pLenti-III-CFP-N
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepLenti-III-CFP-N
VectorTypeLentiviral Vector
Antibiotic InformationPuromycin
Sequencing PrimersCMV sequencing primer 5`---CGC AAA TGG GCG GTA GGC GTG---3`
SV40 reverse sequencing primer 5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta     
      481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag     
      541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg     
      601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact     
      661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct     
      721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt     
      781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac     
      841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc     
      901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc     
      961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa     
     1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg     
     1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata     
     1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc     
     1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga     
     1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc     
     1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca     
     1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag     
     1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta     
     1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga     
     1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg     
     1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg     
     1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc     
     1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg     
     1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat     
     1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac     
     1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat     
     1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca     
     2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga     
     2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg     
     2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa     
     2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga     
     2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag     
     2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa     
     2401 aattcaaaat tttcgggttt ttcgaaccta gggttccgcg ttacataact tacggtaaat     
     2461 ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt     
     2521 cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa     
     2581 actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc     
     2641 aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct     
     2701 acttggcagt acatctacgt ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt     
     2761 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg     
     2821 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca     
     2881 actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca     
     2941 gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc     
     3001 atagaagaac cgagtttaaa ctccctatca gtgatagaga tctccctatc agtgatagag     
     3061 agctaggtat ataacgccac catggtgagc aagggcgagg agctgttcac cggggtggtg     
     3121 cccatcctgg tcgagctgga cggcgacgta aacggccaca ggttcagcgt gtccggcgag     
     3181 ggcgagggcg atgccaccta cggcaagctg accctgaagt tcatctgcac caccggcaag     
     3241 ctgcccgtgc cctggcccac cctcgtgacc accctgacct ggggcgtgca gtgcttcagc     
     3301 cgctaccccg accacatgaa gcagcacgac ttcttcaagt ccgccatgcc cgaaggctac     
     3361 gtccaggagc gtaccatctt cttcaaggac gacggcaact acaagacccg cgccgaggtg     
     3421 aagttcgagg gcgacaccct ggtgaaccgc atcgagctga agggcatcga cttcaaggag     
     3481 gacggcaaca tcctggggca caagctggag tacaactaca tcagccacaa cgtctatatc     
     3541 accgccgaca agcagaagaa cggcatcaag gcccacttca agatccgcca caacatcgag     
     3601 gacggcagcg tgcagctcgc cgaccactac cagcagaaca cccccatcgg cgacggcccc     
     3661 gtgctgctgc ccgacaacca ctacctgagc acccagtccg ccctgagcaa agaccccaac     
     3721 gagaagcgcg atcacatggt cctgctggag ttcgtgaccg ccgccgggat cactctcggc     
     3781 atggacgagc tgtacaagcc cggggctagc caattgagta cttacgtagg taccccagtg     
     3841 tggtggcctg caggtgaatt cactagtacc ggtaggcctg tcgacgatat cgggcccgcg     
     3901 gccgctggat cctctagact gcagctcgag tacccatacg acgtcccaga ctacgcttga     
     3961 gtttaaacac gcgtggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag     
     4021 catgcatctc aattagtcag caaccaggtg tggaaagtcc ccaggctccc cagcaggcag     
     4081 aagtatgcaa agcatgcatc tcaattagtc agcaaccata gtcccgcccc taactccgcc     
     4141 catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct gactaatttt     
     4201 ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga agtagtgagg     
     4261 aggctttttt ggaggccatg accgagtaca agcccacggt gcgcctcgcc acccgcgacg     
     4321 acgtccctcg ggccgtacgc accctcgccg ccgcgttcgc cgactacccc gccacgcgcc     
     4381 acaccgtgga cccggaccgc cacatcgagc gggtcaccga gctgcaagaa ctcttcctca     
     4441 cgcgcgtcgg gctcgacatc ggcaaggtgt gggtcgcgga cgacggcgcc gcggtggcgg     
     4501 tctggaccac gccggagagc gtcgaagcgg gggcggtgtt cgccgagatc ggcccgcgca     
     4561 tggccgagtt gagcggttcc cggctggccg cgcagcaaca gatggaaggg ctcctggcgc     
     4621 cgcaccggcc caaggagccc gcgtggttcc tggccaccgt cggcgtctcg cccgaccacc     
     4681 agggcaaggg tctgggcagc gccgtcgtgc tccccggagt ggaggcggcc gagcgcgccg     
     4741 gggtgcccgc cttcctggag acctccgcgc cccgcaacct ccccttctac gagcggctcg     
     4801 gcttcaccgt caccgccgac gtcgaggtgc ccgaaggacc gcgcacctgg tgcatgaccc     
     4861 gcaagcccgg tgcctgaacg cgttccggaa atcaacctct ggattacaaa atttgtgaaa     
     4921 gattgactgg tattcttaac tatgttgctc cttttacgct atgtggatac gctgctttaa     
     4981 tgcctttgta tcatgctatt gcttcccgta tggctttcat tttctcctcc ttgtataaat     
     5041 cctggttgct gtctctttat gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt     
     5101 gcactgtgtt tgctgacgca acccccactg gttggggcat tgccaccacc tgtcagctcc     
     5161 tttccgggac tttcgctttc cccctcccta ttgccacggc ggaactcatc gccgcctgcc     
