pLenti-III-RFP-N
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepLenti-III-RFP-N
VectorTypePlasmid
Antibiotic InformationPuromycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
SV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag
541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg
601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact
661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct
721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt
781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac
841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc
901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc
961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa
1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg
1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata
1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc
1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga
1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc
1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca
1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag
1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta
1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga
1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg
1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg
1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc
1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg
1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat
1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac
1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat
1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca
2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga
2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg
2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa
2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga
2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag
2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa
2401 aattcaaaat tttcgggttt ttcgaaccta gggttccgcg ttacataact tacggtaaat
2461 ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt
2521 cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa
2581 actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc
2641 aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct
2701 acttggcagt acatctacgt ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt
2761 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg
2821 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca
2881 actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca
2941 gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc
3001 atagaagaac cgagtttaaa ctccctatca gtgatagaga tctccctatc agtgatagag
3061 agctaggtat ataacgccac catggtgagc gagctgatta aggagaacat gcacatgaag
3121 ctgtacatgg agggcaccgt gaacaaccac cacttcaagt gcacatccga gggcgaaggc
3181 aagccctacg agggcaccca gaccatgaga atcaaggcgg tcgagggcgg ccctctcccc
3241 ttcgccttcg acatcctggc taccagcttc atgtacggca gcaaaacctt catcaaccac
3301 acccagggca tccccgactt ctttaagcag tccttccccg agggcttcac atgggagaga
3361 gtcaccacat acgaagacgg gggcgtgctg accgctaccc aggacaccag cctccaggac
3421 ggctgcctca tctacaacgt caagatcaga ggggtgaact tcccatccaa cggccctgtg
3481 atgcagaaga aaacactcgg ctgggaggcc tccaccgaga ccctgtaccc cgctgacggc
3541 ggcctggaag gcagagccga catggccctg aagctcgtgg gcgggggcca cctgatctgc
3601 aacttgaaga ccacatacag atccaagaaa cccgctaaga acctcaagat gcccggcgtc
3661 tactatgtgg acagaagact ggaaagaatc aaggaggccg acaaagagac ctacgtcgag
3721 cagcacgagg tggctgtggc cagatactgc gacctcccta gcaaactggg gcacagaccc
3781 ggggctagcc aattgagtac ttacgtaggt accccagtgt ggtggcctgc aggtgaattc
3841 actagtaccg gtaggcctgt cgacgatatc gggcccgcgg ccgctggatc ctctagactg
3901 cagctcgagt acccatacga cgtcccagac tacgcttgag tttaaacacg cgtggtgtgg
