga tattgctgaa gagcttggcg gcgaatgggc tgaccgcttc ctcgtgcttt     
     5641 acggtatcgc cgctcccgat tcgcagcgca tcgccttcta tcgccttctt gacgagttct     
     5701 tctgaatttt gttaaaattt ttgttaaatc agctcatttt ttaaccaata ggccgaaatc     
     5761 ggcaacatcc cttataaatc aaaagaatag accgcgatag ggttgagtgt tgttccagtt     
     5821 tggaacaaga gtccactatt aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc     
     5881 tatcagggcg atggcccact acgtgaacca tcacccaaat caagtttttt gcggtcgagg     
     5941 tgccgtaaag ctctaaatcg gaaccctaaa gggagccccc gatttagagc ttgacgggga     
     6001 aagccggcga acgtggcgag aaaggaaggg aagaaagcga aaggagcggg cgctagggcg     
     6061 ctggcaagtg tagcggtcac gctgcgcgta accaccacac ccgcgcgctt aatgcgccgc     
     6121 tacagggcgc gtccattcgc cattcaggat cgaattaatt cttaattaac atcatcaata     
     6181 atatacctt                                                       
                                    LOCUS       dna                      6189 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    993..998
                     /dbxref="REBASE:SacI"
     misc_binding    1137..1142
                     /dbxref="REBASE:EcoRI"
     ORF             1143..2795
                     /sequence="ORF_1 rf(3)"
     misc_binding    1169..1174
                     /dbxref="REBASE:ApaI"
     misc_binding    2796..2801
                     /dbxref="REBASE:XhoI"
     misc_binding    3277..3282
                     /dbxref="REBASE:BamHI"
     Rep_Origin      3501..4120
                     /gene="pBR322 origin"
     Promoter        4773..4822
                     /gene="NEOKAN prom"
     ORF             4911..5705
                     /sequence="ORF_2 rf(3)"
     Marker          4914..5702
                     /gene="NTP_II marker"
     misc_binding    5440..5445
                     /dbxref="REBASE:SphI"
     misc_binding    5471..5476
                     /dbxref="REBASE:NcoI"
     Rep_Origin      5810..6115
                     /gene="f1 origin"
BASE COUNT    1519 a   1614 c   1702 g   1354 t    0 others
ORIGIN
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
      AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61    gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
      CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

                                               Encap other(162,310)>>> 
                                               |
121   cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
      GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181   aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
      TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241   aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
      TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301   tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
      ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

          amp prom(365,393)<<< 
          |
361   ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
      CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

421   gttccgcgcacatttccccgaaaagtgccacctgacgttaacctgcgcgctcgctcgctc 480
      CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGGACGCGCGAGCGAGCGAG

481   actgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtg 540
      TGACTCCGGCGGGCCCGTTTCGGGCCCGCAGCCCGCTGGAAACCAGCGGGCCGGAGTCAC

541   agcgagcgagcgcgcagagagggagtggccaactccatcactaggggttccttgtagtta 600
      TCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGGAACATCAAT

601   atgattaacccgccatgctacttatctacgtagccatgctctaggaagatcgcctaggtg 660
      TACTAATTGGGCGGTACGATGAATAGATGCATCGGTACGAGATCCTTCTAGCGGATCCAC

661   aaagaccccacctgtaggtttggcaagttagcttaagtaacgccattttgcaaggcatgg 720
      TTTCTGGGGTGGACATCCAAACCGTTCAATCGAATTCATTGCGGTAAAACGTTCCGTACC

721   aaaatacataactgagaatagagaagttcagatcaaggttaggaacagagagacagcaga 780
      TTTTATGTATTGACTCTTATCTCTTCAAGTCTAGTTCCAATCCTTGTCTCTCTGTCGTCT

781   atatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaac 840
      TATACCCGGTTTGTCCTATAGACACCATTCGTCAAGGACGGGGCCGAGTCCCGGTTCTTG

841   agatggtccccagatgcggtcccgccctcagcagtttctagcgaaccatcagatgtttcc 900
      TCTACCAGGGGTCTACGCCAGGGCGGGAGTCGTCAAAGATCGCTTGGTAGTCTACAAAGG

901   agggtgccccaaggacctgaaatgaccctgtgccttatttgaactaaccaatcagtttgc 960
      TCCCACGGGGTTCCTGGACTTTACTGGGACACGGAATAAACTTGATTGGTTAGTCAAACG