     5221 ttgcccgctg ctggacaggg gctcggctgt tgggcactga caattccgtg gtgttgtcgg     
     5281 ggaagctgac gtcctttcca tggctgctcg cctgtgttgc cacctggatt ctgcgcggga     
     5341 cgtccttctg ctacgtccct tcggccctca atccagcgga ccttccttcc cgcggcctgc     
     5401 tgccggctct gcggcctctt ccgcgtctcg ccttcgccct cagacgagtc ggatctccct     
     5461 ttgggccgcc tccccgcctg tccggatgga agggctaatt cactcccaac gaatacaaga     
     5521 tctgcttttt gcttgtactg ggtctctctg gttagaccag atctgagcct gggagctctc     
     5581 tggctaacta gggaacccac tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt     
     5641 agtgtgtgcc cgtctgttgt gtgactctgg taactagaga tccctcagac ccttttagtc     
     5701 agtgtggaaa atctctagca gtagtagttc atgtcatctt attattcagt atttataact     
     5761 tgcaaagaaa tgaatatcag agagtgagag gaacttgttt attgcagctt ataatggtta     
     5821 caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag     
     5881 ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggcatctat gtcgggtgcg     
     5941 gagaaagagg taatgaaatg gcattatggg tattatgggt ctgcattaat gaatcggcca     
     6001 acgatcccgg tgtgaaatac cgcacagatg cgtaaggaga aaataccgca tcaggcgctc     
     6061 ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc     
     6121 agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa     
     6181 catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt     
     6241 tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg     
     6301 gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg     
     6361 ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag     
     6421 cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc     
     6481 caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa     
     6541 ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg     
     6601 taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc     
     6661 taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac     
     6721 cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg     
     6781 tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt     
     6841 gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt     
     6901 catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa     
     6961 atcaatctaa agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga     
     7021 ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt     
     7081 gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg     
     7141 agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga     
     7201 gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga     
     7261 agctagagta agtagttcgc cagttaatag tttgcgcaac gttgttgaaa aaggatcttc     
     7321 acctagatcc ttttcacgta gaaagccagt ccgcagaaac ggtgctgacc ccggatgaat     
     7381 gtcagctact gggctatctg gacaagggaa aacgcaagcg caaagagaaa gcaggtagct     
     7441 tgcagtgggc ttacatggcg atagctagac tgggcggttt tatggacagc aagcgaaccg     
     7501 gaattgccag ctggggcgcc ctctggtaag gttgggaagc cctgcaaagt aaactggatg     
     7561 gctttctcgc cgccaaggat ctgatggcgc aggggatcaa gctctgatca agagacagga     
     7621 tgaggatcgt ttcgcatgat tgaacaagat ggattgcacg caggttctcc ggccgcttgg     
     7681 gtggagaggc tattcggcta tgactgggca caacagacaa tcggctgctc tgatgccgcc     
     7741 gtgttccggc tgtcagcgca ggggcgcccg gttctttttg tcaagaccga cctgtccggt     
     7801 gccctgaatg aactgcaaga cgaggcagcg cggctatcgt ggctggccac gacgggcgtt     
     7861 ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa gggactggct gctattgggc     
     7921 gaagtgccgg ggcaggatct cctgtcatct caccttgctc ctgccgagaa agtatccatc     
     7981 atggctgatg caatgcggcg gctgcatacg cttgatccgg ctacctgccc attcgaccac     
     8041 caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct tgtcgatcag     
     8101 gatgatctgg acgaagagca tcaggggctc gcgccagccg aactgttcgc caggctcaag     
     8161 gcgagcatgc ccgacggcga ggatctcgtc gtgacccatg gcgatgcctg cttgccgaat     
     8221 atcatggtgg aaaatggccg cttttctgga ttcatcgact gtggccggct gggtgtggcg     
     8281 gaccgctatc aggacatagc gttggctacc cgtgatattg ctgaagagct tggcggcgaa     
     8341 tgggctgacc gcttcctcgt gctttacggt atcgccgctc ccgattcgca gcgcatcgcc     
     8401 ttctatcgcc ttcttgacga gttcttctga attttgttaa aatttttgtt aaatcagctc     
     8461 attttttaac caataggccg aaatcggcaa catcccttat aaatcaaaag aatagaccgc     
     8521 gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc     
     8581 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc     
     8641 caaatcaagt tttttgcggt cgaggtgccg taaagctcta aatcggaacc ctaaagggag     
     8701 cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa     
     8761 agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac     
     8821 cacacccgcg cgcttaatgc gccgctacag ggcgcgtcca ttcgccattc aggatcgaat     
     8881 taattcttaa ttaacatcat caataatata cctt                                 
                                    LOCUS       dna                      8914 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    457..462
                     /dbxref="REBASE:HpaI"
     Other Gene      715..895
                     /gene="HIV-1_5_LTR other"
     Other Gene      1006..1050
                     /gene="HIV-1_psi_pack other"
     misc_binding    1092..1097
                     /dbxref="REBASE:NruI"
     Regulatory_Seq  1557..1790
                     /gene="RRE reg"
     ORF             1600..2301
                     /sequence="ORF_1 rf(1)"
     misc_binding    2611..2616
                     /dbxref="REBASE:NdeI"
     Promoter        2885..2966
                     /gene="CMV prom"
     Regulatory_Seq  3022..3061
                     /gene="tetO reg"
     ORF             3049..4023
                     /sequence="ORF_5 rf(5)"
     Reporter        3082..3798
                     /gene="EGFP reporter"
     ORF             3082..3960
                     /sequence="ORF_2 rf(1)"
     misc_binding    3799..3804
                     /dbxref="REBASE:XmaI"
     misc_binding    3799..3804
                     /dbxref="REBASE:SmaI"
     misc_binding    3829..3834
                     /dbxref="REBASE:KpnI"
     misc_binding    3856..3861
                     /dbxref="REBASE:EcoRI"
     misc_binding    3874..3879
                     /dbxref="REBASE:StuI"
     misc_binding    3886..3891