3961 aaagtcccca ggctccccag caggcagaag tatgcaaagc atgcatctca attagtcagc
4021 aaccaggtgt ggaaagtccc caggctcccc agcaggcaga agtatgcaaa gcatgcatct
4081 caattagtca gcaaccatag tcccgcccct aactccgccc atcccgcccc taactccgcc
4141 cagttccgcc cattctccgc cccatggctg actaattttt tttatttatg cagaggccga
4201 ggccgcctcg gcctctgagc tattccagaa gtagtgagga ggcttttttg gaggccatga
4261 ccgagtacaa gcccacggtg cgcctcgcca cccgcgacga cgtccctcgg gccgtacgca
4321 ccctcgccgc cgcgttcgcc gactaccccg ccacgcgcca caccgtggac ccggaccgcc
4381 acatcgagcg ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg
4441 gcaaggtgtg ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg
4501 tcgaagcggg ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc
4561 ggctggccgc gcagcaacag atggaagggc tcctggcgcc gcaccggccc aaggagcccg
4621 cgtggttcct ggccaccgtc ggcgtctcgc ccgaccacca gggcaagggt ctgggcagcg
4681 ccgtcgtgct ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga
4741 cctccgcgcc ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg
4801 tcgaggtgcc cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc
4861 gttccggaaa tcaacctctg gattacaaaa tttgtgaaag attgactggt attcttaact
4921 atgttgctcc ttttacgcta tgtggatacg ctgctttaat gcctttgtat catgctattg
4981 cttcccgtat ggctttcatt ttctcctcct tgtataaatc ctggttgctg tctctttatg
5041 aggagttgtg gcccgttgtc aggcaacgtg gcgtggtgtg cactgtgttt gctgacgcaa
5101 cccccactgg ttggggcatt gccaccacct gtcagctcct ttccgggact ttcgctttcc
5161 ccctccctat tgccacggcg gaactcatcg ccgcctgcct tgcccgctgc tggacagggg
5221 ctcggctgtt gggcactgac aattccgtgg tgttgtcggg gaagctgacg tcctttccat
5281 ggctgctcgc ctgtgttgcc acctggattc tgcgcgggac gtccttctgc tacgtccctt
5341 cggccctcaa tccagcggac cttccttccc gcggcctgct gccggctctg cggcctcttc
5401 cgcgtctcgc cttcgccctc agacgagtcg gatctccctt tgggccgcct ccccgcctgt
5461 ccggatggaa gggctaattc actcccaacg aatacaagat ctgctttttg cttgtactgg
5521 gtctctctgg ttagaccaga tctgagcctg ggagctctct ggctaactag ggaacccact
5581 gcttaagcct caataaagct tgccttgagt gcttcaagta gtgtgtgccc gtctgttgtg
5641 tgactctggt aactagagat ccctcagacc cttttagtca gtgtggaaaa tctctagcag
5701 tagtagttca tgtcatctta ttattcagta tttataactt gcaaagaaat gaatatcaga
5761 gagtgagagg aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac
5821 aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat
5881 caatgtatct tatcatgtct ggcatctatg tcgggtgcgg agaaagaggt aatgaaatgg
5941 cattatgggt attatgggtc tgcattaatg aatcggccaa cgatcccggt gtgaaatacc
6001 gcacagatgc gtaaggagaa aataccgcat caggcgctct tccgcttcct cgctcactga
6061 ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat
6121 acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca
6181 aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc
6241 tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata
6301 aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc
6361 gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc
6421 acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga
6481 accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc
6541 ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag
6601 gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag
6661 gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag
6721 ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca
6781 gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga
6841 cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat
6901 cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga
6961 gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg
7021 tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga
7081 gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc
7141 agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac
7201 tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc
7261 agttaatagt ttgcgcaacg ttgttgaaaa aggatcttca cctagatcct tttcacgtag
