pLenti-III-GFP-N
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepLenti-III-GFP-N
VectorTypeLentiviral vector
Antibiotic InformationPuromycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
SV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag
541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg
601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact
661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct
721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt
781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac
841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc
901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc
961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa
1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg
1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata
1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc
1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga
1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc
1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca
1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag
1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta
1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga
1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg
1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg
1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc
1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg
1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat
1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac
1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat
1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca
2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga
2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg
2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa
2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga
2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag
2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa
2401 aattcaaaat tttcgggttt ttcgaaccta gggttccgcg ttacataact tacggtaaat
2461 ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt
2521 cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa
2581 actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc
2641 aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct
2701 acttggcagt acatctacgt ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt
2761 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg
2821 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca
2881 actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca
2941 gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc
3001 atagaagaac cgagtttaaa ctccctatca gtgatagaga tctccctatc agtgatagag
3061 agctagggcc accatggtga gcaagggcga ggagctgttc accggggtgg tgcccatcct
3121 ggtcgagctg gacggcgacg taaacggcca caagttcagc gtgtccggcg agggcgaggg
3181 cgatgccacc tacggcaagc tgaccctgaa gttcatctgc accaccggca agctgcccgt
3241 gccctggccc accctcgtga ccaccctgac ctacggcgtg cagtgcttca gccgctaccc
3301 cgaccacatg aagcagcacg acttcttcaa gtccgccatg cccgaaggct acgtccagga
3361 gcgcaccatc ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg tgaagttcga
3421 gggcgacacc ctggtgaacc gcatcgagct gaagggcatc gacttcaagg aggacggcaa
3481 catcctgggg cacaagctgg agtacaacta caacagccac aacgtctata tcatggccga
3541 caagcagaag aacggcatca aggtgaactt caagatccgc cacaacatcg aggacggcag
3601 cgtgcagctc gccgaccact accagcagaa cacccccatc ggcgacggcc ccgtgctgct
3661 gcccgacaac cactacctga gcacccagtc cgccctgagc aaagacccca acgagaagcg
3721 cgatcacatg gtcctgctgg agttcgtgac cgccgccggg atcactctcg gcatggacga
3781 gctgtacaag caattgagta cttacgtagg taccccagtg tggtggcctg caggtgaatt
3841 cactagtacc ggtaggcctg tcgacgatat cgggcccgcg gccgctggat cctctagact
3901 gcagctcgag tacccatacg acgtcccaga ctacgcttga gtttaaacac gcgtggtgtg
3961 gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc aattagtcag
4021 caaccaggtg tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa agcatgcatc
4081 tcaattagtc agcaaccata gtcccgcccc taactccgcc catcccgccc ctaactccgc
4141 ccagttccgc ccattctccg ccccatggct gactaatttt ttttatttat gcagaggccg
4201 aggccgcctc ggcctctgag ctattccaga agtagtgagg aggctttttt ggaggccatg
4261 accgagtaca agcccacggt gcgcctcgcc acccgcgacg acgtccctcg ggccgtacgc
4321 accctcgccg ccgcgttcgc cgactacccc gccacgcgcc acaccgtgga cccggaccgc
4381 cacatcgagc gggtcaccga gctgcaagaa ctcttcctca cgcgcgtcgg gctcgacatc
4441 ggcaaggtgt gggtcgcgga cgacggcgcc gcggtggcgg tctggaccac gccggagagc
4501 gtcgaagcgg gggcggtgtt cgccgagatc ggcccgcgca tggccgagtt gagcggttcc
4561 cggctggccg cgcagcaaca gatggaaggg ctcctggcgc cgcaccggcc caaggagccc
4621 gcgtggttcc tggccaccgt cggcgtctcg cccgaccacc agggcaaggg tctgggcagc
4681 gccgtcgtgc tccccggagt ggaggcggcc gagcgcgccg gggtgcccgc cttcctggag
4741 acctccgcgc cccgcaacct ccccttctac gagcggctcg gcttcaccgt caccgccgac
4801 gtcgaggtgc ccgaaggacc gcgcacctgg tgcatgaccc gcaagcccgg tgcctgaacg
4861 cgttccggaa atcaacctct ggattacaaa atttgtgaaa gattgactgg tattcttaac
4921 tatgttgctc cttttacgct atgtggatac gctgctttaa tgcctttgta tcatgctatt
4981 gcttcccgta tggctttcat tttctcctcc ttgtataaat cctggttgct gtctctttat
5041 gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca
5101 acccccactg gttggggcat tgccaccacc tgtcagctcc tttccgggac tttcgctttc
5161 cccctcccta ttgccacggc ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg
5221 gctcggctgt tgggcactga caattccgtg gtgttgtcgg ggaagctgac gtcctttcca
5281 tggctgctcg cctgtgttgc cacctggatt ctgcgcggga cgtccttctg ctacgtccct
5341 tcggccctca atccagcgga ccttccttcc cgcggcctgc tgccggctct gcggcctctt
5401 ccgcgtctcg ccttcgccct cagacgagtc ggatctccct ttgggccgcc tccccgcctg
5461 tccggatgga agggctaatt cactcccaac gaatacaaga tctgcttttt gcttgtactg