                     /dbxref="REBASE:EcoRV"
     misc_binding    3892..3897
                     /dbxref="REBASE:ApaI"
     misc_binding    3898..3905
                     /dbxref="REBASE:NotI"
     misc_binding    3907..3912
                     /dbxref="REBASE:BamHI"
     misc_binding    3913..3918
                     /dbxref="REBASE:XbaI"
     misc_binding    3925..3930
                     /dbxref="REBASE:XhoI"
     Promoter        3975..4243
                     /gene="SV40 prom"
     Rep_Origin      4142..4219
                     /gene="SV40 origin"
     ORF             4209..4877
                     /sequence="ORF_4 rf(3)"
     misc_binding    4222..4234
                     /dbxref="REBASE:SfiI"
     Marker          4278..4877
                     /gene="puro marker"
     Other Gene      5487..5539
                     /gene="delta_U3 other"
     Other Gene      5540..5720
                     /gene="HIV-1_5_LTR other"
     Rep_Origin      6226..6845
                     /gene="pBR322 origin"
     Promoter        7498..7547
                     /gene="NEOKAN prom"
     misc_binding    7605..7610
                     /dbxref="REBASE:BclI"
     ORF             7636..8430
                     /sequence="ORF_3 rf(1)"
     Marker          7639..8427
                     /gene="NTP_II marker"
     Rep_Origin      8535..8840
                     /gene="f1 origin"
BASE COUNT    2228 a   2262 c   2420 g   2004 t    0 others
ORIGIN
        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta     
      481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag     
      541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg     
      601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact     
      661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct     
      721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt     
      781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac     
      841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc     
      901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc     
      961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa     
     1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg     
     1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata     
     1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc     
     1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga     
     1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc     
     1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca     
     1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag     
     1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta     
     1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga     
     1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg     
     1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg     
     1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc     
     1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg     
     1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat     
     1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac     
     1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat     
     1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca     
     2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga     
     2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg     
     2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa     
     2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga     
     2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag     
     2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa     
     2401 aattcaaaat tttcgggttt ttcgaaccta gggttccgcg ttacataact tacggtaaat     
     2461 ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt     
     2521 cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa     
     2581 actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc     
     2641 aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct     
     2701 acttggcagt acatctacgt ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt     
     2761 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg     
     2821 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca     
     2881 actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca     
     2941 gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc     
     3001 atagaagaac cgagtttaaa ctccctatca gtgatagaga tctccctatc agtgatagag     
     3061 agctaggtat ataacgccac catggtgagc aagggcgagg agctgttcac cggggtggtg     
     3121 cccatcctgg tcgagctgga cggcgacgta aacggccaca ggttcagcgt gtccggcgag     
     3181 ggcgagggcg atgccaccta cggcaagctg accctgaagt tcatctgcac caccggcaag     
     3241 ctgcccgtgc cctggcccac cctcgtgacc accctgacct ggggcgtgca gtgcttcagc     
     3301 cgctaccccg accacatgaa gcagcacgac ttcttcaagt ccgccatgcc cgaaggctac     
     3361 gtccaggagc gtaccatctt cttcaaggac gacggcaact acaagacccg cgccgaggtg     
     3421 aagttcgagg gcgacaccct ggtgaaccgc atcgagctga agggcatcga cttcaaggag     
     3481 gacggcaaca tcctggggca caagctggag tacaactaca tcagccacaa cgtctatatc     
     3541 accgccgaca agcagaagaa cggcatcaag gcccacttca agatccgcca caacatcgag     
     3601 gacggcagcg tgcagctcgc cgaccactac cagcagaaca cccccatcgg cgacggcccc     
     3661 gtgctgctgc ccgacaacca ctacctgagc acccagtccg ccctgagcaa agaccccaac     
     3721 gagaagcgcg atcacatggt cctgctggag ttcgtgaccg ccgccgggat cactctcggc     
     3781 atggacgagc tgtacaagcc cggggctagc caattgagta cttacgtagg taccccagtg     
     3841 tggtggcctg caggtgaatt cactagtacc ggtaggcctg tcgacgatat cgggcccgcg     
     3901 gccgctggat cctctagact gcagctcgag tacccatacg acgtcccaga ctacgcttga     
     3961 gtttaaacac gcgtggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag     
     4021 catgcatctc aattagtcag caaccaggtg tggaaagtcc ccaggctccc cagcaggcag     
     4081 aagtatgcaa agcatgcatc tcaattagtc agcaaccata gtcccgcccc taactccgcc     
     4141 catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct gactaatttt     
     4201 ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga agtagtgagg     
     4261 aggctttttt ggaggccatg accgagtaca agcccacggt gcgcctcgcc acccgcgacg     
     4321 acgtccctcg ggccgtacgc accctcgccg ccgcgttcgc cgactacccc gccacgcgcc     