7321 aaagccagtc cgcagaaacg gtgctgaccc cggatgaatg tcagctactg ggctatctgg
7381 acaagggaaa acgcaagcgc aaagagaaag caggtagctt gcagtgggct tacatggcga
7441 tagctagact gggcggtttt atggacagca agcgaaccgg aattgccagc tggggcgccc
7501 tctggtaagg ttgggaagcc ctgcaaagta aactggatgg ctttctcgcc gccaaggatc
7561 tgatggcgca ggggatcaag ctctgatcaa gagacaggat gaggatcgtt tcgcatgatt
7621 gaacaagatg gattgcacgc aggttctccg gccgcttggg tggagaggct attcggctat
7681 gactgggcac aacagacaat cggctgctct gatgccgccg tgttccggct gtcagcgcag
7741 gggcgcccgg ttctttttgt caagaccgac ctgtccggtg ccctgaatga actgcaagac
7801 gaggcagcgc ggctatcgtg gctggccacg acgggcgttc cttgcgcagc tgtgctcgac
7861 gttgtcactg aagcgggaag ggactggctg ctattgggcg aagtgccggg gcaggatctc
7921 ctgtcatctc accttgctcc tgccgagaaa gtatccatca tggctgatgc aatgcggcgg
7981 ctgcatacgc ttgatccggc tacctgccca ttcgaccacc aagcgaaaca tcgcatcgag
8041 cgagcacgta ctcggatgga agccggtctt gtcgatcagg atgatctgga cgaagagcat
8101 caggggctcg cgccagccga actgttcgcc aggctcaagg cgagcatgcc cgacggcgag
8161 gatctcgtcg tgacccatgg cgatgcctgc ttgccgaata tcatggtgga aaatggccgc
8221 ttttctggat tcatcgactg tggccggctg ggtgtggcgg accgctatca ggacatagcg
8281 ttggctaccc gtgatattgc tgaagagctt ggcggcgaat gggctgaccg cttcctcgtg
8341 ctttacggta tcgccgctcc cgattcgcag cgcatcgcct tctatcgcct tcttgacgag
8401 ttcttctgaa ttttgttaaa atttttgtta aatcagctca ttttttaacc aataggccga
8461 aatcggcaac atcccttata aatcaaaaga atagaccgcg atagggttga gtgttgttcc
8521 agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag ggcgaaaaac
8581 cgtctatcag ggcgatggcc cactacgtga accatcaccc aaatcaagtt ttttgcggtc
8641 gaggtgccgt aaagctctaa atcggaaccc taaagggagc ccccgattta gagcttgacg
8701 gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag cgggcgctag
8761 ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgcgc gcttaatgcg
8821 ccgctacagg gcgcgtccat tcgccattca ggatcgaatt aattcttaat taacatcatc
8881 aataatatac ctt
                                    LOCUS       dna                      8893 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
Other Gene 715..895
/gene="HIV-1_5_LTR other"
Other Gene 1006..1050
/gene="HIV-1_psi_pack other"
misc_binding 1092..1097
/dbxref="REBASE:NruI"
Regulatory_Seq 1557..1790
/gene="RRE reg"
ORF 1600..2301
/sequence="ORF_1 rf(1)"
misc_binding 2611..2616
/dbxref="REBASE:NdeI"
Promoter 2885..2966
/gene="CMV prom"
Regulatory_Seq 3022..3061
/gene="tetO reg"
ORF 3049..4002
/sequence="ORF_5 rf(5)"
ORF 3082..3939
/sequence="ORF_2 rf(1)"
misc_binding 3778..3783
/dbxref="REBASE:SmaI"
misc_binding 3778..3783
/dbxref="REBASE:XmaI"
misc_binding 3808..3813
/dbxref="REBASE:KpnI"
misc_binding 3835..3840
/dbxref="REBASE:EcoRI"
misc_binding 3865..3870
/dbxref="REBASE:EcoRV"
misc_binding 3871..3876
/dbxref="REBASE:ApaI"
misc_binding 3877..3884
/dbxref="REBASE:NotI"
misc_binding 3886..3891
/dbxref="REBASE:BamHI"
misc_binding 3892..3897
/dbxref="REBASE:XbaI"
misc_binding 3904..3909
/dbxref="REBASE:XhoI"
Promoter 3954..4222
/gene="SV40 prom"
Rep_Origin 4121..4198
/gene="SV40 origin"
ORF 4188..4856
/sequence="ORF_4 rf(3)"
misc_binding 4201..4213
/dbxref="REBASE:SfiI"
Marker 4257..4856
/gene="puro marker"
Other Gene 5466..5518
/gene="delta_U3 other"
Other Gene 5519..5699
/gene="HIV-1_5_LTR other"
Rep_Origin 6205..6824
/gene="pBR322 origin"
Promoter 7477..7526
/gene="NEOKAN prom"
misc_binding 7584..7589
/dbxref="REBASE:BclI"
ORF 7615..8409
/sequence="ORF_3 rf(1)"
Marker 7618..8406
/gene="NTP_II marker"
Rep_Origin 8514..8819
/gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 540
CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541 caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 600
GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601 tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 660
ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