                                           SacI 
                                           |
961   ttcttgcttctgtttgtgtgcttctgctccctgagctcaataaaagagcccacaacccct 1020
      AAGAACGAAGACAAACACACGAAGACGAGGGACTCGAGTTATTTTCTCGGGTGTTGGGGA

1021  cacttggtgggccagtcctctgatagactgtgtcccctggatacccgtatgctagcgata 1080
      GTGAACCACCCGGTCAGGAGACTATCTGACACAGGGGACCTATGGGCATACGATCGCTAT

                                                               EcoRI 
                                                               |
1081  tcgagggcagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccctgaat 1140
      AGCTCCCGTCTCCTTCAGAAGATTGTACGCCACTGCACCTCCTCTTAGGGCCGGGACTTA

        ORF_1 rf(3)(1143,2795)>>>      ApaI 
        |                              |
1141  tcatggaagatgccaaaaacattaagaagggcccagcgccattctacccactcgaagacg 1200
      AGTACCTTCTACGGTTTTTGTAATTCTTCCCGGGTCGCGGTAAGATGGGTGAGCTTCTGC

1201  ggaccgccggcgagcagctgcacaaagccatgaagcgctacgccctggtgcccggcacca 1260
      CCTGGCGGCCGCTCGTCGACGTGTTTCGGTACTTCGCGATGCGGGACCACGGGCCGTGGT

1261  tcgcctttaccgacgcacatatcgaggtggacattacctacgccgagtacttcgagatga 1320
      AGCGGAAATGGCTGCGTGTATAGCTCCACCTGTAATGGATGCGGCTCATGAAGCTCTACT

1321  gcgttcggctggcagaagctatgaagcgctatgggctgaatacaaaccatcggatcgtgg 1380
      CGCAAGCCGACCGTCTTCGATACTTCGCGATACCCGACTTATGTTTGGTAGCCTAGCACC

1381  tgtgcagcgagaatagcttgcagttcttcatgcccgtgttgggtgccctgttcatcggtg 1440
      ACACGTCGCTCTTATCGAACGTCAAGAAGTACGGGCACAACCCACGGGACAAGTAGCCAC

1441  tggctgtggccccagctaacgacatctacaacgagcgcgagctgctgaacagcatgggca 1500
      ACCGACACCGGGGTCGATTGCTGTAGATGTTGCTCGCGCTCGACGACTTGTCGTACCCGT

1501  tcagccagcccaccgtcgtattcgtgagcaagaaagggctgcaaaagatcctcaacgtgc 1560
      AGTCGGTCGGGTGGCAGCATAAGCACTCGTTCTTTCCCGACGTTTTCTAGGAGTTGCACG

1561  aaaagaagctaccgatcatacaaaagatcatcatcatggatagcaagaccgactaccagg 1620
      TTTTCTTCGATGGCTAGTATGTTTTCTAGTAGTAGTACCTATCGTTCTGGCTGATGGTCC

1621  gcttccaaagcatgtacaccttcgtgacttcccatttgccacccggcttcaacgagtacg 1680
      CGAAGGTTTCGTACATGTGGAAGCACTGAAGGGTAAACGGTGGGCCGAAGTTGCTCATGC

1681  acttcgtgcccgagagcttcgaccgggacaaaaccatcgccctgatcatgaacagtagtg 1740
      TGAAGCACGGGCTCTCGAAGCTGGCCCTGTTTTGGTAGCGGGACTAGTACTTGTCATCAC

1741  gcagtaccggattgcccaagggcgtagccctaccgcaccgcaccgcttgtgtccgattca 1800
      CGTCATGGCCTAACGGGTTCCCGCATCGGGATGGCGTGGCGTGGCGAACACAGGCTAAGT

1801  gtcatgcccgcgaccccatcttcggcaaccagatcatccccgacaccgctatcctcagcg 1860
      CAGTACGGGCGCTGGGGTAGAAGCCGTTGGTCTAGTAGGGGCTGTGGCGATAGGAGTCGC

1861  tggtgccatttcaccacggcttcggcatgttcaccacgctgggctacttgatctgcggct 1920
      ACCACGGTAAAGTGGTGCCGAAGCCGTACAAGTGGTGCGACCCGATGAACTAGACGCCGA

1921  ttcgggtcgtgctcatgtaccgcttcgaggaggagctattcttgcgcagcttgcaagact 1980
      AAGCCCAGCACGAGTACATGGCGAAGCTCCTCCTCGATAAGAACGCGTCGAACGTTCTGA

