pAAV-miR-Off
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepAAV-miR-Off
VectorTypeAAV Vector
Antibiotic InformationBacterial: Kanamycin
Mammalian: Puromycin
Sequencing PrimersH1 Forward: 5'-CAACCCGCTCCAAGGAATCG-3'
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta acctgcgcgc tcgctcgctc
481 actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg
541 agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc cttgtagtta
601 atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat cgcctagggc
661 tagatacgta gaacgctgac gtcatcaacc cgctccaagg aatcgcgggc ccagtgtcac
721 taggcgggaa cacccagcgc gcgtgcgccc tggcaggaag atggctgtga gggacagggg
781 agtggcgccc tgcaatattt gcatgtcgct atgtgttctg ggaaatcacc ataaacgtga
841 aatgtctttg gatttgggaa tcttataagt tctgtatgag accacaaaaa tagtcttctc
901 tagaagctag cagatatcag tcgacactcg agcaattgta gtaatcaatt acggggtcat
961 tagttcatag cccatatatg gagttccgcg ttacataact tacggtaaat ggcccgcctg
1021 gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt cccatagtaa
1081 cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa actgcccact
1141 tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc aatgacggta
1201 aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct acttggcagt
1261 acatctacgt attagtcatc gctattacca tggtgatgcg gttttggcag tacatcaatg
1321 ggcgtggata gcggtttgac tcacggggat ttccaagtct ccaccccatt gacgtcaatg
1381 ggagtttgtt ttggcaccaa aatcaacggg actttccaaa atgtcgtaac aactccgccc
1441 cattgacgca aatgggcggt aggcgtgtac ggtgggaggt ctatataagc agagctggtt
1501 tagtgaaccg tcagggtacc ggatccctta agtgaacaac tagtgccacc atggtgagca
1561 agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac ggcgacgtaa
1621 acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac ggcaagctga
1681 ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc ctcgtgacca
1741 ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag cagcacgact
1801 tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc ttcaaggacg
1861 acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg gtgaaccgca
1921 tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac aagctggagt
1981 acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac ggcatcaagg
2041 tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc gaccactacc
2101 agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac tacctgagca
2161 cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc ctgctggagt
2221 tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaaggaa ttcggaagcg
2281 ggcagtgcac caactacgcc ctgctgaagc tggccggcga cgtggagagc aaccccggcc
2341 ccggatccat ggccaccgag tacaagccca cggtgcgcct cgccacccgc gacgacgtcc
2401 cccgggccgt acgcaccctc gccgccgcgt tcgccgacta ccccgccacg cgccacaccg
2461 tcgacccgga ccgccacatc gagcgggtca ccgagctgca agaactcttc ctcacgcgcg
2521 tcgggctcga catcggcaag gtgtgggtcg cggacgacgg cgccgcggtg gcggtctgga
2581 ccacgccgga gagcgtcgaa gcgggggcgg tgttcgccga gatcggctcg cgcatggccg
2641 agttgagcgg ttcccggctg gccgcgcagc aacagatgga aggcctcctg gcgccgcacc
2701 ggcccaagga gcccgcgtgg ttcctggcca ccgtcggcgt ctcgcccgac caccagggca
2761 agggtctggg cagcgccgtc gtgctccccg gagtggaggc ggccgagcgc gctggggtgc
2821 ccgccttcct ggagacctcc gcgccccgca acctcccctt ctacgagcgg ctcggcttca
2881 ccgtcaccgc cgacgtcgag gtgcccgaag gaccgcgcac ctggtgcatg acccgcaagc
2941 ccggtgcctg aacgcgtctt aaggcgatcg cagacatgat aagatacatt gatgagtttg
3001 gacaaaccac aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta
3061 ttgctttatt tgtaaccatt ataagctgca ataaacaagt taataacaac aattccattc
3121 attttatgtt tcaggttcag ggggagatgt gggaggtttt ttaaagcaag taaaacctct
3181 acaaatgtgg tagtcgaaat tcccgataag gatcttccta gagcatggct acgtagataa
3241 gtagcatggc gggttaatca ttaactacaa ggaaccccta gtgatggagt tggccactcc
3301 ctctctgcgc gctcgctcgc tcactgaggc cgggcgacca aaggtcgccc gacgcccggg
3361 ctttgcccgg gcggcctcag tgagcgagcg agcgcgcagg gatcccggtg tgaaataccg
3421 cacagatgcg taaggagaaa ataccgcatc aggcgctctt ccgcttcctc gctcactgac
3481 tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata
3541 cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa
3601 aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct
3661 gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa
3721 agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg
3781 cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca
3841 cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa
3901 ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg
3961 gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg
4021 tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg
4081 acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc
4141 tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag
4201 attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac
4261 gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc
4321 ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag
4381 taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt
4441 ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag
4501 ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca
4561 gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact
4621 ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca
4681 gttaatagtt tgcgcaacgt tgttgaaaaa ggatcttcac ctagatcctt ttcacgtaga
4741 aagccagtcc gcagaaacgg tgctgacccc ggatgaatgt cagctactgg gctatctgga
4801 caagggaaaa cgcaagcgca aagagaaagc aggtagcttg cagtgggctt acatggcgat
4861 agctagactg ggcggtttta tggacagcaa gcgaaccgga attgccagct ggggcgccct
4921 ctggtaaggt tgggaagccc tgcaaagtaa actggatggc tttctcgccg ccaaggatct
4981 gatggcgcag gggatcaagc tctgatcaag agacaggatg aggatcgttt cgcatgattg
5041 aacaagatgg attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg
5101 actgggcaca acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg
5161 ggcgcccggt tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaagacg
5221 aggcagcgcg gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg
5281 ttgtcactga agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc
5341 tgtcatctca ccttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc
5401 tgcatacgct tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc
5461 gagcacgtac tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc
5521 aggggctcgc gccagccgaa ctgttcgcca ggctcaaggc gagcatgccc gacggcgagg
5581 atctcgtcgt gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct
5641 tttctggatt catcgactgt ggccggctgg gtgtggcgga ccgctatcag gacatagcgt
5701 tggctacccg tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc
5761 tttacggtat cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt
5821 tcttctgaat tttgttaaaa tttttgttaa atcagctcat tttttaacca ataggccgaa
5881 atcggcaaca tcccttataa atcaaaagaa tagaccgcga tagggttgag tgttgttcca
5941 gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc
6001 gtctatcagg gcgatggccc actacgtgaa ccatcaccca aatcaagttt tttgcggtcg
6061 aggtgccgta aagctctaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg
6121 ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg
6181 gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgcgcg cttaatgcgc
6241 cgctacaggg cgcgtccatt cgccattcag gatcgaatta attcttaatt aacatcatca
6301 ataatatacc tt
                                    LOCUS       dna                      6312 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
misc_binding 707..712
/dbxref="REBASE:ApaI"
misc_binding 899..904
/dbxref="REBASE:XbaI"
misc_binding 913..918
/dbxref="REBASE:EcoRV"
misc_binding 927..932
/dbxref="REBASE:XhoI"
misc_binding 1161..1166
/dbxref="REBASE:NdeI"
misc_binding 1515..1520
/dbxref="REBASE:KpnI"
Reporter 1551..2267
/gene="EGFP reporter"
ORF 1551..2951
/sequence="ORF_1 rf(3)"
misc_binding 2268..2273
/dbxref="REBASE:EcoRI"
Marker 2355..2951
/gene="puro marker"
misc_binding 2681..2686
/dbxref="REBASE:StuI"
Rep_Origin 3624..4243
/gene="pBR322 origin"
Promoter 4896..4945
/gene="NEOKAN prom"
misc_binding 5003..5008
/dbxref="REBASE:BclI"
ORF 5034..5828
/sequence="ORF_2 rf(3)"
Marker 5037..5825
/gene="NTP_II marker"
misc_binding 5563..5568
/dbxref="REBASE:SphI"
Rep_Origin 5933..6238
/gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaacctgcgcgctcgctcgctc 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGGACGCGCGAGCGAGCGAG

481 actgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtg 540
TGACTCCGGCGGGCCCGTTTCGGGCCCGCAGCCCGCTGGAAACCAGCGGGCCGGAGTCAC

541 agcgagcgagcgcgcagagagggagtggccaactccatcactaggggttccttgtagtta 600
TCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGGAACATCAAT

601 atgattaacccgccatgctacttatctacgtagccatgctctaggaagatcgcctagggc 660
TACTAATTGGGCGGTACGATGAATAGATGCATCGGTACGAGATCCTTCTAGCGGATCCCG

ApaI
|
661 tagatacgtagaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcac 720
ATCTATGCATCTTGCGACTGCAGTAGTTGGGCGAGGTTCCTTAGCGCCCGGGTCACAGTG

721 taggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacagggg 780
ATCCGCCCTTGTGGGTCGCGCGCACGCGGGACCGTCCTTCTACCGACACTCCCTGTCCCC

781 agtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtga 840
TCACCGCGGGACGTTATAAACGTACAGCGATACACAAGACCCTTTAGTGGTATTTGCACT

841 aatgtctttggatttgggaatcttataagttctgtatgagaccacaaaaatagtcttctc 900
TTACAGAAACCTAAACCCTTAGAATATTCAAGACATACTCTGGTGTTTTTATCAGAAGAG

XbaI EcoRV XhoI
| | |
901 tagaagctagcagatatcagtcgacactcgagcaattgtagtaatcaattacggggtcat 960
ATCTTCGATCGTCTATAGTCAGCTGTGAGCTCGTTAACATCATTAGTTAATGCCCCAGTA

961 tagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctg 1020
ATCAAGTATCGGGTATATACCTCAAGGCGCAATGTATTGAATGCCATTTACCGGGCGGAC

1021 gctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaa 1080
CGACTGGCGGGTTGCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAAGGGTATCATT

1081 cgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccact 1140
GCGGTTATCCCTGAAAGGTAACTGCAGTTACCCACCTCATAAATGCCATTTGACGGGTGA

NdeI
|
1141 tggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggta 1200
ACCGTCATGTAGTTCACATAGTATACGGTTCATGCGGGGGATAACTGCAGTTACTGCCAT

1201 aatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagt 1260
TTACCGGGCGGACCGTAATACGGGTCATGTACTGGAATACCCTGAAAGGATGAACCGTCA

1261 acatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatg 1320
TGTAGATGCATAATCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCATGTAGTTAC

1321 ggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatg 1380
CCGCACCTATCGCCAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAACTGCAGTTAC

1381 ggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccc 1440
CCTCAAACAAAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGTTGAGGCGGG

1441 cattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtt 1500
GTAACTGCGTTTACCCGCCATCCGCACATGCCACCCTCCAGATATATTCGTCTCGACCAA

ORF_1 rf(3)(1551,2951)>>>
|
KpnI EGFP reporter(1551,2267)>>>
| |
1501 tagtgaaccgtcagggtaccggatcccttaagtgaacaactagtgccaccatggtgagca 1560
ATCACTTGGCAGTCCCATGGCCTAGGGAATTCACTTGTTGATCACGGTGGTACCACTCGT

1561 agggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaa 1620
TCCCGCTCCTCGACAAGTGGCCCCACCACGGGTAGGACCAGCTCGACCTGCCGCTGCATT

1621 acggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctga 1680
TGCCGGTGTTCAAGTCGCACAGGCCGCTCCCGCTCCCGCTACGGTGGATGCCGTTCGACT

1681 ccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgacca 1740
GGGACTTCAAGTAGACGTGGTGGCCGTTCGACGGGCACGGGACCGGGTGGGAGCACTGGT

1741 ccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgact 1800
GGGACTGGATGCCGCACGTCACGAAGTCGGCGATGGGGCTGGTGTACTTCGTCGTGCTGA

1801 tcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacg 1860
AGAAGTTCAGGCGGTACGGGCTTCCGATGCAGGTCCTCGCGTGGTAGAAGAAGTTCCTGC

1861 acggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgca 1920
TGCCGTTGATGTTCTGGGCGCGGCTCCACTTCAAGCTCCCGCTGTGGGACCACTTGGCGT

