pLenti-GIII-CMV
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepLenti-GIII-CMV
VectorTypeLentiviral Plasmid
Antibiotic InformationBacterial: Kanamycin. Mammalian: Puromycin.
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
SV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional InformationThe gene expression is driven by a CMV promoter, without any Tag or reporter.
Original Vector: 9779bp
Vector without Insert Casette: 8074bp
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 aactccgccc cattgacgca aatgggcggt aggcgtgtac ggtgggaggt ctatataagc     
61 agagctcgtt tagtgaaccg tcagatcgcc tggagacgcc atccacgctg ttttgacctc
121 catagaagaa ccgagtttaa actccctatc agtgatagag atctccctat cagtgataga
181 gagctagcga tatcaacaag tttgtacaaa aaagctgaac gagaaacgta aaatgatata
241 aatatcaata tattaaatta gattttgcat aaaaaacaga ctacataata ctgtaaaaca
301 caacatatcc agtcactatg gcggccgcat taggcacccc aggctttaca ctttatgctt
361 ccggctcgta taatgtgtgg attttgagtt aggatccgtc gagattttca ggagctaagg
421 aagctaaaat ggagaaaaaa atcactggat ataccaccgt tgatatatcc caatggcatc
481 gtaaagaaca ttttgaggca tttcagtcag ttgctcaatg tacctataac cagaccgttc
541 agctggatat tacggccttt ttaaagaccg taaagaaaaa taagcacaag ttttatccgg
601 cctttattca cattcttgcc cgcctgatga atgctcatcc ggaattccgt atggcaatga
661 aagacggtga gctggtgata tgggatagtg ttcacccttg ttacaccgtt ttccatgagc
721 aaactgaaac gttttcatcg ctctggagtg aataccacga cgatttccgg cagtttctac
781 acatatattc gcaagatgtg gcgtgttacg gtgaaaacct ggcctatttc cctaaagggt
841 ttattgagaa tatgtttttc gtctcagcca atccctgggt gagtttcacc agttttgatt
901 taaacgtggc caatatggac aacttcttcg cccccgtttt caccatgggc aaatattata
961 cgcaaggcga caaggtgctg atgccgctgg cgattcaggt tcatcatgcc gtttgtgatg
1021 gcttccatgt cggcagaatg cttaatgaat tacaacagta ctgcgatgag tggcagggcg
1081 gggcgtaaag atctggatcc ggcttactaa aagccagata acagtatgcg tatttgcgcg
1141 ctgatttttg cggtataaga atatatactg atatgtatac ccgaagtatg tcaaaaagag
1201 gtatgctatg aagcagcgta ttacagtgac agttgacagc gacagctatc agttgctcaa
1261 ggcatatatg atgtcaatat ctccggtctg gtaagcacaa ccatgcagaa tgaagcccgt
1321 cgtctgcgtg ccgaacgctg gaaagcggaa aatcaggaag ggatggctga ggtcgcccgg
1381 tttattgaaa tgaacggctc ttttgctgac gagaacaggg gctggtgaaa tgcagtttaa
1441 ggtttacacc tataaaagag agagccgtta tcgtctgttt gtggatgtac agagtgatat
1501 tattgacacg cccgggcgac ggatggtgat ccccctggcc agtgcacgtc tgctgtcaga
1561 taaagtctcc cgtgaacttt acccggtggt gcatatcggg gatgaaagct ggcgcatgat
1621 gaccaccgat atggccagtg tgccggtctc cgttatcggg gaagaagtgg ctgatctcag
1681 ccaccgcgaa aatgacatca aaaacgccat taacctgatg ttctggggaa tataaatgtc
1741 aggctccctt atacacagcc agtctgcagg tcgaccatag tgactggata tgttgtgttt
1801 tacagtatta tgtagtctgt tttttatgca aaatctaatt taatatattg atatttatat
1861 cattttacgt ttctcgttca gctttcttgt acaaagtggt tgatatctga ctcgagtacc
1921 catacgacgt cccagactac gcttgagttt aaacacgcgt ggtgtggaaa gtccccaggc
1981 tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac caggtgtgga
2041 aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca
2101 accatagtcc cgcccctaac tccgcccatc ccgcccctaa ctccgcccag ttccgcccat
2161 tctccgcccc atggctgact aatttttttt atttatgcag aggccgaggc cgcctcggcc
2221 tctgagctat tccagaagta gtgaggaggc ttttttggag gccatgaccg agtacaagcc
2281 cacggtgcgc ctcgccaccc gcgacgacgt ccctcgggcc gtacgcaccc tcgccgccgc
2341 gttcgccgac taccccgcca cgcgccacac cgtggacccg gaccgccaca tcgagcgggt
2401 caccgagctg caagaactct tcctcacgcg cgtcgggctc gacatcggca aggtgtgggt
2461 cgcggacgac ggcgccgcgg tggcggtctg gaccacgccg gagagcgtcg aagcgggggc
2521 ggtgttcgcc gagatcggcc cgcgcatggc cgagttgagc ggttcccggc tggccgcgca
2581 gcaacagatg gaagggctcc tggcgccgca ccggcccaag gagcccgcgt ggttcctggc
2641 caccgtcggc gtctcgcccg accaccaggg caagggtctg ggcagcgccg tcgtgctccc
2701 cggagtggag gcggccgagc gcgccggggt gcccgccttc ctggagacct ccgcgccccg
2761 caacctcccc ttctacgagc ggctcggctt caccgtcacc gccgacgtcg aggtgcccga
2821 aggaccgcgc acctggtgca tgacccgcaa gcccggtgcc tgaacgcgtt ccggaaatca
2881 acctctggat tacaaaattt gtgaaagatt gactggtatt cttaactatg ttgctccttt
2941 tacgctatgt ggatacgctg ctttaatgcc tttgtatcat gctattgctt cccgtatggc
3001 tttcattttc tcctccttgt ataaatcctg gttgctgtct ctttatgagg agttgtggcc
3061 cgttgtcagg caacgtggcg tggtgtgcac tgtgtttgct gacgcaaccc ccactggttg
3121 gggcattgcc accacctgtc agctcctttc cgggactttc gctttccccc tccctattgc
3181 cacggcggaa ctcatcgccg cctgccttgc ccgctgctgg acaggggctc ggctgttggg
3241 cactgacaat tccgtggtgt tgtcggggaa gctgacgtcc tttccatggc tgctcgcctg