5521 ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac
5581 tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt
5641 gtgactctgg taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca
5701 gtagtagttc atgtcatctt attattcagt atttataact tgcaaagaaa tgaatatcag
5761 agagtgagag gaacttgttt attgcagctt ataatggtta caaataaagc aatagcatca
5821 caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg tccaaactca
5881 tcaatgtatc ttatcatgtc tggcatctat gtcgggtgcg gagaaagagg taatgaaatg
5941 gcattatggg tattatgggt ctgcattaat gaatcggcca acgatcccgg tgtgaaatac
6001 cgcacagatg cgtaaggaga aaataccgca tcaggcgctc ttccgcttcc tcgctcactg
6061 actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa
6121 tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc
6181 aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc
6241 ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat
6301 aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc
6361 cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct
6421 cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg
6481 aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc
6541 cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga
6601 ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa
6661 ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta
6721 gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc
6781 agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg
6841 acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga
6901 tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg
6961 agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct
7021 gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg
7081 agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc
7141 cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa
7201 ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc
7261 cagttaatag tttgcgcaac gttgttgaaa aaggatcttc acctagatcc ttttcacgta
7321 gaaagccagt ccgcagaaac ggtgctgacc ccggatgaat gtcagctact gggctatctg
7381 gacaagggaa aacgcaagcg caaagagaaa gcaggtagct tgcagtgggc ttacatggcg
7441 atagctagac tgggcggttt tatggacagc aagcgaaccg gaattgccag ctggggcgcc
7501 ctctggtaag gttgggaagc cctgcaaagt aaactggatg gctttctcgc cgccaaggat
7561 ctgatggcgc aggggatcaa gctctgatca agagacagga tgaggatcgt ttcgcatgat
7621 tgaacaagat ggattgcacg caggttctcc ggccgcttgg gtggagaggc tattcggcta
7681 tgactgggca caacagacaa tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca
7741 ggggcgcccg gttctttttg tcaagaccga cctgtccggt gccctgaatg aactgcaaga
7801 cgaggcagcg cggctatcgt ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga
7861 cgttgtcact gaagcgggaa gggactggct gctattgggc gaagtgccgg ggcaggatct
7921 cctgtcatct caccttgctc ctgccgagaa agtatccatc atggctgatg caatgcggcg
7981 gctgcatacg cttgatccgg ctacctgccc attcgaccac caagcgaaac atcgcatcga
8041 gcgagcacgt actcggatgg aagccggtct tgtcgatcag gatgatctgg acgaagagca
8101 tcaggggctc gcgccagccg aactgttcgc caggctcaag gcgagcatgc ccgacggcga
8161 ggatctcgtc gtgacccatg gcgatgcctg cttgccgaat atcatggtgg aaaatggccg
8221 cttttctgga ttcatcgact gtggccggct gggtgtggcg gaccgctatc aggacatagc
8281 gttggctacc cgtgatattg ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt
8341 gctttacggt atcgccgctc ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga
8401 gttcttctga attttgttaa aatttttgtt aaatcagctc attttttaac caataggccg
8461 aaatcggcaa catcccttat aaatcaaaag aatagaccgc gatagggttg agtgttgttc
8521 cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa
8581 ccgtctatca gggcgatggc ccactacgtg aaccatcacc caaatcaagt tttttgcggt
8641 cgaggtgccg taaagctcta aatcggaacc ctaaagggag cccccgattt agagcttgac
8701 ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta
8761 gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcg cgcttaatgc
8821 gccgctacag ggcgcgtcca ttcgccattc aggatcgaat taattcttaa ttaacatcat
8881 caataatata cctt
                                    LOCUS       dna                      8894 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
Other Gene 715..895
/gene="HIV-1_5_LTR other"
Other Gene 1006..1050
/gene="HIV-1_psi_pack other"
misc_binding 1092..1097
/dbxref="REBASE:NruI"
Regulatory_Seq 1557..1790
/gene="RRE reg"
ORF 1600..2301
/sequence="ORF_1 rf(1)"
misc_binding 2611..2616
/dbxref="REBASE:NdeI"
Promoter 2885..2966
/gene="CMV prom"
ORF 2960..4003
/sequence="ORF_5 rf(5)"
Regulatory_Seq 3022..3061
/gene="tetO reg"
Reporter 3074..3790
/gene="EGFP reporter"
ORF 3074..3940
/sequence="ORF_3 rf(2)"
misc_binding 3809..3814
/dbxref="REBASE:KpnI"
misc_binding 3836..3841
/dbxref="REBASE:EcoRI"
misc_binding 3854..3859
/dbxref="REBASE:StuI"
misc_binding 3866..3871
/dbxref="REBASE:EcoRV"
misc_binding 3872..3877
/dbxref="REBASE:ApaI"
misc_binding 3878..3885
/dbxref="REBASE:NotI"
misc_binding 3887..3892
/dbxref="REBASE:BamHI"
misc_binding 3893..3898
/dbxref="REBASE:XbaI"
misc_binding 3905..3910
/dbxref="REBASE:XhoI"
Promoter 3955..4223
/gene="SV40 prom"
Rep_Origin 4122..4199
/gene="SV40 origin"
ORF 4189..4857
/sequence="ORF_2 rf(1)"
misc_binding 4202..4214
/dbxref="REBASE:SfiI"
Marker 4258..4857
/gene="puro marker"
Other Gene 5467..5519
/gene="delta_U3 other"
Other Gene 5520..5700
/gene="HIV-1_5_LTR other"
Rep_Origin 6206..6825
/gene="pBR322 origin"
Promoter 7478..7527
/gene="NEOKAN prom"
misc_binding 7585..7590
/dbxref="REBASE:BclI"
ORF 7616..8410
/sequence="ORF_4 rf(2)"
Marker 7619..8407
/gene="NTP_II marker"
Rep_Origin 8515..8820
/gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 540
CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541 caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 600
GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601 tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 660
ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