1921 tcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagt 1980
AGCTCGACTTCCCGTAGCTGAAGTTCCTCCTGCCGTTGTAGGACCCCGTGTTCGACCTCA

1981 acaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaagg 2040
TGTTGATGTTGTCGGTGTTGCAGATATAGTACCGGCTGTTCGTCTTCTTGCCGTAGTTCC

2041 tgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactacc 2100
ACTTGAAGTTCTAGGCGGTGTTGTAGCTCCTGCCGTCGCACGTCGAGCGGCTGGTGATGG

2101 agcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagca 2160
TCGTCTTGTGGGGGTAGCCGCTGCCGGGGCACGACGACGGGCTGTTGGTGATGGACTCGT

2161 cccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagt 2220
GGGTCAGGCGGGACTCGTTTCTGGGGTTGCTCTTCGCGCTAGTGTACCAGGACGACCTCA

EcoRI
|
2221 tcgtgaccgccgccgggatcactctcggcatggacgagctgtacaaggaattcggaagcg 2280
AGCACTGGCGGCGGCCCTAGTGAGAGCCGTACCTGCTCGACATGTTCCTTAAGCCTTCGC

2281 ggcagtgcaccaactacgccctgctgaagctggccggcgacgtggagagcaaccccggcc 2340
CCGTCACGTGGTTGATGCGGGACGACTTCGACCGGCCGCTGCACCTCTCGTTGGGGCCGG

puro marker(2355,2951)>>>
|
2341 ccggatccatggccaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtcc 2400
GGCCTAGGTACCGGTGGCTCATGTTCGGGTGCCACGCGGAGCGGTGGGCGCTGCTGCAGG

2401 cccgggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccg 2460
GGGCCCGGCATGCGTGGGAGCGGCGGCGCAAGCGGCTGATGGGGCGGTGCGCGGTGTGGC

2461 tcgacccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcg 2520
AGCTGGGCCTGGCGGTGTAGCTCGCCCAGTGGCTCGACGTTCTTGAGAAGGAGTGCGCGC

2521 tcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctgga 2580
AGCCCGAGCTGTAGCCGTTCCACACCCAGCGCCTGCTGCCGCGGCGCCACCGCCAGACCT

2581 ccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggctcgcgcatggccg 2640
GGTGCGGCCTCTCGCAGCTTCGCCCCCGCCACAAGCGGCTCTAGCCGAGCGCGTACCGGC

StuI
|
2641 agttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcacc 2700
TCAACTCGCCAAGGGCCGACCGGCGCGTCGTTGTCTACCTTCCGGAGGACCGCGGCGTGG

2701 ggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggca 2760
CCGGGTTCCTCGGGCGCACCAAGGACCGGTGGCAGCCGCAGAGCGGGCTGGTGGTCCCGT

2761 agggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgctggggtgc 2820
TCCCAGACCCGTCGCGGCAGCACGAGGGGCCTCACCTCCGCCGGCTCGCGCGACCCCACG

2821 ccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttca 2880
GGCGGAAGGACCTCTGGAGGCGCGGGGCGTTGGAGGGGAAGATGCTCGCCGAGCCGAAGT

2881 ccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagc 2940
GGCAGTGGCGGCTGCAGCTCCACGGGCTTCCTGGCGCGTGGACCACGTACTGGGCGTTCG

2941 ccggtgcctgaacgcgtcttaaggcgatcgcagacatgataagatacattgatgagtttg 3000
GGCCACGGACTTGCGCAGAATTCCGCTAGCGTCTGTACTATTCTATGTAACTACTCAAAC

3001 gacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgcta 3060
CTGTTTGGTGTTGATCTTACGTCACTTTTTTTACGAAATAAACACTTTAAACACTACGAT

3061 ttgctttatttgtaaccattataagctgcaataaacaagttaataacaacaattccattc 3120
AACGAAATAAACATTGGTAATATTCGACGTTATTTGTTCAATTATTGTTGTTAAGGTAAG

3121 attttatgtttcaggttcagggggagatgtgggaggttttttaaagcaagtaaaacctct 3180
TAAAATACAAAGTCCAAGTCCCCCTCTACACCCTCCAAAAAATTTCGTTCATTTTGGAGA