     4381 acaccgtgga cccggaccgc cacatcgagc gggtcaccga gctgcaagaa ctcttcctca     
     4441 cgcgcgtcgg gctcgacatc ggcaaggtgt gggtcgcgga cgacggcgcc gcggtggcgg     
     4501 tctggaccac gccggagagc gtcgaagcgg gggcggtgtt cgccgagatc ggcccgcgca     
     4561 tggccgagtt gagcggttcc cggctggccg cgcagcaaca gatggaaggg ctcctggcgc     
     4621 cgcaccggcc caaggagccc gcgtggttcc tggccaccgt cggcgtctcg cccgaccacc     
     4681 agggcaaggg tctgggcagc gccgtcgtgc tccccggagt ggaggcggcc gagcgcgccg     
     4741 gggtgcccgc cttcctggag acctccgcgc cccgcaacct ccccttctac gagcggctcg     
     4801 gcttcaccgt caccgccgac gtcgaggtgc ccgaaggacc gcgcacctgg tgcatgaccc     
     4861 gcaagcccgg tgcctgaacg cgttccggaa atcaacctct ggattacaaa atttgtgaaa     
     4921 gattgactgg tattcttaac tatgttgctc cttttacgct atgtggatac gctgctttaa     
     4981 tgcctttgta tcatgctatt gcttcccgta tggctttcat tttctcctcc ttgtataaat     
     5041 cctggttgct gtctctttat gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt     
     5101 gcactgtgtt tgctgacgca acccccactg gttggggcat tgccaccacc tgtcagctcc     
     5161 tttccgggac tttcgctttc cccctcccta ttgccacggc ggaactcatc gccgcctgcc     
     5221 ttgcccgctg ctggacaggg gctcggctgt tgggcactga caattccgtg gtgttgtcgg     
     5281 ggaagctgac gtcctttcca tggctgctcg cctgtgttgc cacctggatt ctgcgcggga     
     5341 cgtccttctg ctacgtccct tcggccctca atccagcgga ccttccttcc cgcggcctgc     
     5401 tgccggctct gcggcctctt ccgcgtctcg ccttcgccct cagacgagtc ggatctccct     
     5461 ttgggccgcc tccccgcctg tccggatgga agggctaatt cactcccaac gaatacaaga     
     5521 tctgcttttt gcttgtactg ggtctctctg gttagaccag atctgagcct gggagctctc     
     5581 tggctaacta gggaacccac tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt     
     5641 agtgtgtgcc cgtctgttgt gtgactctgg taactagaga tccctcagac ccttttagtc     
     5701 agtgtggaaa atctctagca gtagtagttc atgtcatctt attattcagt atttataact     
     5761 tgcaaagaaa tgaatatcag agagtgagag gaacttgttt attgcagctt ataatggtta     
     5821 caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag     
     5881 ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggcatctat gtcgggtgcg     
     5941 gagaaagagg taatgaaatg gcattatggg tattatgggt ctgcattaat gaatcggcca     
     6001 acgatcccgg tgtgaaatac cgcacagatg cgtaaggaga aaataccgca tcaggcgctc     
     6061 ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc     
     6121 agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa     
     6181 catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt     
     6241 tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg     
     6301 gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg     
     6361 ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag     
     6421 cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc     
     6481 caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa     
     6541 ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg     
     6601 taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc     
     6661 taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac     
     6721 cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg     
     6781 tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt     
     6841 gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt     
     6901 catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa     
     6961 atcaatctaa agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga     
     7021 ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt     
     7081 gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg     
     7141 agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga     
     7201 gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga     
     7261 agctagagta agtagttcgc cagttaatag tttgcgcaac gttgttgaaa aaggatcttc     
     7321 acctagatcc ttttcacgta gaaagccagt ccgcagaaac ggtgctgacc ccggatgaat     
     7381 gtcagctact gggctatctg gacaagggaa aacgcaagcg caaagagaaa gcaggtagct     
     7441 tgcagtgggc ttacatggcg atagctagac tgggcggttt tatggacagc aagcgaaccg     
     7501 gaattgccag ctggggcgcc ctctggtaag gttgggaagc cctgcaaagt aaactggatg     
     7561 gctttctcgc cgccaaggat ctgatggcgc aggggatcaa gctctgatca agagacagga     
     7621 tgaggatcgt ttcgcatgat tgaacaagat ggattgcacg caggttctcc ggccgcttgg     
     7681 gtggagaggc tattcggcta tgactgggca caacagacaa tcggctgctc tgatgccgcc     
     7741 gtgttccggc tgtcagcgca ggggcgcccg gttctttttg tcaagaccga cctgtccggt     
     7801 gccctgaatg aactgcaaga cgaggcagcg cggctatcgt ggctggccac gacgggcgtt     
     7861 ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa gggactggct gctattgggc     
     7921 gaagtgccgg ggcaggatct cctgtcatct caccttgctc ctgccgagaa agtatccatc     
     7981 atggctgatg caatgcggcg gctgcatacg cttgatccgg ctacctgccc attcgaccac     
     8041 caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct tgtcgatcag     
     8101 gatgatctgg acgaagagca tcaggggctc gcgccagccg aactgttcgc caggctcaag     
     8161 gcgagcatgc ccgacggcga ggatctcgtc gtgacccatg gcgatgcctg cttgccgaat     
     8221 atcatggtgg aaaatggccg cttttctgga ttcatcgact gtggccggct gggtgtggcg     
     8281 gaccgctatc aggacatagc gttggctacc cgtgatattg ctgaagagct tggcggcgaa     
     8341 tgggctgacc gcttcctcgt gctttacggt atcgccgctc ccgattcgca gcgcatcgcc     
     8401 ttctatcgcc ttcttgacga gttcttctga attttgttaa aatttttgtt aaatcagctc     
     8461 attttttaac caataggccg aaatcggcaa catcccttat aaatcaaaag aatagaccgc     
     8521 gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc     
     8581 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc     
     8641 caaatcaagt tttttgcggt cgaggtgccg taaagctcta aatcggaacc ctaaagggag     
     8701 cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa     
     8761 agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac     
     8821 cacacccgcg cgcttaatgc gccgctacag ggcgcgtcca ttcgccattc aggatcgaat     
     8881 taattcttaa ttaacatcat caataatata cctt                                 
//
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
      AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61    gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
      CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