HIV-1_5_LTR other(715,895)>>>
|
661 gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 720
CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721 ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 780
GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781 aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 840
TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841 tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 900
AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901 gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 960
CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

HIV-1_psi_pack other(1006,1050)>>>
|
961 ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 1020
CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021 ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 1080
AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

NruI
|
1081 ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 1140
CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141 aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 1200
TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201 tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 1260
ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261 caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 1320
GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321 aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 1380
TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381 aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 1440
TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441 ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 1500
CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

RRE reg(1557,1790)>>>
|
1501 gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 1560
CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

ORF_1 rf(1)(1600,2301)>>>
|
1561 gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 1620
CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621 ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 1680
GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681 agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 1740
TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741 caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 1800
GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801 ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 1860
CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861 aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 1920
TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921 aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 1980
TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981 gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 2040
CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041 aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 2100
TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101 atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 2160
TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161 tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 2220
AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221 ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 2280
CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281 aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 2340
TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

2341 aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 2400
TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

2401 aattcaaaattttcgggtttttcgaacctagggttccgcgttacataacttacggtaaat 2460
TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCCCAAGGCGCAATGTATTGAATGCCATTTA

2461 ggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgtt 2520
CCGGGCGGACCGACTGGCGGGTTGCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAA

2521 cccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaa 2580
GGGTATCATTGCGGTTATCCCTGAAAGGTAACTGCAGTTACCCACCTCATAAATGCCATT

NdeI
|
2581 actgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtc 2640
TGACGGGTGAACCGTCATGTAGTTCACATAGTATACGGTTCATGCGGGGGATAACTGCAG

2641 aatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcct 2700
TTACTGCCATTTACCGGGCGGACCGTAATACGGGTCATGTACTGGAATACCCTGAAAGGA

2701 acttggcagtacatctacgtttagtcatcgctattaccatggtgatgcggttttggcagt 2760
TGAACCGTCATGTAGATGCAAATCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCA

2761 acatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattg 2820
TGTAGTTACCCGCACCTATCGCCAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAAC

2821 acgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaaca 2880
TGCAGTTACCCTCAAACAAAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGT

CMV prom(2885,2966)>>>
|
2881 actccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagca 2940
TGAGGCGGGGTAACTGCGTTTACCCGCCATCCGCACATGCCACCCTCCAGATATATTCGT

ORF_5 rf(5)(2960,4003)<<<
|
2941 gagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctcc 3000
CTCGAGCAAATCACTTGGCAGTCTAGCGGACCTCTGCGGTAGGTGCGACAAAACTGGAGG

tetO reg(3022,3061)>>>
|
3001 atagaagaaccgagtttaaactccctatcagtgatagagatctccctatcagtgatagag 3060
TATCTTCTTGGCTCAAATTTGAGGGATAGTCACTATCTCTAGAGGGATAGTCACTATCTC

EGFP reporter(3074,3790)>>>
|
ORF_3 rf(2)(3074,3940)>>>
|
3061 agctagGGCCACCatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcct 3120
TCGATCCCGGTGGTACCACTCGTTCCCGCTCCTCGACAAGTGGCCCCACCACGGGTAGGA

3121 ggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgaggg 3180
CCAGCTCGACCTGCCGCTGCATTTGCCGGTGTTCAAGTCGCACAGGCCGCTCCCGCTCCC

3181 cgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgt 3240
GCTACGGTGGATGCCGTTCGACTGGGACTTCAAGTAGACGTGGTGGCCGTTCGACGGGCA

3241 gccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccc 3300
CGGGACCGGGTGGGAGCACTGGTGGGACTGGATGCCGCACGTCACGAAGTCGGCGATGGG

3301 cgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccagga 3360
GCTGGTGTACTTCGTCGTGCTGAAGAAGTTCAGGCGGTACGGGCTTCCGATGCAGGTCCT

3361 gcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcga 3420
CGCGTGGTAGAAGAAGTTCCTGCTGCCGTTGATGTTCTGGGCGCGGCTCCACTTCAAGCT

3421 gggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaa 3480
CCCGCTGTGGGACCACTTGGCGTAGCTCGACTTCCCGTAGCTGAAGTTCCTCCTGCCGTT

3481 catcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccga 3540
GTAGGACCCCGTGTTCGACCTCATGTTGATGTTGTCGGTGTTGCAGATATAGTACCGGCT

3541 caagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcag 3600
GTTCGTCTTCTTGCCGTAGTTCCACTTGAAGTTCTAGGCGGTGTTGTAGCTCCTGCCGTC

3601 cgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgct 3660
GCACGTCGAGCGGCTGGTGATGGTCGTCTTGTGGGGGTAGCCGCTGCCGGGGCACGACGA

3661 gcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcg 3720
CGGGCTGTTGGTGATGGACTCGTGGGTCAGGCGGGACTCGTTTCTGGGGTTGCTCTTCGC

3721 cgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacga 3780
GCTAGTGTACCAGGACGACCTCAAGCACTGGCGGCGGCCCTAGTGAGAGCCGTACCTGCT

KpnI EcoRI
| |
3781 gctgtacaagcaattgagtacttacgtaggtaccccagtgtggtggcctgcaggtgaatt 3840
CGACATGTTCGTTAACTCATGAATGCATCCATGGGGTCACACCACCGGACGTCCACTTAA

NotI
|
StuI EcoRV ApaI BamHI XbaI
| | | | | |
3841 cactagtaccggtaggcctgtcgacgatatcgggcccgcggccgctggatcctctagact 3900
GTGATCATGGCCATCCGGACAGCTGCTATAGCCCGGGCGCCGGCGACCTAGGAGATCTGA

XhoI SV40 prom(3955,4223)>>>
| |
3901 gcagctcgagtacccatacgacgtcccagactacgcttgagtttaaacacgcgtggtgtg 3960
CGTCGAGCTCATGGGTATGCTGCAGGGTCTGATGCGAACTCAAATTTGTGCGCACCACAC

3961 gaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcag 4020
CTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTC

4021 caaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatc 4080
GTTGGTCCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAG

SV40 origin(4122,4199)>>>
|
4081 tcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgc 4140
AGTTAATCAGTCGTTGGTATCAGGGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGCG

ORF_2 rf(1)(4189,4857)>>>
|
4141 ccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccg 4200
GGTCAAGGCGGGTAAGAGGCGGGGTACCGACTGATTAAAAAAAATAAATACGTCTCCGGC