3181 acaaatgtggtagtcgaaattcccgataaggatcttcctagagcatggctacgtagataa 3240
TGTTTACACCATCAGCTTTAAGGGCTATTCCTAGAAGGATCTCGTACCGATGCATCTATT

3241 gtagcatggcgggttaatcattaactacaaggaacccctagtgatggagttggccactcc 3300
CATCGTACCGCCCAATTAGTAATTGATGTTCCTTGGGGATCACTACCTCAACCGGTGAGG

3301 ctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccggg 3360
GAGAGACGCGCGAGCGAGCGAGTGACTCCGGCCCGCTGGTTTCCAGCGGGCTGCGGGCCC

3361 ctttgcccgggcggcctcagtgagcgagcgagcgcgcagggatcccggtgtgaaataccg 3420
GAAACGGGCCCGCCGGAGTCACTCGCTCGCTCGCGCGTCCCTAGGGCCACACTTTATGGC

3421 cacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgac 3480
GTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTG

3481 tcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaata 3540
AGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTAT

3541 cggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaa 3600
GCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTT

pBR322 origin(3624,4243)<<<
|
3601 aaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccct 3660
TTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGA

3661 gacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataa 3720
CTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATT

3721 agataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccg 3780
TCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGC

3781 cttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctca 3840
GAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGT

3841 cgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaa 3900
GCGACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTT

3901 ccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccg 3960
GGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGC

3961 gtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgagg 4020
CATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCC

4021 tatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagg 4080
ATACATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCC

4081 acagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagc 4140
TGTCATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCG

4141 tcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcag 4200
AGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTC

4201 attacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgac 4260
TAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTG

4261 gctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatc 4320
CGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAG

4321 ttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgag 4380
AAGTGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTC

4381 taaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgt 4440
ATTTGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACA

4441 ctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggag 4500
GATAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTC

4501 ggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctcca 4560
CCGAATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGT

4561 gatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaact 4620
CTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGA

4621 ttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgcca 4680
AATAGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGT

4681 gttaatagtttgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgtaga 4740
CAATTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCT

4741 aagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctgga 4800
TTCGGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCT

4801 caagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgat 4860
GTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTA

NEOKAN prom(4896,4945)>>>
|
4861 agctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccct 4920
TCGATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGA

4921 ctggtaaggttgggaagccctgcaaagtaaactggatggctttctcgccgccaaggatct 4980
GACCATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGA

NTP_II marker(5037,5825)>>>
|
BclI ORF_2 rf(3)(5034,5828)>>>
| | |
4981 gatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattg 5040
CTACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAAC

5041 aacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatg 5100
TTGTTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATAC

5101 actgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcagg 5160
TGACCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCC

5161 ggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacg 5220
CCGCGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGC

5221 aggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacg 5280
TCCGTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGC

5281 ttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcc 5340
AACAGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGG

5341 tgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggc 5400
ACAGTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCG

5401 tgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagc 5460
ACGTATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCG

5461 gagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatc 5520
CTCGTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAG

SphI
|
5521 aggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgagg 5580
TCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCC

5581 atctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgct 5640
TAGAGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGA

5641 tttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgt 5700
AAAGACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCA

5701 tggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgc 5760
ACCGATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACG

5761 tttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagt 5820
AAATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCA

5821 tcttctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggccgaa 5880
AGAAGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTT

f1 origin(5933,6238)<<<
|
5881 atcggcaacatcccttataaatcaaaagaatagaccgcgatagggttgagtgttgttcca 5940
TAGCCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGT

5941 gtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaacc 6000
CAAACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGG

6001 gtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcggtcg 6060
CAGATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGC

6061 aggtgccgtaaagctctaaatcggaaccctaaagggagcccccgatttagagcttgacgg 6120
TCCACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCC

6121 ggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagg 6180
CCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCC

6181 gcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgc 6240
CGCGACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCG

6241 cgctacagggcgcgtccattcgccattcaggatcgaattaattcttaattaacatcatca 6300
GCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGT

6301 ataatatacctt 6312
TATTATATGGAA