3301 tgttgccacc tggattctgc gcgggacgtc cttctgctac gtcccttcgg ccctcaatcc
3361 agcggacctt ccttcccgcg gcctgctgcc ggctctgcgg cctcttccgc gtctcgcctt
3421 cgccctcaga cgagtcggat ctccctttgg gccgcctccc cgcctgtccg gatggaaggg
3481 ctaattcact cccaacgaat acaagatctg ctttttgctt gtactgggtc tctctggtta
3541 gaccagatct gagcctggga gctctctggc taactaggga acccactgct taagcctcaa
3601 taaagcttgc cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac
3661 tagagatccc tcagaccctt ttagtcagtg tggaaaatct ctagcagtag tagttcatgt
3721 catcttatta ttcagtattt ataacttgca aagaaatgaa tatcagagag tgagaggaac
3781 ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat
3841 aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat
3901 catgtctggc atctatgtcg ggtgcggaga aagaggtaat gaaatggcat tatgggtatt
3961 atgggtctgc attaatgaat cggccaacga tcccggtgtg aaataccgca cagatgcgta
4021 aggagaaaat accgcatcag gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg
4081 gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca
4141 gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac
4201 cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac
4261 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg
4321 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac
4381 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat
4441 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag
4501 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac
4561 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt
4621 gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt
4681 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc
4741 aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga
4801 aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac
4861 gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc
4921 cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct
4981 gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca
5041 tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct
5101 ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca
5161 ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc
5221 atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg
5281 cgcaacgttg ttgaaaaagg atcttcacct agatcctttt cacgtagaaa gccagtccgc
5341 agaaacggtg ctgaccccgg atgaatgtca gctactgggc tatctggaca agggaaaacg
5401 caagcgcaaa gagaaagcag gtagcttgca gtgggcttac atggcgatag ctagactggg
5461 cggttttatg gacagcaagc gaaccggaat tgccagctgg ggcgccctct ggtaaggttg
5521 ggaagccctg caaagtaaac tggatggctt tctcgccgcc aaggatctga tggcgcaggg
5581 gatcaagctc tgatcaagag acaggatgag gatcgtttcg catgattgaa caagatggat
5641 tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac
5701 agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc
5761 tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaagacgag gcagcgcggc
5821 tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag
5881 cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc
5941 ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg
6001 atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc
6061 ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc
6121 cagccgaact gttcgccagg ctcaaggcga gcatgcccga cggcgaggat ctcgtcgtga
6181 cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca
6241 tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg
6301 atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg
6361 ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgaattt
6421 tgttaaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaacatc
6481 ccttataaat caaaagaata gaccgcgata gggttgagtg ttgttccagt ttggaacaag
6541 agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt ctatcagggc
6601 gatggcccac tacgtgaacc atcacccaaa tcaagttttt tgcggtcgag gtgccgtaaa
6661 gctctaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg aaagccggcg
6721 aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc gctggcaagt
6781 gtagcggtca cgctgcgcgt aaccaccaca cccgcgcgct taatgcgccg ctacagggcg
6841 cgtccattcg ccattcagga tcgaattaat tcttaattaa catcatcaat aatatacctt
6901 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt
6961 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
7021 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
7081 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
7141 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
7201 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