SfiI puro marker(4258,4857)>>>
| |
4201 aggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggccatg 4260
TCCGGCGGAGCCGGAGACTCGATAAGGTCTTCATCACTCCTCCGAAAAAACCTCCGGTAC

4261 accgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccctcgggccgtacgc 4320
TGGCTCATGTTCGGGTGCCACGCGGAGCGGTGGGCGCTGCTGCAGGGAGCCCGGCATGCG

4321 accctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtggacccggaccgc 4380
TGGGAGCGGCGGCGCAAGCGGCTGATGGGGCGGTGCGCGGTGTGGCACCTGGGCCTGGCG

4381 cacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatc 4440
GTGTAGCTCGCCCAGTGGCTCGACGTTCTTGAGAAGGAGTGCGCGCAGCCCGAGCTGTAG

4441 ggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagc 4500
CCGTTCCACACCCAGCGCCTGCTGCCGCGGCGCCACCGCCAGACCTGGTGCGGCCTCTCG

4501 gtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcc 4560
CAGCTTCGCCCCCGCCACAAGCGGCTCTAGCCGGGCGCGTACCGGCTCAACTCGCCAAGG

4561 cggctggccgcgcagcaacagatggaagggctcctggcgccgcaccggcccaaggagccc 4620
GCCGACCGGCGCGTCGTTGTCTACCTTCCCGAGGACCGCGGCGTGGCCGGGTTCCTCGGG

4621 gcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagc 4680
CGCACCAAGGACCGGTGGCAGCCGCAGAGCGGGCTGGTGGTCCCGTTCCCAGACCCGTCG

4681 gccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggag 4740
CGGCAGCACGAGGGGCCTCACCTCCGCCGGCTCGCGCGGCCCCACGGGCGGAAGGACCTC

4741 acctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgac 4800
TGGAGGCGCGGGGCGTTGGAGGGGAAGATGCTCGCCGAGCCGAAGTGGCAGTGGCGGCTG

4801 gtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaacg 4860
CAGCTCCACGGGCTTCCTGGCGCGTGGACCACGTACTGGGCGTTCGGGCCACGGACTTGC

4861 cgttccggaaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaac 4920
GCAAGGCCTTTAGTTGGAGACCTAATGTTTTAAACACTTTCTAACTGACCATAAGAATTG

4921 tatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctatt 4980
ATACAACGAGGAAAATGCGATACACCTATGCGACGAAATTACGGAAACATAGTACGATAA

4981 gcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttat 5040
CGAAGGGCATACCGAAAGTAAAAGAGGAGGAACATATTTAGGACCAACGACAGAGAAATA

5041 gaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgca 5100
CTCCTCAACACCGGGCAACAGTCCGTTGCACCGCACCACACGTGACACAAACGACTGCGT

5101 acccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttc 5160
TGGGGGTGACCAACCCCGTAACGGTGGTGGACAGTCGAGGAAAGGCCCTGAAAGCGAAAG

5161 cccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggg 5220
GGGGAGGGATAACGGTGCCGCCTTGAGTAGCGGCGGACGGAACGGGCGACGACCTGTCCC

5221 gctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttcca 5280
CGAGCCGACAACCCGTGACTGTTAAGGCACCACAACAGCCCCTTCGACTGCAGGAAAGGT

5281 tggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtccct 5340
ACCGACGAGCGGACACAACGGTGGACCTAAGACGCGCCCTGCAGGAAGACGATGCAGGGA

5341 tcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctctt 5400
AGCCGGGAGTTAGGTCGCCTGGAAGGAAGGGCGCCGGACGACGGCCGAGACGCCGGAGAA

5401 ccgcgtctcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcctg 5460
GGCGCAGAGCGGAAGCGGGAGTCTGCTCAGCCTAGAGGGAAACCCGGCGGAGGGGCGGAC

delta_U3 other(5467,5519)>>>
|
5461 tccggatggaagggctaattcactcccaacgaatacaagatctgctttttgcttgtactg 5520
AGGCCTACCTTCCCGATTAAGTGAGGGTTGCTTATGTTCTAGACGAAAAACGAACATGAC

HIV-1_5_LTR other(5520,5700)>>>
|
5521 ggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccac 5580
CCAGAGAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTG

5581 tgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgt 5640
ACGAATTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACA

5641 gtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagca 5700
CACTGAGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGT

5701 gtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcag 5760
CATCATCAAGTACAGTAGAATAATAAGTCATAAATATTGAACGTTTCTTTACTTATAGTC

5761 agagtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatca 5820
TCTCACTCTCCTTGAACAAATAACGTCGAATATTACCAATGTTTATTTCGTTATCGTAGT

5821 caaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactca 5880
GTTTAAAGTGTTTATTTCGTAAAAAAAGTGACGTAAGATCAACACCAAACAGGTTTGAGT

5881 tcaatgtatcttatcatgtctggcatctatgtcgggtgcggagaaagaggtaatgaaatg 5940
AGTTACATAGAATAGTACAGACCGTAGATACAGCCCACGCCTCTTTCTCCATTACTTTAC

5941 gcattatgggtattatgggtctgcattaatgaatcggccaacgatcccggtgtgaaatac 6000
CGTAATACCCATAATACCCAGACGTAATTACTTAGCCGGTTGCTAGGGCCACACTTTATG

6001 cgcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactg 6060
GCGTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGAC

6061 actcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaa 6120
TGAGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATT

6121 tacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagc 6180
ATGCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCG

pBR322 origin(6206,6825)<<<
|
6181 aaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgccccc 6240
TTTTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGG

6241 ctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactat 6300
GACTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATA

6301 aaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgc 6360
TTTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACG

6361 cgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagct 6420
GCGAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGA

6421 cacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacg 6480
GTGCGACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGC

6481 aaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacc 6540
TTGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGG

6541 cggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcga 6600
GCCATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCT

6601 ggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaa 6660
CCATACATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTT

6661 ggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggta 6720
CCTGTCATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCAT

6721 gctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagc 6780
CGAGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCG

6781 agattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctg 6840
TCTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGAC

6841 acgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaagga 6900
TGCGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCT

6901 tcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatg 6960
AGAAGTGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATAC

6961 agtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatct 7020
TCATTTGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGA

7021 gtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacggg 7080
CAGATAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCC

7081 agggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctc 7140
TCCCGAATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAG

7141 cagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaa 7200
GTCTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTT

7201 ctttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgc 7260
GAAATAGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCG

7261 cagttaatagtttgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgta 7320
GTCAATTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCAT

7321 gaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctg 7380
CTTTCGGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGAC

7381 gacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcg 7440
CTGTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGC

NEOKAN prom(7478,7527)>>>
|
7441 atagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgcc 7500
TATCGATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGG

7501 ctctggtaaggttgggaagccctgcaaagtaaactggatggctttctcgccgccaaggat 7560
GAGACCATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTA

NTP_II marker(7619,8407)>>>
|
BclI ORF_4 rf(2)(7616,8410)>>>
| | |
7561 ctgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgat 7620
GACTACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTA

7621 tgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggcta 7680
ACTTGTTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGAT

7681 tgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgca 7740
ACTGACCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGT

7741 ggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaaga 7800
CCCCGCGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCT

7801 cgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcga 7860
GCTCCGTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCT

7861 cgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatct 7920
GCAACAGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGA

7921 cctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcg 7980
GGACAGTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGC

7981 gctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcga 8040
CGACGTATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCT

8041 gcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagca 8100
CGCTCGTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGT

8101 tcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcga 8160
AGTCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCT

8161 ggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccg 8220
CCTAGAGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGC

8221 cttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagc 8280
GAAAAGACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCG

8281 gttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgt 8340
CAACCGATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCA

8341 gctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacga 8400
CGAAATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCT

8401 gttcttctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggccg 8460
CAAGAAGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGC

f1 origin(8515,8820)<<<
|
8461 aaatcggcaacatcccttataaatcaaaagaatagaccgcgatagggttgagtgttgttc 8520
TTTAGCCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAG

8521 cagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaa 8580
GTCAAACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTT

8581 ccgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcggt 8640
GGCAGATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCA

8641 cgaggtgccgtaaagctctaaatcggaaccctaaagggagcccccgatttagagcttgac 8700
GCTCCACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTG

8701 ggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgcta 8760
CCCCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGAT

8761 gggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgc 8820
CCCGCGACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACG

8821 gccgctacagggcgcgtccattcgccattcaggatcgaattaattcttaattaacatcat 8880
CGGCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTA

8881 caataatatacctt 8894
GTTATTATATGGAA