HIV-1_5_LTR other(715,895)>>>
|
661 gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 720
CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721 ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 780
GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781 aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 840
TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841 tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 900
AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901 gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 960
CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

HIV-1_psi_pack other(1006,1050)>>>
|
961 ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 1020
CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021 ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 1080
AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

NruI
|
1081 ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 1140
CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141 aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 1200
TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201 tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 1260
ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261 caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 1320
GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321 aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 1380
TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381 aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 1440
TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441 ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 1500
CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

RRE reg(1557,1790)>>>
|
1501 gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 1560
CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

ORF_1 rf(1)(1600,2301)>>>
|
1561 gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 1620
CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621 ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 1680
GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681 agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 1740
TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741 caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 1800
GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801 ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 1860
CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861 aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 1920
TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921 aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 1980
TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981 gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 2040
CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041 aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 2100
TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101 atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 2160
TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161 tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 2220
AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221 ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 2280
CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281 aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 2340
TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

2341 aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 2400
TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

2401 aattcaaaattttcgggtttttcgaacctagggttccgcgttacataacttacggtaaat 2460
TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCCCAAGGCGCAATGTATTGAATGCCATTTA

2461 ggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgtt 2520
CCGGGCGGACCGACTGGCGGGTTGCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAA

2521 cccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaa 2580
GGGTATCATTGCGGTTATCCCTGAAAGGTAACTGCAGTTACCCACCTCATAAATGCCATT

NdeI
|
2581 actgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtc 2640
TGACGGGTGAACCGTCATGTAGTTCACATAGTATACGGTTCATGCGGGGGATAACTGCAG

2641 aatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcct 2700
TTACTGCCATTTACCGGGCGGACCGTAATACGGGTCATGTACTGGAATACCCTGAAAGGA

2701 acttggcagtacatctacgtttagtcatcgctattaccatggtgatgcggttttggcagt 2760
TGAACCGTCATGTAGATGCAAATCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCA

2761 acatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattg 2820
TGTAGTTACCCGCACCTATCGCCAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAAC

2821 acgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaaca 2880
TGCAGTTACCCTCAAACAAAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGT

CMV prom(2885,2966)>>>
|
2881 actccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagca 2940
TGAGGCGGGGTAACTGCGTTTACCCGCCATCCGCACATGCCACCCTCCAGATATATTCGT

2941 gagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctcc 3000
CTCGAGCAAATCACTTGGCAGTCTAGCGGACCTCTGCGGTAGGTGCGACAAAACTGGAGG

tetO reg(3022,3061)>>> ORF_5 rf(5)(3049,4002)<<<
| |
3001 atagaagaaccgagtttaaactccctatcagtgatagagatctccctatcagtgatagag 3060
TATCTTCTTGGCTCAAATTTGAGGGATAGTCACTATCTCTAGAGGGATAGTCACTATCTC

ORF_2 rf(1)(3082,3939)>>>
|
3061 agctaggtatataacgccaccatggtgagcgagctgattaaggagaacatgcacatgaag 3120
TCGATCCATATATTGCGGTGGTACCACTCGCTCGACTAATTCCTCTTGTACGTGTACTTC

3121 ctgtacatggagggcaccgtgaacaaccaccacttcaagtgcacatccgagggcgaaggc 3180
GACATGTACCTCCCGTGGCACTTGTTGGTGGTGAAGTTCACGTGTAGGCTCCCGCTTCCG

3181 aagccctacgagggcacccagaccatgagaatcaaggcggtcgagggcggccctctcccc 3240
TTCGGGATGCTCCCGTGGGTCTGGTACTCTTAGTTCCGCCAGCTCCCGCCGGGAGAGGGG

3241 ttcgccttcgacatcctggctaccagcttcatgtacggcagcaaaaccttcatcaaccac 3300
AAGCGGAAGCTGTAGGACCGATGGTCGAAGTACATGCCGTCGTTTTGGAAGTAGTTGGTG

3301 acccagggcatccccgacttctttaagcagtccttccccgagggcttcacatgggagaga 3360
TGGGTCCCGTAGGGGCTGAAGAAATTCGTCAGGAAGGGGCTCCCGAAGTGTACCCTCTCT

3361 gtcaccacatacgaagacgggggcgtgctgaccgctacccaggacaccagcctccaggac 3420
CAGTGGTGTATGCTTCTGCCCCCGCACGACTGGCGATGGGTCCTGTGGTCGGAGGTCCTG

3421 ggctgcctcatctacaacgtcaagatcagaggggtgaacttcccatccaacggccctgtg 3480
CCGACGGAGTAGATGTTGCAGTTCTAGTCTCCCCACTTGAAGGGTAGGTTGCCGGGACAC

3481 atgcagaagaaaacactcggctgggaggcctccaccgagaccctgtaccccgctgacggc 3540
TACGTCTTCTTTTGTGAGCCGACCCTCCGGAGGTGGCTCTGGGACATGGGGCGACTGCCG

3541 ggcctggaaggcagagccgacatggccctgaagctcgtgggcgggggccacctgatctgc 3600
CCGGACCTTCCGTCTCGGCTGTACCGGGACTTCGAGCACCCGCCCCCGGTGGACTAGACG

3601 aacttgaagaccacatacagatccaagaaacccgctaagaacctcaagatgcccggcgtc 3660
TTGAACTTCTGGTGTATGTCTAGGTTCTTTGGGCGATTCTTGGAGTTCTACGGGCCGCAG

3661 tactatgtggacagaagactggaaagaatcaaggaggccgacaaagagacctacgtcgag 3720
ATGATACACCTGTCTTCTGACCTTTCTTAGTTCCTCCGGCTGTTTCTCTGGATGCAGCTC

XmaI
|
3721 cagcacgaggtggctgtggccagatactgcgacctccctagcaaactggggcacagaccc 3780
GTCGTGCTCCACCGACACCGGTCTATGACGCTGGAGGGATCGTTTGACCCCGTGTCTGGG

SmaI KpnI EcoRI
| | |
3781 ggggctagccaattgagtacttacgtaggtaccccagtgtggtggcctgcaggtgaattc 3840
CCCCGATCGGTTAACTCATGAATGCATCCATGGGGTCACACCACCGGACGTCCACTTAAG

NotI
|
EcoRV ApaI BamHI XbaI
| | | | |
3841 actagtaccggtaggcctgtcgacgatatcgggcccgcggccgctggatcctctagactg 3900
TGATCATGGCCATCCGGACAGCTGCTATAGCCCGGGCGCCGGCGACCTAGGAGATCTGAC

XhoI SV40 prom(3954,4222)>>>
| |
3901 cagctcgagtacccatacgacgtcccagactacgcttgagtttaaacacgcgtggtgtgg 3960
GTCGAGCTCATGGGTATGCTGCAGGGTCTGATGCGAACTCAAATTTGTGCGCACCACACC

3961 aaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagc 4020
TTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCG

4021 aaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatct 4080
TTGGTCCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGA

SV40 origin(4121,4198)>>>
|
4081 caattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcc 4140
GTTAATCAGTCGTTGGTATCAGGGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGCGG

ORF_4 rf(3)(4188,4856)>>>
|
4141 cagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccga 4200
GTCAAGGCGGGTAAGAGGCGGGGTACCGACTGATTAAAAAAAATAAATACGTCTCCGGCT

SfiI puro marker(4257,4856)>>>
| |
4201 ggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggccatga 4260
CCGGCGGAGCCGGAGACTCGATAAGGTCTTCATCACTCCTCCGAAAAAACCTCCGGTACT

4261 ccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccctcgggccgtacgca 4320
GGCTCATGTTCGGGTGCCACGCGGAGCGGTGGGCGCTGCTGCAGGGAGCCCGGCATGCGT

4321 ccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtggacccggaccgcc 4380
GGGAGCGGCGGCGCAAGCGGCTGATGGGGCGGTGCGCGGTGTGGCACCTGGGCCTGGCGG

4381 acatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcg 4440
TGTAGCTCGCCCAGTGGCTCGACGTTCTTGAGAAGGAGTGCGCGCAGCCCGAGCTGTAGC

4441 gcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcg 4500
CGTTCCACACCCAGCGCCTGCTGCCGCGGCGCCACCGCCAGACCTGGTGCGGCCTCTCGC

4501 tcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttccc 4560
AGCTTCGCCCCCGCCACAAGCGGCTCTAGCCGGGCGCGTACCGGCTCAACTCGCCAAGGG

4561 ggctggccgcgcagcaacagatggaagggctcctggcgccgcaccggcccaaggagcccg 4620
CCGACCGGCGCGTCGTTGTCTACCTTCCCGAGGACCGCGGCGTGGCCGGGTTCCTCGGGC

4621 cgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcg 4680
GCACCAAGGACCGGTGGCAGCCGCAGAGCGGGCTGGTGGTCCCGTTCCCAGACCCGTCGC

4681 ccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggaga 4740
GGCAGCACGAGGGGCCTCACCTCCGCCGGCTCGCGCGGCCCCACGGGCGGAAGGACCTCT

4741 cctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacg 4800
GGAGGCGCGGGGCGTTGGAGGGGAAGATGCTCGCCGAGCCGAAGTGGCAGTGGCGGCTGC

4801 tcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaacgc 4860
AGCTCCACGGGCTTCCTGGCGCGTGGACCACGTACTGGGCGTTCGGGCCACGGACTTGCG

4861 gttccggaaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaact 4920
CAAGGCCTTTAGTTGGAGACCTAATGTTTTAAACACTTTCTAACTGACCATAAGAATTGA

4921 atgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattg 4980
TACAACGAGGAAAATGCGATACACCTATGCGACGAAATTACGGAAACATAGTACGATAAC

4981 cttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatg 5040
GAAGGGCATACCGAAAGTAAAAGAGGAGGAACATATTTAGGACCAACGACAGAGAAATAC

5041 aggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaa 5100
TCCTCAACACCGGGCAACAGTCCGTTGCACCGCACCACACGTGACACAAACGACTGCGTT

5101 cccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttcc 5160
GGGGGTGACCAACCCCGTAACGGTGGTGGACAGTCGAGGAAAGGCCCTGAAAGCGAAAGG

5161 ccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacagggg 5220
GGGAGGGATAACGGTGCCGCCTTGAGTAGCGGCGGACGGAACGGGCGACGACCTGTCCCC

5221 ctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccat 5280
GAGCCGACAACCCGTGACTGTTAAGGCACCACAACAGCCCCTTCGACTGCAGGAAAGGTA

5281 ggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtccctt 5340
CCGACGAGCGGACACAACGGTGGACCTAAGACGCGCCCTGCAGGAAGACGATGCAGGGAA

5341 cggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttc 5400
GCCGGGAGTTAGGTCGCCTGGAAGGAAGGGCGCCGGACGACGGCCGAGACGCCGGAGAAG

5401 cgcgtctcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcctgt 5460
GCGCAGAGCGGAAGCGGGAGTCTGCTCAGCCTAGAGGGAAACCCGGCGGAGGGGCGGACA

delta_U3 other(5466,5518)>>> HIV-1_5_LTR other(5519,5699)>>>
| |
5461 ccggatggaagggctaattcactcccaacgaatacaagatctgctttttgcttgtactgg 5520
GGCCTACCTTCCCGATTAAGTGAGGGTTGCTTATGTTCTAGACGAAAAACGAACATGACC

5521 gtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccact 5580
CAGAGAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGA

5581 gcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtg 5640
CGAATTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACAC

5641 tgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcag 5700
ACTGAGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTC

5701 tagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcaga 5760
ATCATCAAGTACAGTAGAATAATAAGTCATAAATATTGAACGTTTCTTTACTTATAGTCT

5761 gagtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcac 5820
CTCACTCTCCTTGAACAAATAACGTCGAATATTACCAATGTTTATTTCGTTATCGTAGTG

5821 aaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcat 5880
TTTAAAGTGTTTATTTCGTAAAAAAAGTGACGTAAGATCAACACCAAACAGGTTTGAGTA

5881 caatgtatcttatcatgtctggcatctatgtcgggtgcggagaaagaggtaatgaaatgg 5940
GTTACATAGAATAGTACAGACCGTAGATACAGCCCACGCCTCTTTCTCCATTACTTTACC

5941 cattatgggtattatgggtctgcattaatgaatcggccaacgatcccggtgtgaaatacc 6000
GTAATACCCATAATACCCAGACGTAATTACTTAGCCGGTTGCTAGGGCCACACTTTATGG

6001 gcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactga 6060
CGTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACT

6061 ctcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaat 6120
GAGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTA

6121 acggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagca 6180
TGCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGT

pBR322 origin(6205,6824)<<<
|
6181 aaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccc 6240
TTTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGG

6241 tgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactata 6300
ACTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATAT

6301 aagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgcc 6360
TTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGG

6361 gcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctc 6420
CGAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAG

6421 acgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacga 6480
TGCGACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCT

6481 accccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaaccc 6540
TGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGG

6541 ggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgag 6600
CCATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTC

6601 gtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaag 6660
CATACATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTC

6661 gacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtag 6720
CTGTCATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATC

6721 ctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagca 6780
GAGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGT

6781 gattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctga 6840
CTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACT

6841 cgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggat 6900
GCGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTA

6901 cttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatga 6960
GAAGTGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACT

6961 gtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctg 7020
CATTTGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGAC

7021 tctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacggga 7080
AGATAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCT

7081 gggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctcc 7140
CCCGAATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGG

7141 agatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaac 7200
TCTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTG

7201 tttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgcc 7260
AAATAGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGG

7261 agttaatagtttgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgtag 7320
TCAATTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATC

7321 aaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctgg 7380
TTTCGGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACC

7381 acaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcga 7440
TGTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCT

NEOKAN prom(7477,7526)>>>
|
7441 tagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccc 7500
ATCGATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGG

7501 tctggtaaggttgggaagccctgcaaagtaaactggatggctttctcgccgccaaggatc 7560
AGACCATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAG

NTP_II marker(7618,8406)>>>
|
BclI ORF_3 rf(1)(7615,8409)>>>
| | |
7561 tgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgatt 7620
ACTACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAA

7621 gaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctat 7680
CTTGTTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATA

7681 gactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcag 7740
CTGACCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTC

7741 gggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagac 7800
CCCGCGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTG

7801 gaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgac 7860
CTCCGTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTG

7861 gttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctc 7920
CAACAGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAG

7921 ctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcgg 7980
GACAGTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCC

7981 ctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgag 8040
GACGTATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTC

8041 cgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcat 8100
GCTCGTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTA

8101 caggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgag 8160
GTCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTC

8161 gatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgc 8220
CTAGAGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCG

8221 ttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcg 8280
AAAAGACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGC

8281 ttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtg 8340
AACCGATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCAC

8341 ctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgag 8400
GAAATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTC

8401 ttcttctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggccga 8460
AAGAAGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCT

f1 origin(8514,8819)<<<
|
8461 aatcggcaacatcccttataaatcaaaagaatagaccgcgatagggttgagtgttgttcc 8520
TTAGCCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGG

8521 agtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaac 8580
TCAAACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTG

8581 cgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcggtc 8640
GCAGATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAG

8641 gaggtgccgtaaagctctaaatcggaaccctaaagggagcccccgatttagagcttgacg 8700
CTCCACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGC

8701 gggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctag 8760
CCCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATC

8761 ggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcg 8820
CCGCGACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGC

8821 ccgctacagggcgcgtccattcgccattcaggatcgaattaattcttaattaacatcatc 8880
GGCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAG

8881 aataatatacctt 8893
TTATTATATGGAA