7261 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
7321 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
7381 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag
7441 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg
7501 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact
7561 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct
7621 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt
7681 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac
7741 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc
7801 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc
7861 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa
7921 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg
7981 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata
8041 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc
8101 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga
8161 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc
8221 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca
8281 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag
8341 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta
8401 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga
8461 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg
8521 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg
8581 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc
8641 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg
8701 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat
8761 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac
8821 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat
8881 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca
8941 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga
9001 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg
9061 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa
9121 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga
9181 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag
9241 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa
9301 aattcaaaat tttcgggttt ttcgaaccta gggttccgcg ttacataact tacggtaaat
9361 ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt
9421 cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa
9481 actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc
9541 aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct
9601 acttggcagt acatctacgt ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt
9661 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg
9721 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaac
                                    LOCUS       dna                      9779 bp                                   
FEATURES Location/Qualifiers
Promoter 6..87
/gene="CMV prom"
misc_binding 321..328
/dbxref="REBASE:NotI"
Marker 429..1088
/gene="CAT marker"
ORF 429..1088
/sequence="ORF_3 rf(3)"
misc_binding 642..647
/dbxref="REBASE:EcoRI"
Other Gene 1430..1735
/gene="ccdB other"
misc_binding 1511..1516
/dbxref="REBASE:XmaI"
misc_binding 1511..1516
/dbxref="REBASE:SmaI"
misc_binding 1764..1769
/dbxref="REBASE:PstI"
misc_binding 1911..1916
/dbxref="REBASE:XhoI"
Promoter 1961..2229
/gene="SV40 prom"
Rep_Origin 2128..2205
/gene="SV40 origin"
ORF 2195..2863
/sequence="ORF_2 rf(2)"
misc_binding 2208..2220
/dbxref="REBASE:SfiI"
Marker 2264..2863
/gene="puro marker"
Other Gene 3473..3525
/gene="delta_U3 other"
Other Gene 3526..3706
/gene="HIV-1_5_LTR other"
Rep_Origin 4212..4831
/gene="pBR322 origin"
Promoter 5484..5533
/gene="NEOKAN prom"
misc_binding 5591..5596
/dbxref="REBASE:BclI"
ORF 5622..6416
/sequence="ORF_4 rf(3)"
Marker 5625..6413
/gene="NTP_II marker"
Rep_Origin 6521..6826
/gene="f1 origin"
Other Gene 6881..6982
/gene="RITR other"
Other Gene 6881..6982
/gene="LITR other"
Other Gene 7062..7210
/gene="Encap other"
Promoter 7265..7293
/gene="amp prom"
misc_binding 7357..7362
/dbxref="REBASE:HpaI"
Other Gene 7615..7795
/gene="HIV-1_5_LTR other"
Other Gene 7906..7950
/gene="HIV-1_psi_pack other"
misc_binding 7992..7997
/dbxref="REBASE:NruI"
Regulatory_Seq 8457..8690
/gene="RRE reg"
ORF 8500..9201
/sequence="ORF_1 rf(1)"
misc_binding 9511..9516
/dbxref="REBASE:NdeI"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
           CMV prom(6,87)>>> 
|
1 aactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagc 60
TTGAGGCGGGGTAACTGCGTTTACCCGCCATCCGCACATGCCACCCTCCAGATATATTCG