1981  ataagattcaatctgccctgctggtgcccacactatttagcttcttcgctaagagcactc 2040
      TATTCTAAGTTAGACGGGACGACCACGGGTGTGATAAATCGAAGAAGCGATTCTCGTGAG

2041  tcatcgacaagtacgacctaagcaacttgcacgagatcgccagcggcggggcgccgctca 2100
      AGTAGCTGTTCATGCTGGATTCGTTGAACGTGCTCTAGCGGTCGCCGCCCCGCGGCGAGT

2101  gcaaggaggtaggtgaggccgtggccaaacgcttccacctaccaggcatccgccagggct 2160
      CGTTCCTCCATCCACTCCGGCACCGGTTTGCGAAGGTGGATGGTCCGTAGGCGGTCCCGA

2161  acggcctgacagaaacaaccagcgccattctgatcacccccgaaggggacgacaagcctg 2220
      TGCCGGACTGTCTTTGTTGGTCGCGGTAAGACTAGTGGGGGCTTCCCCTGCTGTTCGGAC

2221  gcgcagtaggcaaggtggtgcccttcttcgaggctaaggtggtggacttggacaccggta 2280
      CGCGTCATCCGTTCCACCACGGGAAGAAGCTCCGATTCCACCACCTGAACCTGTGGCCAT

2281  agacactgggtgtgaaccagcgcggcgagctgtgcgtccgtggccccatgatcatgagcg 2340
      TCTGTGACCCACACTTGGTCGCGCCGCTCGACACGCAGGCACCGGGGTACTAGTACTCGC

2341  gctacgttaacaaccccgaggctacaaacgctctcatcgacaaggacggctggctgcaca 2400
      CGATGCAATTGTTGGGGCTCCGATGTTTGCGAGAGTAGCTGTTCCTGCCGACCGACGTGT

2401  gcggcgacatcgcctactgggacgaggacgagcacttcttcatcgtggaccggctgaaga 2460
      CGCCGCTGTAGCGGATGACCCTGCTCCTGCTCGTGAAGAAGTAGCACCTGGCCGACTTCT

2461  gcctgatcaaatacaagggctaccaggtagccccagccgaactggagagcatcctgctgc 2520
      CGGACTAGTTTATGTTCCCGATGGTCCATCGGGGTCGGCTTGACCTCTCGTAGGACGACG

2521  aacaccccaacatcttcgacgccggggtcgccggcctgcccgacgacgatgccggcgagc 2580
      TTGTGGGGTTGTAGAAGCTGCGGCCCCAGCGGCCGGACGGGCTGCTGCTACGGCCGCTCG

2581  tgcccgccgcagtcgtcgtgctggaacacggtaaaaccatgaccgagaaggagatcgtgg 2640
      ACGGGCGGCGTCAGCAGCACGACCTTGTGCCATTTTGGTACTGGCTCTTCCTCTAGCACC

2641  actatgtggccagccaggttacaaccgccaagaagctgcgcggtggtgttgtgttcgtgg 2700
      TGATACACCGGTCGGTCCAATGTTGGCGGTTCTTCGACGCGCCACCACAACACAAGCACC

2701  acgaggtgcctaaaggactgaccggcaagttggacgcccgcaagatccgcgagattctca 2760
      TGCTCCACGGATTTCCTGACTGGCCGTTCAACCTGCGGGCGTTCTAGGCGCTCTAAGAGT

                                          XhoI 
                                          |
2761  ttaaggccaagaagggcggcaagatcgccgtgtaactcgagtacccatacgacgtcccag 2820
      AATTCCGGTTCTTCCCGCCGTTCTAGCGGCACATTGAGCTCATGGGTATGCTGCAGGGTC

2821  actacgctacgcgtcttaaggcgatcgcagacatgataagatacattgatgagtttggac 2880
      TGATGCGATGCGCAGAATTCCGCTAGCGTCTGTACTATTCTATGTAACTACTCAAACCTG

2881  aaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattg 2940
      TTTGGTGTTGATCTTACGTCACTTTTTTTACGAAATAAACACTTTAAACACTACGATAAC

2941  ctttatttgtaaccattataagctgcaataaacaagttaataacaacaattccattcatt 3000
      GAAATAAACATTGGTAATATTCGACGTTATTTGTTCAATTATTGTTGTTAAGGTAAGTAA