                                               Encap other(162,310)>>> 
                                               |
121   cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
      GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181   aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
      TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241   aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
      TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301   tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
      ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

          amp prom(365,393)<<< 
          |
361   ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
      CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

                                             HpaI 
                                             |
421   gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
      CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481   gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 540
      CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541   caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 600
      GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601   tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 660
      ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

                                                            HIV-1_5_LTR other(715,895)>>> 
                                                            |
661   gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 720
      CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721   ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 780
      GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781   aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 840
      TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841   tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 900
      AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901   gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 960
      CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

                                                   HIV-1_psi_pack other(1006,1050)>>> 
                                                   |
961   ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 1020
      CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021  ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 1080
      AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

                    NruI 
                    |
1081  ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 1140
      CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141  aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 1200
      TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201  tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 1260
      ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261  caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 1320
      GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321  aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 1380
      TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381  aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 1440
      TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441  ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 1500
      CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

                                                              RRE reg(1557,1790)>>> 
                                                              |
1501  gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 1560
      CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

                                             ORF_1 rf(1)(1600,2301)>>> 
                                             |
1561  gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 1620
      CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621  ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 1680
      GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681  agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 1740
      TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741  caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 1800
      GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801  ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 1860
      CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861  aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 1920
      TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921  aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 1980
      TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981  gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 2040
      CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041  aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 2100
      TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101  atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 2160
      TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161  tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 2220
      AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221  ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 2280
      CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281  aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 2340
      TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

2341  aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 2400
      TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

2401  aattcaaaattttcgggtttttcgaacctagggttccgcgttacataacttacggtaaat 2460
      TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCCCAAGGCGCAATGTATTGAATGCCATTTA

2461  ggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgtt 2520
      CCGGGCGGACCGACTGGCGGGTTGCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAA

2521  cccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaa 2580
      GGGTATCATTGCGGTTATCCCTGAAAGGTAACTGCAGTTACCCACCTCATAAATGCCATT

                                      NdeI 
                                      |
2581  actgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtc 2640
      TGACGGGTGAACCGTCATGTAGTTCACATAGTATACGGTTCATGCGGGGGATAACTGCAG

2641  aatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcct 2700
      TTACTGCCATTTACCGGGCGGACCGTAATACGGGTCATGTACTGGAATACCCTGAAAGGA

2701  acttggcagtacatctacgtttagtcatcgctattaccatggtgatgcggttttggcagt 2760
      TGAACCGTCATGTAGATGCAAATCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCA

2761  acatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattg 2820
      TGTAGTTACCCGCACCTATCGCCAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAAC

2821  acgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaaca 2880
      TGCAGTTACCCTCAAACAAAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGT

          CMV prom(2885,2966)>>> 
          |
2881  actccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagca 2940
      TGAGGCGGGGTAACTGCGTTTACCCGCCATCCGCACATGCCACCCTCCAGATATATTCGT

2941  gagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctcc 3000
      CTCGAGCAAATCACTTGGCAGTCTAGCGGACCTCTGCGGTAGGTGCGACAAAACTGGAGG

                           tetO reg(3022,3061)>>>     ORF_5 rf(5)(3049,4023)<<< 
                           |                          |
3001  atagaagaaccgagtttaaactccctatcagtgatagagatctccctatcagtgatagag 3060
      TATCTTCTTGGCTCAAATTTGAGGGATAGTCACTATCTCTAGAGGGATAGTCACTATCTC

                           EGFP reporter(3082,3798)>>> 
                           |
                           ORF_2 rf(1)(3082,3960)>>> 
                           |
3061  agctaggtatataacgccaccATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTG 3120
      TCGATCCATATATTGCGGTGGTACCACTCGTTCCCGCTCCTCGACAAGTGGCCCCACCAC

3121  CCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAGGTTCAGCGTGTCCGGCGAG 3180
      GGGTAGGACCAGCTCGACCTGCCGCTGCATTTGCCGGTGTCCAAGTCGCACAGGCCGCTC

3181  GGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAG 3240
      CCGCTCCCGCTACGGTGGATGCCGTTCGACTGGGACTTCAAGTAGACGTGGTGGCCGTTC

3241  CTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTGGGGCGTGCAGTGCTTCAGC 3300
      GACGGGCACGGGACCGGGTGGGAGCACTGGTGGGACTGGACCCCGCACGTCACGAAGTCG