61 agagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctc 120
TCTCGAGCAAATCACTTGGCAGTCTAGCGGACCTCTGCGGTAGGTGCGACAAAACTGGAG

121 catagaagaaccgagtttaaactccctatcagtgatagagatctccctatcagtgataga 180
GTATCTTCTTGGCTCAAATTTGAGGGATAGTCACTATCTCTAGAGGGATAGTCACTATCT

181 gagctagcgatatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatata 240
CTCGATCGCTATAGTTGTTCAAACATGTTTTTTCGACTTGCTCTTTGCATTTTACTATAT

241 aatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaaca 300
TTATAGTTATATAATTTAATCTAAAACGTATTTTTTGTCTGATGTATTATGACATTTTGT

NotI
|
301 caacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgctt 360
GTTGTATAGGTCAGTGATACCGCCGGCGTAATCCGTGGGGTCCGAAATGTGAAATACGAA

361 ccggctcgtataatgtgtggattttgagttaggatccgtcgagattttcaggagctaagg 420
GGCCGAGCATATTACACACCTAAAACTCAATCCTAGGCAGCTCTAAAAGTCCTCGATTCC

ORF_3 rf(3)(429,1088)>>>
|
CAT marker(429,1088)>>>
|
421 aagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatc 480
TTCGATTTTACCTCTTTTTTTAGTGACCTATATGGTGGCAACTATATAGGGTTACCGTAG

481 gtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttc 540
CATTTCTTGTAAAACTCCGTAAAGTCAGTCAACGAGTTACATGGATATTGGTCTGGCAAG

541 agctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccgg 600
TCGACCTATAATGCCGGAAAAATTTCTGGCATTTCTTTTTATTCGTGTTCAAAATAGGCC

EcoRI
|
601 cctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatga 660
GGAAATAAGTGTAAGAACGGGCGGACTACTTACGAGTAGGCCTTAAGGCATACCGTTACT

661 aagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagc 720
TTCTGCCACTCGACCACTATACCCTATCACAAGTGGGAACAATGTGGCAAAAGGTACTCG

721 aaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctac 780
TTTGACTTTGCAAAAGTAGCGAGACCTCACTTATGGTGCTGCTAAAGGCCGTCAAAGATG

781 acatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggt 840
TGTATATAAGCGTTCTACACCGCACAATGCCACTTTTGGACCGGATAAAGGGATTTCCCA

841 ttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatt 900
AATAACTCTTATACAAAAAGCAGAGTCGGTTAGGGACCCACTCAAAGTGGTCAAAACTAA

901 taaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattata 960
ATTTGCACCGGTTATACCTGTTGAAGAAGCGGGGGCAAAAGTGGTACCCGTTTATAATAT

961 cgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatg 1020
GCGTTCCGCTGTTCCACGACTACGGCGACCGCTAAGTCCAAGTAGTACGGCAAACACTAC

1021 gcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcg 1080
CGAAGGTACAGCCGTCTTACGAATTACTTAATGTTGTCATGACGCTACTCACCGTCCCGC

1081 gggcgtaaagatctggatccggcttactaaaagccagataacagtatgcgtatttgcgcg 1140
CCCGCATTTCTAGACCTAGGCCGAATGATTTTCGGTCTATTGTCATACGCATAAACGCGC

1141 ctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagag 1200
GACTAAAAACGCCATATTCTTATATATGACTATACATATGGGCTTCATACAGTTTTTCTC

1201 gtatgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaa 1260
CATACGATACTTCGTCGCATAATGTCACTGTCAACTGTCGCTGTCGATAGTCAACGAGTT

1261 ggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgt 1320
CCGTATATACTACAGTTATAGAGGCCAGACCATTCGTGTTGGTACGTCTTACTTCGGGCA

1321 cgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccgg 1380
GCAGACGCACGGCTTGCGACCTTTCGCCTTTTAGTCCTTCCCTACCGACTCCAGCGGGCC

ccdB other(1430,1735)>>>
|
1381 tttattgaaatgaacggctcttttgctgacgagaacaggggctggtgaaatgcagtttaa 1440
AAATAACTTTACTTGCCGAGAAAACGACTGCTCTTGTCCCCGACCACTTTACGTCAAATT

1441 ggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatat 1500
CCAAATGTGGATATTTTCTCTCTCGGCAATAGCAGACAAACACCTACATGTCTCACTATA

SmaI
|
XmaI
| |
1501 tattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcaga 1560
ATAACTGTGCGGGCCCGCTGCCTACCACTAGGGGGACCGGTCACGTGCAGACGACAGTCT