3001  ttatgtttcaggttcagggggagatgtgggaggttttttaaagcaagtaaaacctctaca 3060
      AATACAAAGTCCAAGTCCCCCTCTACACCCTCCAAAAAATTTCGTTCATTTTGGAGATGT

3061  aatgtggtagtcgaaattcccgataaggatcttcctagagcatggctacgtagataagta 3120
      TTACACCATCAGCTTTAAGGGCTATTCCTAGAAGGATCTCGTACCGATGCATCTATTCAT

3121  gcatggcgggttaatcattaactacaaggaacccctagtgatggagttggccactccctc 3180
      CGTACCGCCCAATTAGTAATTGATGTTCCTTGGGGATCACTACCTCAACCGGTGAGGGAG

3181  tctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctt 3240
      AGACGCGCGAGCGAGCGAGTGACTCCGGCCCGCTGGTTTCCAGCGGGCTGCGGGCCCGAA

                                           BamHI 
                                           |
3241  tgcccgggcggcctcagtgagcgagcgagcgcgcagggatcccggtgtgaaataccgcac 3300
      ACGGGCCCGCCGGAGTCACTCGCTCGCTCGCGCGTCCCTAGGGCCACACTTTATGGCGTG

3301  agatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcg 3360
      TCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGC

3361  ctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacgg 3420
      GACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCC

3421  ttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaag 3480
      AATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTC

                          pBR322 origin(3501,4120)<<< 
                          |
3481  gccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgac 3540
      CGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTG

3541  gagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaaga 3600
      CTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCT

3601  taccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgctt 3660
      ATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAA

3661  accggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgc 3720
      TGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCG

3721  tgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccc 3780
      ACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGG

3781  cccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggta 3840
      GGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCAT

3841  agacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtat 3900
      TCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATA

3901  gtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggaca 3960
      CATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGT

3961  gtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctct 4020
      CATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGA

4021  tgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagatt 4080
      ACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAA

4081  acgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgct 4140
      TGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGA

4141  cagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttc 4200
      GTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAG

4201  acctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaa 4260
      TGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATT

4261  acttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtcta 4320
      TGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGAT

4321  tttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggc 4380
      AAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCG

4381  ttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagat 4440
      AATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTA

4441  ttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaacttta 4500
      AATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAAT

4501  tccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagtt 4560
      AGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAA

4561  aatagtttgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgtagaaag 4620
      TTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTC

4621  ccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaa 4680
      GGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTT

4681  gggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagc 4740
      CCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCG

                                      NEOKAN prom(4773,4822)>>> 
                                      |
4741  tagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctg 4800
      ATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGAC

4801  gtaaggttgggaagccctgcaaagtaaactggatggctttctcgccgccaaggatctgat 4860
      CATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTA

                                                           NTP_II marker(4914,5702)>>> 
                                                           |
                                                        ORF_2 rf(3)(4911,5705)>>> 
                                                        |  |
4861  ggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaac 4920
      CCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTG

4921  aagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgact 4980
      TTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGA

4981  gggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggc 5040
      CCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCG

5041  gcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgagg 5100
      CGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCC

5101  cagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttg 5160
      GTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAAC

5161  tcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgt 5220
      AGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACA

5221  catctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgc 5280
      GTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACG

5281  atacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgag 5340
      TATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTC

5341  cacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcagg 5400
      GTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCC

                                                  SphI 
                                                  |
5401  ggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatc 5460
      CCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAG

                 NcoI 
                 |
5461  tcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgctttt 5520
      AGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAA

5521  ctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttgg 5580
      GACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACC

5581  ctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgcttt 5640
      GATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAA

5641  acggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttct 5700
      TGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGA

5701  tctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggccgaaatc 5760
      AGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAG

                                                       f1 origin(5810,6115)<<< 
                                                       |
5761  ggcaacatcccttataaatcaaaagaatagaccgcgatagggttgagtgttgttccagtt 5820
      CCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAA

5821  tggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtc 5880
      ACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAG

5881  tatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcggtcgagg 5940
      ATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCC

5941  tgccgtaaagctctaaatcggaaccctaaagggagcccccgatttagagcttgacgggga 6000
      ACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCT

6001  aagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcg 6060
      TTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGC

6061  ctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgc 6120
      GACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCG

6121  tacagggcgcgtccattcgccattcaggatcgaattaattcttaattaacatcatcaata 6180
      ATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTAT

6181  atatacctt 6189
      TATATGGAA