pORF
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepORF
Antibiotic InformationBacterial: Spectinomycin
Sequencing PrimersM13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga     
61 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga
121 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca
181 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc
241 tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta
301 gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc
361 acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa
421 caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg
481 gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa
541 aacgacggcc agtcttaagc tcgggcccca aataatgatt ttattttgac tgatagtgac
601 ctgttcgttg caacacattg atgagcaatg cttttttata atgccaactt tgtacaaaaa
661 agctgaacga gaaacgtaaa atgatataaa tatcaatata ttaaattaga ttttgcataa
721 aaaacagact acataatact gtaaaacaca acatatccag tcactatgaa tcaactactt
781 agatggtatt agtgacctgt agtcgaccga cagccttcca aatgttcttc gggtgatgct
841 gccaacttag tcgaccgaca gccttccaaa tgttcttctc aaacggaatc gtcgtatcca
901 gcctactcgc tattgtcctc aatgccgtat taaatcataa aaagaaataa gaaaaagagg
961 tgcgagcctc ttttttgtgt gacaaaataa aaacatctac ctattcatat acgctagtgt
1021 catagtcctg aaaatcatct gcatcaagaa caatttcaca actcttatac ttttctctta
1081 caagtcgttc ggcttcatct ggattttcag cctctatact tactaaacgt gataaagttt
1141 ctgtaatttc tactgtatcg acctgcagac tggctgtgta taagggagcc tgacatttat
1201 attccccaga acatcaggtt aatggcgttt ttgatgtcat tttcgcggtg gctgagatca
1261 gccacttctt ccccgataac ggagaccggc acactggcca tatcggtggt catcatgcgc
1321 cagctttcat ccccgatatg caccaccggg taaagttcac gggagacttt atctgacagc
1381 agacgtgcac tggccagggg gatcaccatc cgtcgcccgg gcgtgtcaat aatatcactc
1441 tgtacatcca caaacagacg ataacggctc tctcttttat aggtgtaaac cttaaactgc
1501 atttcaccag cccctgttct cgtcagcaaa agagccgttc atttcaataa accgggcgac
1561 ctcagccatc ccttcctgat tttccgcttt ccagcgttcg gcacgcagac gacgggcttc
1621 attctgcatg gttgtgctta ccagaccgga gatattgaca tcatatatgc cttgagcaac
1681 tgatagctgt cgctgtcaac tgtcactgta atacgctgct tcatagcata cctctttttg
1741 acatacttcg ggtatacata tcagtatata ttcttatacc gcaaaaatca gcgcgcaaat
1801 acgcatactg ttatctggct tttagtaagc cggatccacg cggcgtttac gccccgccct
1861 gccactcatc gcagtactgt tgtaattcat taagcattct gccgacatgg aagccatcac
1921 agacggcatg atgaacctga atcgccagcg gcatcagcac cttgtcgcct tgcgtataat
1981 atttgcccat ggtgaaaacg ggggcgaaga agttgtccat attggccacg tttaaatcaa
2041 aactggtgaa actcacccag ggattggctg agacgaaaaa catattctca ataaaccctt
2101 tagggaaata ggccaggttt tcaccgtaac acgccacatc ttgcgaatat atgtgtagaa
2161 actgccggaa atcgtcgtgg tattcactcc agagcgatga aaacgtttca gtttgctcat
2221 ggaaaacggt gtaacaaggg tgaacactat cccatatcac cagctcaccg tctttcattg
2281 ccatacggaa ttccggatga gcattcatca ggcgggcaag aatgtgaata aaggccggat
2341 aaaacttgtg cttatttttc tttacggtct ttaaaaaggc cgtaatatcc agctgaacgg
2401 tctggttata ggtacattga gcaactgact gaaatgcctc aaaatgttct ttacgatgcc
2461 attgggatat atcaacggtg gtatatccag tgattttttt ctccatttta gcttccttag
2521 ctcctgaaaa tctcgataac tcaaaaaata cgcccggtag tgatcttatt tcattatggt
2581 gaaagttgga acctcttacg tgccgatcaa cgtctcattt tcgccaaaag ttggcccagg
2641 gcttcccggt atcaacaggg acaccaggat ttatttattc tgcgaagtga tcttccgtca
2701 caggtattta ttcggcgcaa agtgcgtcgg gtgatgctgc caacttagtc gactacaggt
2761 cactaatacc atctaagtag ttgattcata gtgactggat atgttgtgtt ttacagtatt
2821 atgtagtctg ttttttatgc aaaatctaat ttaatatatt gatatttata tcattttacg
2881 tttctcgttc agctttcttg tacaaagttg gcattataag aaagcattgc ttatcaattt