1561 taaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgat 1620
ATTTCAGAGGGCACTTGAAATGGGCCACCACGTATAGCCCCTACTTTCGACCGCGTACTA

1621 gaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcag 1680
CTGGTGGCTATACCGGTCACACGGCCAGAGGCAATAGCCCCTTCTTCACCGACTAGAGTC

1681 ccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtc 1740
GGTGGCGCTTTTACTGTAGTTTTTGCGGTAATTGGACTACAAGACCCCTTATATTTACAG

PstI
|
1741 aggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttt 1800
TCCGAGGGAATATGTGTCGGTCAGACGTCCAGCTGGTATCACTGACCTATACAACACAAA

1801 tacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatat 1860
ATGTCATAATACATCAGACAAAAAATACGTTTTAGATTAAATTATATAACTATAAATATA

XhoI
|
1861 cattttacgtttctcgttcagctttcttgtacaaagtggttgatatctgactcgagtacc 1920
GTAAAATGCAAAGAGCAAGTCGAAAGAACATGTTTCACCAACTATAGACTGAGCTCATGG

SV40 prom(1961,2229)>>>
|
1921 catacgacgtcccagactacgcttgagtttaaacacgcgtggtgtggaaagtccccaggc 1980
GTATGCTGCAGGGTCTGATGCGAACTCAAATTTGTGCGCACCACACCTTTCAGGGGTCCG

1981 tccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtgga 2040
AGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTGGTCCACACCT

2041 aagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagca 2100
TTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGT

SV40 origin(2128,2205)>>>
|
2101 accatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccat 2160
TGGTATCAGGGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGCGGGTCAAGGCGGGTA

SfiI
|
ORF_2 rf(2)(2195,2863)>>>
| |
2161 tctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcc 2220
AGAGGCGGGGTACCGACTGATTAAAAAAAATAAATACGTCTCCGGCTCCGGCGGAGCCGG

puro marker(2264,2863)>>>
|
2221 tctgagctattccagaagtagtgaggaggcttttttggaggccatgaccgagtacaagcc 2280
AGACTCGATAAGGTCTTCATCACTCCTCCGAAAAAACCTCCGGTACTGGCTCATGTTCGG

2281 cacggtgcgcctcgccacccgcgacgacgtccctcgggccgtacgcaccctcgccgccgc 2340
GTGCCACGCGGAGCGGTGGGCGCTGCTGCAGGGAGCCCGGCATGCGTGGGAGCGGCGGCG

2341 gttcgccgactaccccgccacgcgccacaccgtggacccggaccgccacatcgagcgggt 2400
CAAGCGGCTGATGGGGCGGTGCGCGGTGTGGCACCTGGGCCTGGCGGTGTAGCTCGCCCA

2401 caccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggt 2460
GTGGCTCGACGTTCTTGAGAAGGAGTGCGCGCAGCCCGAGCTGTAGCCGTTCCACACCCA

2461 cgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggc 2520
GCGCCTGCTGCCGCGGCGCCACCGCCAGACCTGGTGCGGCCTCTCGCAGCTTCGCCCCCG

2521 ggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgca 2580
CCACAAGCGGCTCTAGCCGGGCGCGTACCGGCTCAACTCGCCAAGGGCCGACCGGCGCGT

2581 gcaacagatggaagggctcctggcgccgcaccggcccaaggagcccgcgtggttcctggc 2640
CGTTGTCTACCTTCCCGAGGACCGCGGCGTGGCCGGGTTCCTCGGGCGCACCAAGGACCG

2641 caccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccc 2700
GTGGCAGCCGCAGAGCGGGCTGGTGGTCCCGTTCCCAGACCCGTCGCGGCAGCACGAGGG

2701 cggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccg 2760
GCCTCACCTCCGCCGGCTCGCGCGGCCCCACGGGCGGAAGGACCTCTGGAGGCGCGGGGC

2761 caacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccga 2820
GTTGGAGGGGAAGATGCTCGCCGAGCCGAAGTGGCAGTGGCGGCTGCAGCTCCACGGGCT

2821 aggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaacgcgttccggaaatca 2880
TCCTGGCGCGTGGACCACGTACTGGGCGTTCGGGCCACGGACTTGCGCAAGGCCTTTAGT