3301  CGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTAC 3360
      GCGATGGGGCTGGTGTACTTCGTCGTGCTGAAGAAGTTCAGGCGGTACGGGCTTCCGATG

3361  GTCCAGGAGCGTACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTG 3420
      CAGGTCCTCGCATGGTAGAAGAAGTTCCTGCTGCCGTTGATGTTCTGGGCGCGGCTCCAC

3421  AAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAG 3480
      TTCAAGCTCCCGCTGTGGGACCACTTGGCGTAGCTCGACTTCCCGTAGCTGAAGTTCCTC

3481  GACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACATCAGCCACAACGTCTATATC 3540
      CTGCCGTTGTAGGACCCCGTGTTCGACCTCATGTTGATGTAGTCGGTGTTGCAGATATAG

3541  ACCGCCGACAAGCAGAAGAACGGCATCAAGGCCCACTTCAAGATCCGCCACAACATCGAG 3600
      TGGCGGCTGTTCGTCTTCTTGCCGTAGTTCCGGGTGAAGTTCTAGGCGGTGTTGTAGCTC

3601  GACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCC 3660
      CTGCCGTCGCACGTCGAGCGGCTGGTGATGGTCGTCTTGTGGGGGTAGCCGCTGCCGGGG

3661  GTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAAC 3720
      CACGACGACGGGCTGTTGGTGATGGACTCGTGGGTCAGGCGGGACTCGTTTCTGGGGTTG

3721  GAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGC 3780
      CTCTTCGCGCTAGTGTACCAGGACGACCTCAAGCACTGGCGGCGGCCCTAGTGAGAGCCG

                           SmaI 
                           |
                         XmaI                              KpnI 
                         | |                               |
3781  ATGGACGAGCTGTACAAGcccggggctagccaattgagtacttacgtaggtaccccagtg 3840
      TACCTGCTCGACATGTTCGGGCCCCGATCGGTTAACTCATGAATGCATCCATGGGGTCAC

                      EcoRI               StuI        EcoRV   ApaI 
                      |                   |           |       |
3841  tggtggcctgcaggtgaattcactagtaccggtaggcctgtcgacgatatcgggcccgcg 3900
      ACCACCGGACGTCCACTTAAGTGATCATGGCCATCCGGACAGCTGCTATAGCCCGGGCGC

     NotI    BamHI XbaI        XhoI 
     |       |     |           |
3901  gccgctggatcctctagactgcagctcgagtacccatacgacgtcccagactacgcttga 3960
      CGGCGACCTAGGAGATCTGACGTCGAGCTCATGGGTATGCTGCAGGGTCTGATGCGAACT

                    SV40 prom(3975,4243)>>> 
                    |
3961  gtttaaacacgcgtggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaag 4020
      CAAATTTGTGCGCACCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTC

4021  catgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcag 4080
      GTACGTAGAGTTAATCAGTCGTTGGTCCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTC

4081  aagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcc 4140
      TTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTGGTATCAGGGCGGGGATTGAGGCGG

       SV40 origin(4142,4219)>>> 
       |
4141  catcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaatttt 4200
      GTAGGGCGGGGATTGAGGCGGGTCAAGGCGGGTAAGAGGCGGGGTACCGACTGATTAAAA

                                   SfiI 
                                   |
              ORF_4 rf(3)(4209,4877)>>> 
              |                    |
4201  ttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgagg 4260
      AAAATAAATACGTCTCCGGCTCCGGCGGAGCCGGAGACTCGATAAGGTCTTCATCACTCC

                       puro marker(4278,4877)>>> 
                       |
4261  aggcttttttggaggccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacg 4320
      TCCGAAAAAACCTCCGGTACTGGCTCATGTTCGGGTGCCACGCGGAGCGGTGGGCGCTGC

4321  acgtccctcgggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgcc 4380
      TGCAGGGAGCCCGGCATGCGTGGGAGCGGCGGCGCAAGCGGCTGATGGGGCGGTGCGCGG

4381  acaccgtggacccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctca 4440
      TGTGGCACCTGGGCCTGGCGGTGTAGCTCGCCCAGTGGCTCGACGTTCTTGAGAAGGAGT

4441  cgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcgg 4500
      GCGCGCAGCCCGAGCTGTAGCCGTTCCACACCCAGCGCCTGCTGCCGCGGCGCCACCGCC

4501  tctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgca 4560
      AGACCTGGTGCGGCCTCTCGCAGCTTCGCCCCCGCCACAAGCGGCTCTAGCCGGGCGCGT

4561  tggccgagttgagcggttcccggctggccgcgcagcaacagatggaagggctcctggcgc 4620
      ACCGGCTCAACTCGCCAAGGGCCGACCGGCGCGTCGTTGTCTACCTTCCCGAGGACCGCG

4621  cgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccacc 4680
      GCGTGGCCGGGTTCCTCGGGCGCACCAAGGACCGGTGGCAGCCGCAGAGCGGGCTGGTGG

4681  agggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccg 4740
      TCCCGTTCCCAGACCCGTCGCGGCAGCACGAGGGGCCTCACCTCCGCCGGCTCGCGCGGC

4741  gggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcg 4800
      CCCACGGGCGGAAGGACCTCTGGAGGCGCGGGGCGTTGGAGGGGAAGATGCTCGCCGAGC

4801  gcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgaccc 4860
      CGAAGTGGCAGTGGCGGCTGCAGCTCCACGGGCTTCCTGGCGCGTGGACCACGTACTGGG

4861  gcaagcccggtgcctgaacgcgttccggaaatcaacctctggattacaaaatttgtgaaa 4920
      CGTTCGGGCCACGGACTTGCGCAAGGCCTTTAGTTGGAGACCTAATGTTTTAAACACTTT

4921  gattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaa 4980
      CTAACTGACCATAAGAATTGATACAACGAGGAAAATGCGATACACCTATGCGACGAAATT

4981  tgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaat 5040
      ACGGAAACATAGTACGATAACGAAGGGCATACCGAAAGTAAAAGAGGAGGAACATATTTA

5041  cctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgt 5100
      GGACCAACGACAGAGAAATACTCCTCAACACCGGGCAACAGTCCGTTGCACCGCACCACA

5101  gcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcc 5160
      CGTGACACAAACGACTGCGTTGGGGGTGACCAACCCCGTAACGGTGGTGGACAGTCGAGG

5161  tttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgcc 5220
      AAAGGCCCTGAAAGCGAAAGGGGGAGGGATAACGGTGCCGCCTTGAGTAGCGGCGGACGG

5221  ttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcgg 5280
      AACGGGCGACGACCTGTCCCCGAGCCGACAACCCGTGACTGTTAAGGCACCACAACAGCC

5281  ggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcggga 5340
      CCTTCGACTGCAGGAAAGGTACCGACGAGCGGACACAACGGTGGACCTAAGACGCGCCCT

5341  cgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgc 5400
      GCAGGAAGACGATGCAGGGAAGCCGGGAGTTAGGTCGCCTGGAAGGAAGGGCGCCGGACG

5401  tgccggctctgcggcctcttccgcgtctcgccttcgccctcagacgagtcggatctccct 5460
      ACGGCCGAGACGCCGGAGAAGGCGCAGAGCGGAAGCGGGAGTCTGCTCAGCCTAGAGGGA

                                delta_U3 other(5487,5539)>>> 
                                |
5461  ttgggccgcctccccgcctgtccggatggaagggctaattcactcccaacgaatacaaga 5520
      AACCCGGCGGAGGGGCGGACAGGCCTACCTTCCCGATTAAGTGAGGGTTGCTTATGTTCT

                         HIV-1_5_LTR other(5540,5720)>>> 
                         |
5521  tctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctc 5580
      AGACGAAAAACGAACATGACCCAGAGAGACCAATCTGGTCTAGACTCGGACCCTCGAGAG

5581  tggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagt 5640
      ACCGATTGATCCCTTGGGTGACGAATTCGGAGTTATTTCGAACGGAACTCACGAAGTTCA

5641  agtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtc 5700
      TCACACACGGGCAGACAACACACTGAGACCATTGATCTCTAGGGAGTCTGGGAAAATCAG

5701  agtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttataact 5760
      TCACACCTTTTAGAGATCGTCATCATCAAGTACAGTAGAATAATAAGTCATAAATATTGA

5761  tgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagcttataatggtta 5820
      ACGTTTCTTTACTTATAGTCTCTCACTCTCCTTGAACAAATAACGTCGAATATTACCAAT

5821  caaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctag 5880
      GTTTATTTCGTTATCGTAGTGTTTAAAGTGTTTATTTCGTAAAAAAAGTGACGTAAGATC

5881  ttgtggtttgtccaaactcatcaatgtatcttatcatgtctggcatctatgtcgggtgcg 5940
      AACACCAAACAGGTTTGAGTAGTTACATAGAATAGTACAGACCGTAGATACAGCCCACGC

5941  gagaaagaggtaatgaaatggcattatgggtattatgggtctgcattaatgaatcggcca 6000
      CTCTTTCTCCATTACTTTACCGTAATACCCATAATACCCAGACGTAATTACTTAGCCGGT

6001  acgatcccggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgctc 6060
      TGCTAGGGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAG

6061  ttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatc 6120
      AAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAG

6121  agctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaa 6180
      TCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTT

                                                   pBR322 origin(6226,6845)<<< 
                                                   |
6181  catgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtt 6240
      GTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAA

6241  tttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtg 6300
      AAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCAC

6301  gcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcg 6360
      CGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGC

6361  ctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaag 6420
      GAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTC

6421  cgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctc 6480
      GCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGCCACATCCAGCAAGCGAG

6481  caagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaa 6540
      GTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATT

6541  ctatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactgg 6600
      GATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACC

6601  taacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcc 6660
      ATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTCAAGAACTTCACCACCGG

6661  taactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttac 6720
      ATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCGAGACGACTTCGGTCAATG

6721  cttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtgg 6780
      GAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACC

6781  tttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatccttt 6840
      AAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAA

6841  gatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggt 6900
      CTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCA

6901  catgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaa 6960
      GTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTAATTTTTACTTCAAAATT

6961  atcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtga 7020
      TAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAATGGTTACGAATTAGTCACT

7021  ggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgt 7080
      CCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCA

7081  gtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcg 7140
      CATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCACGACGTTACTATGGCGC

7141  agacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccga 7200
      TCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCT

7201  gcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccggga 7260
      CGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGATAATTAACAACGGCCCT

7261  agctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgaaaaaggatcttc 7320
      TCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAACAACTTTTTCCTAGAAG

7321  acctagatccttttcacgtagaaagccagtccgcagaaacggtgctgaccccggatgaat 7380
      TGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTA

7381  gtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagct 7440
      CAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGA

                                                               NEOKAN prom(7498,7547)>>> 
                                                               |
7441  tgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccg 7500
      ACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGC

7501  gaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatg 7560
      CTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGACGTTTCATTTGACCTAC

                                                   BclI 
                                                   |
7561  gctttctcgccgccaaggatctgatggcgcaggggatcaagctctgatcaagagacagga 7620
      CGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCT

                        NTP_II marker(7639,8427)>>> 
                        |
                     ORF_3 rf(1)(7636,8430)>>> 
                     |  |
7621  tgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgg 7680
      ACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACC

7681  gtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgcc 7740
      CACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGG

7741  gtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggt 7800
      CACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCA

7801  gccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgtt 7860
      CGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAA

7861  ccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggc 7920
      GGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCCTGACCGACGATAACCCG

7921  gaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatc 7980
      CTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAG

7981  atggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccac 8040
      TACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCCGATGGACGGGTAAGCTGGTG

8041  caagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcag 8100
      GTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTC

8101  gatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaag 8160
      CTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTC

8161  gcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaat 8220
      CGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGCTACGGACGAACGGCTTA

8221  atcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcg 8280
      TAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACACCGGCCGACCCACACCGC

8281  gaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaa 8340
      CTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAACGACTTCTCGAACCGCCGCTT

8341  tgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgcc 8400
      ACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGG

8401  ttctatcgccttcttgacgagttcttctgaattttgttaaaatttttgttaaatcagctc 8460
      AAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTAAAAACAATTTAGTCGAG

8461  attttttaaccaataggccgaaatcggcaacatcccttataaatcaaaagaatagaccgc 8520
      TAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCG

                    f1 origin(8535,8840)<<< 
                    |
8521  gatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactc 8580
      CTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAG

8581  caacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcacc 8640
      GTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGG

8641  caaatcaagttttttgcggtcgaggtgccgtaaagctctaaatcggaaccctaaagggag 8700
      GTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTC

8701  cccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaa 8760
      GGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTT

8761  agcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccac 8820
      TCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAGTGCGACGCGCATTGGTG

8821  cacacccgcgcgcttaatgcgccgctacagggcgcgtccattcgccattcaggatcgaat 8880
      GTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTA

8881  taattcttaattaacatcatcaataatatacctt 8914
      ATTAAGAATTAATTGTAGTAGTTATTATATGGAA
                                    LOCUS       dna                      8914 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    457..462
                     /dbxref="REBASE:HpaI"
     Other Gene      715..895
                     /gene="HIV-1_5_LTR other"
     Other Gene      1006..1050
                     /gene="HIV-1_psi_pack other"
     misc_binding    1092..1097
                     /dbxref="REBASE:NruI"
     Regulatory_Seq  1557..1790
                     /gene="RRE reg"
     ORF             1600..2301
                     /sequence="ORF_1 rf(1)"
     misc_binding    2611..2616
                     /dbxref="REBASE:NdeI"
     Promoter        2885..2966
                     /gene="CMV prom"
     Regulatory_Seq  3022..3061
                     /gene="tetO reg"
     ORF             3049..4023
                     /sequence="ORF_5 rf(5)"
     Reporter        3082..3798
                     /gene="EGFP reporter"
     ORF             3082..3960
                     /sequence="ORF_2 rf(1)"
     misc_binding    3799..3804
                     /dbxref="REBASE:XmaI"
     misc_binding    3799..3804
                     /dbxref="REBASE:SmaI"
     misc_binding    3829..3834
                     /dbxref="REBASE:KpnI"
     misc_binding    3856..3861
                     /dbxref="REBASE:EcoRI"
     misc_binding    3874..3879
                     /dbxref="REBASE:StuI"
     misc_binding    3886..3891
                     /dbxref="REBASE:EcoRV"
     misc_binding    3892..3897
                     /dbxref="REBASE:ApaI"
     misc_binding    3898..3905
                     /dbxref="REBASE:NotI"
     misc_binding    3907..3912
                     /dbxref="REBASE:BamHI"
     misc_binding    3913..3918
                     /dbxref="REBASE:XbaI"
     misc_binding    3925..3930
                     /dbxref="REBASE:XhoI"
     Promoter        3975..4243
                     /gene="SV40 prom"
     Rep_Origin      4142..4219
                     /gene="SV40 origin"
     ORF             4209..4877
                     /sequence="ORF_4 rf(3)"
     misc_binding    4222..4234
                     /dbxref="REBASE:SfiI"
     Marker          4278..4877
                     /gene="puro marker"
     Other Gene      5487..5539
                     /gene="delta_U3 other"
     Other Gene      5540..5720
                     /gene="HIV-1_5_LTR other"
     Rep_Origin      6226..6845
                     /gene="pBR322 origin"
     Promoter        7498..7547
                     /gene="NEOKAN prom"
     misc_binding    7605..7610
                     /dbxref="REBASE:BclI"
     ORF             7636..8430
                     /sequence="ORF_3 rf(1)"
     Marker          7639..8427
                     /gene="NTP_II marker"
     Rep_Origin      8535..8840
                     /gene="f1 origin"
BASE COUNT    2228 a   2262 c   2420 g   2004 t    0 others