2941 gttgcaacga acaggtcact atcagtcaaa ataaaatcat tatttgccat ccagctgata
3001 tcccctatag tgagtcgtat tacatggtca tagctgtttc ctggcagctc tggcccgtgt
3061 ctcaaaatct ctgatgttac attgcacaag ataaaaatat atcatcatgc ctcctctaga
3121 ccagccagga cagaaatgcc tcgacttcgc tgctgcccaa ggttgccggg tgacgcacac
3181 cgtggaaacg gatgaaggca cgaacccagt ggacataagc ctgttcggtt cgtaagctgt
3241 aatgcaagta gcgtatgcgc tcacgcaact ggtccagaac cttgaccgaa cgcagcggtg
3301 gtaacggcgc agtggcggtt ttcatggctt gttatgactg tttttttggg gtacagtcta
3361 tgcctcgggc atccaagcag caagcgcgtt acgccgtggg tcgatgtttg atgttatgga
3421 gcagcaacga tgttacgcag cagggcagtc gccctaaaac aaagttaaac atcatgaggg
3481 aagcggtgat cgccgaagta tcgactcaac tatcagaggt agttggcgtc atcgagcgcc
3541 atctcgaacc gacgttgctg gccgtacatt tgtacggctc cgcagtggat ggcggcctga
3601 agccacacag tgatattgat ttgctggtta cggtgaccgt aaggcttgat gaaacaacgc
3661 ggcgagcttt gatcaacgac cttttggaaa cttcggcttc ccctggagag agcgagattc
3721 tccgcgctgt agaagtcacc attgttgtgc acgacgacat cattccgtgg cgttatccag
3781 ctaagcgcga actgcaattt ggagaatggc agcgcaatga cattcttgca ggtatcttcg
3841 agccagccac gatcgacatt gatctggcta tcttgctgac aaaagcaaga gaacatagcg
3901 ttgccttggt aggtccagcg gcggaggaac tctttgatcc ggttcctgaa caggatctat
3961 ttgaggcgct aaatgaaacc ttaacgctat ggaactcgcc gcccgactgg gctggcgatg
4021 agcgaaatgt agtgcttacg ttgtcccgca tttggtacag cgcagtaacc ggcaaaatcg
4081 cgccgaagga tgtcgctgcc gactgggcaa tggagcgcct gccggcccag tatcagcccg
4141 tcatacttga agctagacag gcttatcttg gacaagaaga agatcgcttg gcctcgcgcg
4201 cagatcagtt ggaagaattt gtccactacg tgaaaggcga gatcaccaag gtagtcggca
4261 aataaccctc gagccaccca tgaccaaaat cccttaacgt gagttacgcg tcgttccact
4321 gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg
4381 taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc
4441 aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata
4501 ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta
4561 catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc
4621 ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg
4681 ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac
4741 agcgtgagca ttgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg
4801 taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt
4861 atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct
4921 cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg
4981 ccttttgctg gccttttgct cacatgtt
                                    LOCUS       dna                      5008 bp                                   
FEATURES Location/Qualifiers
Terminator 268..295
/gene="rrnB_T2 term"
Terminator 427..470
/gene="rrnB_T1 term"
misc_binding 499..504
/dbxref="REBASE:HpaI"
misc_binding 563..568
/dbxref="REBASE:ApaI"
misc_binding 1163..1168
/dbxref="REBASE:PstI"
Other Gene 1197..1502
/gene="ccdB other"
misc_binding 1416..1421
/dbxref="REBASE:SmaI"
misc_binding 1416..1421
/dbxref="REBASE:XmaI"
misc_binding 1832..1837
/dbxref="REBASE:BamHI"
Marker 1847..2506
/gene="CAT marker"
ORF 1847..2506
/sequence="ORF_2 rf(4)"
misc_binding 1987..1992
/dbxref="REBASE:NcoI"
misc_binding 2288..2293
/dbxref="REBASE:EcoRI"
misc_binding 2997..3002
/dbxref="REBASE:EcoRV"
Promoter 3004..3022
/gene="T7 prom"
misc_binding 3115..3120
/dbxref="REBASE:XbaI"
Marker 3255..4265
/gene="spect marker"
ORF 3255..4265
/sequence="ORF_1 rf(3)"
misc_binding 3670..3675
/dbxref="REBASE:BclI"
misc_binding 4098..4108
/dbxref="REBASE:BglI"
misc_binding 4268..4273
/dbxref="REBASE:XhoI"
Rep_Origin 4342..4961
/gene="pBR322 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctga 60
GAAAGGACGCAATAGGGGACTAAGACACCTATTGGCATAATGGCGGAAACTCACTCGACT

61 taccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 120
ATGGCGAGCGGCGTCGGCTTGCTGGCTCGCGTCGCTCAGTCACTCGCTCCTTCGCCTTCT

121 gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggca 180
CGCGGGTTATGCGTTTGGCGGAGAGGGGCGCGCAACCGGCTAAGTAATTACGTCGACCGT

181 cgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgc 240
GCTGTCCAAAGGGCTGACCTTTCGCCCGTCACTCGCGTTGCGTTAATTATGCGCATGGCG

rrnB_T2 term(268,295)<<<
|
241 tagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgctta 300
ATCGGTCCTTCTCAAACATCTTTGCGTTTTTCCGGTAGGCAGTCCTACCGGAAGACGAAT

301 gtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttc 360
CAAACTACGGACCGTCAAATACCGCCCGCAGGACGGGCGGTGGGAGGCCCGGCAACGAAG

361 acaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaa 420
TGTTGCAAGTTTAGGCGAGGGCCGCCTAAACAGGATGAGTCCTCTCGCAAGTGGCTGTTT

rrnB_T1 term(427,470)<<<
|
421 caacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctg 480
GTTGTCTATTTTGCTTTCCGGGTCAGAAGGCTGACTCGGAAAGCAAAATAAACTACGGAC

HpaI
|
481 gcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaa 540
CGTCAAGGGATGAGAGCGCAATTGCGATCGTACCTACAAAAGGGTCAGTGCTGCAACATT

attP other(570,801)>>>
|
ApaI
| |
541 aacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgac 600
TTGCTGCCGGTCAGAATTCGAGCCCGGGGTTTATTACTAAAATAAAACTGACTATCACTG

601 ctgttcgttgcaacacattgatgagcaatgcttttttataatgccaactttgtacaaaaa 660
GACAAGCAACGTTGTGTAACTACTCGTTACGAAAAAATATTACGGTTGAAACATGTTTTT


661 agctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataa 720
TCGACTTGCTCTTTGCATTTTACTATATTTATAGTTATATAATTTAATCTAAAACGTATT

721 aaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactactt 780
TTTTGTCTGATGTATTATGACATTTTGTGTTGTATAGGTCAGTGATACTTAGTTGATGAA

781 agatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgct 840
TCTACCATAATCACTGGACATCAGCTGGCTGTCGGAAGGTTTACAAGAAGCCCACTACGA

841 gccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatcca 900
CGGTTGAATCAGCTGGCTGTCGGAAGGTTTACAAGAAGAGTTTGCCTTAGCAGCATAGGT

901 gcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagagg 960
CGGATGAGCGATAACAGGAGTTACGGCATAATTTAGTATTTTTCTTTATTCTTTTTCTCC

961 tgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgt 1020
ACGCTCGGAGAAAAAACACACTGTTTTATTTTTGTAGATGGATAAGTATATGCGATCACA

1021 catagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctctta 1080
GTATCAGGACTTTTAGTAGACGTAGTTCTTGTTAAAGTGTTGAGAATATGAAAAGAGAAT

1081 caagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagttt 1140
GTTCAGCAAGCCGAAGTAGACCTAAAAGTCGGAGATATGAATGATTTGCACTATTTCAAA

PstI ccdB other(1197,1502)<<<
| |
1141 ctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttat 1200
GACATTAAAGATGACATAGCTGGACGTCTGACCGACACATATTCCCTCGGACTGTAAATA

1201 attccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatca 1260
TAAGGGGTCTTGTAGTCCAATTACCGCAAAAACTACAGTAAAAGCGCCACCGACTCTAGT

1261 gccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgc 1320
CGGTGAAGAAGGGGCTATTGCCTCTGGCCGTGTGACCGGTATAGCCACCAGTAGTACGCG

1321 cagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagc 1380
GTCGAAAGTAGGGGCTATACGTGGTGGCCCATTTCAAGTGCCCTCTGAAATAGACTGTCG

SmaI
|
XmaI
| |
1381 agacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactc 1440
TCTGCACGTGACCGGTCCCCCTAGTGGTAGGCAGCGGGCCCGCACAGTTATTATAGTGAG

1441 tgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgc 1500
ACATGTAGGTGTTTGTCTGCTATTGCCGAGAGAGAAAATATCCACATTTGGAATTTGACG

1501 atttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgac 1560
TAAAGTGGTCGGGGACAAGAGCAGTCGTTTTCTCGGCAAGTAAAGTTATTTGGCCCGCTG

1561 ctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttc 1620
GAGTCGGTAGGGAAGGACTAAAAGGCGAAAGGTCGCAAGCCGTGCGTCTGCTGCCCGAAG

1621 attctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaac 1680
TAAGACGTACCAACACGAATGGTCTGGCCTCTATAACTGTAGTATATACGGAACTCGTTG

1681 tgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttg 1740
ACTATCGACAGCGACAGTTGACAGTGACATTATGCGACGAAGTATCGTATGGAGAAAAAC

1741 acatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaat 1800
TGTATGAAGCCCATATGTATAGTCATATATAAGAATATGGCGTTTTTAGTCGCGCGTTTA

ORF_2 rf(4)(1847,2506)<<<
|
BamHI CAT marker(1847,2506)<<<
| |
1801 acgcatactgttatctggcttttagtaagccggatccacgcggcgtttacgccccgccct 1860
TGCGTATGACAATAGACCGAAAATCATTCGGCCTAGGTGCGCCGCAAATGCGGGGCGGGA

1861 gccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcac 1920
CGGTGAGTAGCGTCATGACAACATTAAGTAATTCGTAAGACGGCTGTACCTTCGGTAGTG

1921 agacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataat 1980
TCTGCCGTACTACTTGGACTTAGCGGTCGCCGTAGTCGTGGAACAGCGGAACGCATATTA

NcoI
|
1981 atttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaa 2040
TAAACGGGTACCACTTTTGCCCCCGCTTCTTCAACAGGTATAACCGGTGCAAATTTAGTT

2041 aactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctt 2100
TTGACCACTTTGAGTGGGTCCCTAACCGACTCTGCTTTTTGTATAAGAGTTATTTGGGAA

2101 tagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaa 2160
ATCCCTTTATCCGGTCCAAAAGTGGCATTGTGCGGTGTAGAACGCTTATATACACATCTT

2161 actgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcat 2220
TGACGGCCTTTAGCAGCACCATAAGTGAGGTCTCGCTACTTTTGCAAAGTCAAACGAGTA

2221 ggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattg 2280
CCTTTTGCCACATTGTTCCCACTTGTGATAGGGTATAGTGGTCGAGTGGCAGAAAGTAAC

EcoRI
|
2281 ccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggat 2340
GGTATGCCTTAAGGCCTACTCGTAAGTAGTCCGCCCGTTCTTACACTTATTTCCGGCCTA

2341 aaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacgg 2400
TTTTGAACACGAATAAAAAGAAATGCCAGAAATTTTTCCGGCATTATAGGTCGACTTGCC

2401 tctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgcc 2460
AGACCAATATCCATGTAACTCGTTGACTGACTTTACGGAGTTTTACAAGAAATGCTACGG

2461 attgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttag 2520
TAACCCTATATAGTTGCCACCATATAGGTCACTAAAAAAAGAGGTAAAATCGAAGGAATC

2521 ctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggt 2580
GAGGACTTTTAGAGCTATTGAGTTTTTTATGCGGGCCATCACTAGAATAAAGTAATACCA

2581 gaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagg 2640
CTTTCAACCTTGGAGAATGCACGGCTAGTTGCAGAGTAAAAGCGGTTTTCAACCGGGTCC

2641 gcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtca 2700
CGAAGGGCCATAGTTGTCCCTGTGGTCCTAAATAAATAAGACGCTTCACTAGAAGGCAGT

2701 caggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggt 2760
GTCCATAAATAAGCCGCGTTTCACGCAGCCCACTACGACGGTTGAATCAGCTGATGTCCA

2761 cactaataccatctaagtagttgattcatagtgactggatatgttgtgttttacagtatt 2820
GTGATTATGGTAGATTCATCAACTAAGTATCACTGACCTATACAACACAAAATGTCATAA

2821 atgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacg 2880
TACATCAGACAAAAAATACGTTTTAGATTAAATTATATAACTATAAATATAGTAAAATGC

2881 tttctcgttcagctttcttgtacaaagttggcattataagaaagcattgcttatcaattt 2940
AAAGAGCAAGTCGAAAGAACATGTTTCAACCGTAATATTCTTTCGTAACGAATAGTTAAA

2941 gttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgata 3000
CAACGTTGCTTGTCCAGTGATAGTCAGTTTTATTTTAGTAATAAACGGTAGGTCGACTAT

T7 prom(3004,3022)<<<
|
EcoRV
| |
3001 tcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgt 3060
AGGGGATATCACTCAGCATAATGTACCAGTATCGACAAAGGACCGTCGAGACCGGGCACA

XbaI
|
3061 ctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgcctcctctaga 3120
GAGTTTTAGAGACTACAATGTAACGTGTTCTATTTTTATATAGTAGTACGGAGGAGATCT

3121 ccagccaggacagaaatgcctcgacttcgctgctgcccaaggttgccgggtgacgcacac 3180
GGTCGGTCCTGTCTTTACGGAGCTGAAGCGACGACGGGTTCCAACGGCCCACTGCGTGTG

3181 cgtggaaacggatgaaggcacgaacccagtggacataagcctgttcggttcgtaagctgt 3240
GCACCTTTGCCTACTTCCGTGCTTGGGTCACCTGTATTCGGACAAGCCAAGCATTCGACA

spect marker(3255,4265)>>>
|
ORF_1 rf(3)(3255,4265)>>>
|
3241 aatgcaagtagcgtatgcgctcacgcaactggtccagaaccttgaccgaacgcagcggtg 3300
TTACGTTCATCGCATACGCGAGTGCGTTGACCAGGTCTTGGAACTGGCTTGCGTCGCCAC

3301 gtaacggcgcagtggcggttttcatggcttgttatgactgtttttttggggtacagtcta 3360
CATTGCCGCGTCACCGCCAAAAGTACCGAACAATACTGACAAAAAAACCCCATGTCAGAT

3361 tgcctcgggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatgga 3420
ACGGAGCCCGTAGGTTCGTCGTTCGCGCAATGCGGCACCCAGCTACAAACTACAATACCT

3421 gcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaaacatcatgaggg 3480
CGTCGTTGCTACAATGCGTCGTCCCGTCAGCGGGATTTTGTTTCAATTTGTAGTACTCCC

3481 aagcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgcc 3540
TTCGCCACTAGCGGCTTCATAGCTGAGTTGATAGTCTCCATCAACCGCAGTAGCTCGCGG

3541 atctcgaaccgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctga 3600
TAGAGCTTGGCTGCAACGACCGGCATGTAAACATGCCGAGGCGTCACCTACCGCCGGACT

3601 agccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacgc 3660
TCGGTGTGTCACTATAACTAAACGACCAATGCCACTGGCATTCCGAACTACTTTGTTGCG

BclI
|
3661 ggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattc 3720
CCGCTCGAAACTAGTTGCTGGAAAACCTTTGAAGCCGAAGGGGACCTCTCTCGCTCTAAG

3721 tccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccag 3780
AGGCGCGACATCTTCAGTGGTAACAACACGTGCTGCTGTAGTAAGGCACCGCAATAGGTC

3781 ctaagcgcgaactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcg 3840
GATTCGCGCTTGACGTTAAACCTCTTACCGTCGCGTTACTGTAAGAACGTCCATAGAAGC

3841 agccagccacgatcgacattgatctggctatcttgctgacaaaagcaagagaacatagcg 3900
TCGGTCGGTGCTAGCTGTAACTAGACCGATAGAACGACTGTTTTCGTTCTCTTGTATCGC

3901 ttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctat 3960
AACGGAACCATCCAGGTCGCCGCCTCCTTGAGAAACTAGGCCAAGGACTTGTCCTAGATA

3961 ttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatg 4020
AACTCCGCGATTTACTTTGGAATTGCGATACCTTGAGCGGCGGGCTGACCCGACCGCTAC

4021 agcgaaatgtagtgcttacgttgtcccgcatttggtacagcgcagtaaccggcaaaatcg 4080
TCGCTTTACATCACGAATGCAACAGGGCGTAAACCATGTCGCGTCATTGGCCGTTTTAGC

BglI
|
4081 cgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccg 4140
GCGGCTTCCTACAGCGACGGCTGACCCGTTACCTCGCGGACGGCCGGGTCATAGTCGGGC

4141 tcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcg 4200
AGTATGAACTTCGATCTGTCCGAATAGAACCTGTTCTTCTTCTAGCGAACCGGAGCGCGC

4201 cagatcagttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtcggca 4260
GTCTAGTCAACCTTCTTAAACAGGTGATGCACTTTCCGCTCTAGTGGTTCCATCAGCCGT

XhoI
|
4261 aataaccctcgagccacccatgaccaaaatcccttaacgtgagttacgcgtcgttccact 4320
TTATTGGGAGCTCGGTGGGTACTGGTTTTAGGGAATTGCACTCAATGCGCAGCAAGGTGA

pBR322 origin(4342,4961)>>>
|
4321 gagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcg 4380
CTCGCAGTCTGGGGCATCTTTTCTAGTTTCCTAGAAGAACTCTAGGAAAAAAAGACGCGC

4381 taatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatc 4440
ATTAGACGACGAACGTTTGTTTTTTTGGTGGCGATGGTCGCCACCAAACAAACGGCCTAG

4441 aagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaata 4500
TTCTCGATGGTTGAGAAAAAGGCTTCCATTGACCGAAGTCGTCTCGCGTCTATGGTTTAT

4501 ctgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgccta 4560
GACAGGAAGATCACATCGGCATCAATCCGGTGGTGAAGTTCTTGAGACATCGTGGCGGAT

4561 catacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtc 4620
GTATGGAGCGAGACGATTAGGACAATGGTCACCGACGACGGTCACCGCTATTCAGCACAG

4621 ttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacgg 4680
AATGGCCCAACCTGAGTTCTGCTATCAATGGCCTATTCCGCGTCGCCAGCCCGACTTGCC

4681 ggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctac 4740
CCCCAAGCACGTGTGTCGGGTCGAACCTCGCTTGCTGGATGTGGCTTGACTCTATGGATG

4741 agcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccgg 4800
TCGCACTCGTAACTCTTTCGCGGTGCGAAGGGCTTCCCTCTTTCCGCCTGTCCATAGGCC

4801 taagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggt 4860
ATTCGCCGTCCCAGCCTTGTCCTCTCGCGTGCTCCCTCGAAGGTCCCCCTTTGCGGACCA

4861 atctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgct 4920
TAGAAATATCAGGACAGCCCAAAGCGGTGGAGACTGAACTCGCAGCTAAAAACACTACGA

4921 cgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctgg 4980
GCAGTCCCCCCGCCTCGGATACCTTTTTGCGGTCGTTGCGCCGGAAAAATGCCAAGGACC

4981 ccttttgctggccttttgctcacatgtt 5008
GGAAAACGACCGGAAAACGAGTGTACAA