2881 acctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttt 2940
TGGAGACCTAATGTTTTAAACACTTTCTAACTGACCATAAGAATTGATACAACGAGGAAA

2941 tacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggc 3000
ATGCGATACACCTATGCGACGAAATTACGGAAACATAGTACGATAACGAAGGGCATACCG

3001 tttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcc 3060
AAAGTAAAAGAGGAGGAACATATTTAGGACCAACGACAGAGAAATACTCCTCAACACCGG

3061 cgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttg 3120
GCAACAGTCCGTTGCACCGCACCACACGTGACACAAACGACTGCGTTGGGGGTGACCAAC

3121 gggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgc 3180
CCCGTAACGGTGGTGGACAGTCGAGGAAAGGCCCTGAAAGCGAAAGGGGGAGGGATAACG

3181 cacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttggg 3240
GTGCCGCCTTGAGTAGCGGCGGACGGAACGGGCGACGACCTGTCCCCGAGCCGACAACCC

3241 cactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctg 3300
GTGACTGTTAAGGCACCACAACAGCCCCTTCGACTGCAGGAAAGGTACCGACGAGCGGAC

3301 tgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatcc 3360
ACAACGGTGGACCTAAGACGCGCCCTGCAGGAAGACGATGCAGGGAAGCCGGGAGTTAGG

3361 agcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtctcgcctt 3420
TCGCCTGGAAGGAAGGGCGCCGGACGACGGCCGAGACGCCGGAGAAGGCGCAGAGCGGAA

delta_U3 other(3473,3525)>>>
|
3421 cgccctcagacgagtcggatctccctttgggccgcctccccgcctgtccggatggaaggg 3480
GCGGGAGTCTGCTCAGCCTAGAGGGAAACCCGGCGGAGGGGCGGACAGGCCTACCTTCCC

HIV-1_5_LTR other(3526,3706)>>>
|
3481 ctaattcactcccaacgaatacaagatctgctttttgcttgtactgggtctctctggtta 3540
GATTAAGTGAGGGTTGCTTATGTTCTAGACGAAAAACGAACATGACCCAGAGAGACCAAT

3541 gaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaa 3600
CTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAATTCGGAGTT

3601 taaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaac 3660
ATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTGAGACCATTG

3661 tagagatccctcagacccttttagtcagtgtggaaaatctctagcagtagtagttcatgt 3720
ATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCATCATCAAGTACA

3721 catcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaac 3780
GTAGAATAATAAGTCATAAATATTGAACGTTTCTTTACTTATAGTCTCTCACTCTCCTTG

3781 ttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaat 3840
AACAAATAACGTCGAATATTACCAATGTTTATTTCGTTATCGTAGTGTTTAAAGTGTTTA

3841 aaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttat 3900
TTTCGTAAAAAAAGTGACGTAAGATCAACACCAAACAGGTTTGAGTAGTTACATAGAATA

3901 catgtctggcatctatgtcgggtgcggagaaagaggtaatgaaatggcattatgggtatt 3960
GTACAGACCGTAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGTAATACCCATAA

3961 atgggtctgcattaatgaatcggccaacgatcccggtgtgaaataccgcacagatgcgta 4020
TACCCAGACGTAATTACTTAGCCGGTTGCTAGGGCCACACTTTATGGCGTGTCTACGCAT

4021 aggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcg 4080
TCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGC

4081 gtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccaca 4140
CAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGT

4141 gaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaac 4200
CTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTG

pBR322 origin(4212,4831)<<<
|
4201 cgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcac 4260
GCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTG

4261 aaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcg 4320
TTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGC

4321 tttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatac 4380
AAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATG

4381 ctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtat 4440
GACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATA

4441 ctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcag 4500
GAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTC

4501 cccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgac 4560
GGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTG

4561 ttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggt 4620
AATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCA

4621 gctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggt 4680
CGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCA

4681 atctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggc 4740
TAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCG

4741 aaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga 4800
TTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCT

4801 aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaac 4860
TTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTG

4861 gaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatc 4920
CTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAG

4921 cttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtct 4980
GAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAGA

4981 gacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttca 5040
CTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGT

5041 tccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatct 5100
AGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGA

5101 ggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagca 5160
CCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGT

5161 ataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctcc 5220
TATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGG

5221 atccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttg 5280
TAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAAC

5281 cgcaacgttgttgaaaaaggatcttcacctagatccttttcacgtagaaagccagtccgc 5340
GCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCG

5341 agaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacg 5400
TCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGC

5401 caagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactggg 5460
GTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCC

NEOKAN prom(5484,5533)>>>
|
5461 cggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttg 5520
GCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAAC

5521 ggaagccctgcaaagtaaactggatggctttctcgccgccaaggatctgatggcgcaggg 5580
CCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCC

NTP_II marker(5625,6413)>>>
|
BclI ORF_4 rf(3)(5622,6416)>>>
| | |
5581 gatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggat 5640
CTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTA

5641 tgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaac 5700
ACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTG

5701 agacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttc 5760
TCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAG

5761 tttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggc 5820
AAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCG

5821 tatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaag 5880
ATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTC

5881 cgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcacc 5940
GCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGG

5941 ttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttg 6000
AACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAAC

6001 atccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactc 6060
TAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAG

6061 ggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgc 6120
CCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCG

6121 cagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtga 6180
GTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACT

6181 cccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattca 6240
GGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGT

6241 tcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtg 6300
AGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCAC

6301 atattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcg 6360
TATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGC

6361 ccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattt 6420
GGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAA

6421 tgttaaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaacatc 6480
ACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAG

f1 origin(6521,6826)<<<
|
6481 ccttataaatcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaag 6540
GGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTC

6541 agtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggc 6600
TCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCG

6601 gatggcccactacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaaa 6660
CTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTT

6661 gctctaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcg 6720
CGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGC

6721 aacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagt 6780
TTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCA

6781 gtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacagggcg 6840
CATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGC

LITR other(6881,6982)>>>
|
RITR other(6881,6982)<<<
|
6841 cgtccattcgccattcaggatcgaattaattcttaattaacatcatcaataatatacctt 6900
GCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA

6901 ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 6960
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

6961 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 7020
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(7062,7210)>>>
|
7021 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 7080
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

7081 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 7140
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

7141 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 7200
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

7201 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 7260
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(7265,7293)<<<
|
7261 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 7320
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
7321 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 7380
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

7381 gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 7440
CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

7441 caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 7500
GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

7501 tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 7560
ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

HIV-1_5_LTR other(7615,7795)>>>
|
7561 gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 7620
CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

7621 ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 7680
GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

7681 aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 7740
TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

7741 tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 7800
AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

7801 gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 7860
CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

HIV-1_psi_pack other(7906,7950)>>>
|
7861 ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 7920
CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

7921 ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 7980
AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

NruI
|
7981 ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 8040
CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

8041 aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 8100
TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

8101 tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 8160
ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

8161 caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 8220
GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

8221 aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 8280
TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

8281 aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 8340
TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

8341 ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 8400
CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

RRE reg(8457,8690)>>>
|
8401 gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 8460
CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

ORF_1 rf(1)(8500,9201)>>>
|
8461 gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 8520
CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

8521 ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 8580
GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

8581 agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 8640
TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

8641 caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 8700
GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

8701 ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 8760
CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

8761 aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 8820
TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

8821 aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 8880
TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

8881 gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 8940
CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

8941 aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 9000
TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

9001 atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 9060
TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

9061 tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 9120
AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

9121 ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 9180
CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

9181 aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 9240
TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

9241 aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 9300
TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

9301 aattcaaaattttcgggtttttcgaacctagggttccgcgttacataacttacggtaaat 9360
TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCCCAAGGCGCAATGTATTGAATGCCATTTA

9361 ggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgtt 9420
CCGGGCGGACCGACTGGCGGGTTGCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAA

9421 cccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaa 9480
GGGTATCATTGCGGTTATCCCTGAAAGGTAACTGCAGTTACCCACCTCATAAATGCCATT

NdeI
|
9481 actgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtc 9540
TGACGGGTGAACCGTCATGTAGTTCACATAGTATACGGTTCATGCGGGGGATAACTGCAG

9541 aatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcct 9600
TTACTGCCATTTACCGGGCGGACCGTAATACGGGTCATGTACTGGAATACCCTGAAAGGA

9601 acttggcagtacatctacgtttagtcatcgctattaccatggtgatgcggttttggcagt 9660
TGAACCGTCATGTAGATGCAAATCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCA

9661 acatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattg 9720
TGTAGTTACCCGCACCTATCGCCAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAAC

9721 acgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaac 9779
TGCAGTTACCCTCAAACAAAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTG