pPB-N-His
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepPB-N-His
VectorTypeProtein Vector
Antibiotic InformationBacterial: Kanamycin
Sequencing PrimersT7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'

T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Additional InformationOriginal Vector: 7023bp

Vector without Insert Cassette: 5368bp
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg     
61 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc
121 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg
181 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc
241 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt
301 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc
361 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta
421 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt
481 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta
541 tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat
601 tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa
661 actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc
721 gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga
781 aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc
841 agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac
901 cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac
961 aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat
1021 tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag
1081 tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca
1141 taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac
1201 ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg
1261 tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca
1321 tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac
1381 cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa
1441 cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga
1501 gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg
1561 gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc
1621 agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag
1681 aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc
1741 agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg
1801 cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac
1861 accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga
1921 aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt
1981 ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag
2041 cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg
2101 gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta
2161 tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc
2221 agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg
2281 tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta
2341 caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg
2401 ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct
2461 gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag
2521 gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc
2581 gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag
2641 aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt
2701 ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa
2761 acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg
2821 ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg
2881 tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc
2941 tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta
3001 cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca
3061 gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc
3121 ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc
3181 catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa
3241 ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc
3301 gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac
3361 gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca
3421 ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta
3481 atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa
3541 cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat
3601 tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca
3661 ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa
3721 aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt
3781 atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg
3841 cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca
3901 gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta
3961 tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg
4021 agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat
4081 gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct
4141 ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg
4201 catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat
4261 tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc
4321 tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca
4381 gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg
4441 ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt
4501 tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg
4561 catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct
4621 cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga
4681 tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg
4741 ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc
4801 ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg
4861 cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg
4921 gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga
4981 aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa
5041 ttttgtttaa ctttaagaag gagatatacc atgggcagca gccatcatca tcatcatcac
5101 agcagcggcc tggtgccgcg cggcagccat atggctagct acatcacaag tttgtacaaa
5161 aaagctgaac gagaaacgta aaatgatata aatatcaata tattaaatta gattttgcat
5221 aaaaaacaga ctacataata ctgtaaaaca caacatatcc agtcactatg gcggccgcat
5281 taggcacccc aggctttaca ctttatgctt ccggctcgta taatgtgtgg attttgagtt
5341 aggatccgtc gagattttca ggagctaagg aagctaaaat ggagaaaaaa atcactggat
5401 ataccaccgt tgatatatcc caatggcatc gtaaagaaca ttttgaggca tttcagtcag
5461 ttgctcaatg tacctataac cagaccgttc agctggatat tacggccttt ttaaagaccg
5521 taaagaaaaa taagcacaag ttttatccgg cctttattca cattcttgcc cgcctgatga
5581 atgctcatcc ggaattccgt atggcaatga aagacggtga gctggtgata tgggatagtg
5641 ttcacccttg ttacaccgtt ttccatgagc aaactgaaac gttttcatcg ctctggagtg
5701 aataccacga cgatttccgg cagtttctac acatatattc gcaagatgtg gcgtgttacg
5761 gtgaaaacct ggcctatttc cctaaagggt ttattgagaa tatgtttttc gtctcagcca
5821 atccctgggt gagtttcacc agttttgatt taaacgtggc caatatggac aacttcttcg
5881 cccccgtttt caccatgggc aaatattata cgcaaggcga caaggtgctg atgccgctgg
5941 cgattcaggt tcatcatgcc gtttgtgatg gcttccatgt cggcagaatg cttaatgaat
6001 tacaacagta ctgcgatgag tggcagggcg gggcgtaaac gcgtggatcc ggcttactaa
6061 aagccagata acagtatgcg tatttgcgcg ctgatttttg cggtataaga atatatactg
6121 atatgtatac ccgaagtatg tcaaaaagag gtatgctatg aagcagcgta ttacagtgac
6181 agttgacagc gacagctatc agttgctcaa ggcatatatg atgtcaatat ctccggtctg
6241 gtaagcacaa ccatgcagaa tgaagcccgt cgtctgcgtg ccgaacgctg gaaagcggaa
6301 aatcaggaag ggatggctga ggtcgcccgg tttattgaaa tgaacggctc ttttgctgac
6361 gagaacaggg gctggtgaaa tgcagtttaa ggtttacacc tataaaagag agagccgtta
6421 tcgtctgttt gtggatgtac agagtgatat tattgacacg cccgggcgac ggatggtgat
6481 ccccctggcc agtgcacgtc tgctgtcaga taaagtctcc cgtgaacttt acccggtggt
6541 gcatatcggg gatgaaagct ggcgcatgat gaccaccgat atggccagtg tgccggtctc
6601 cgttatcggg gaagaagtgg ctgatctcag ccaccgcgaa aatgacatca aaaacgccat
6661 taacctgatg ttctggggaa tataaatgtc aggctccctt atacacagcc agtctgcagg
6721 tcgaccatag tgactggata tgttgtgttt tacagtatta tgtagtctgt tttttatgca
6781 aaatctaatt taatatattg atatttatat cattttacgt ttctcgttca gctttcttgt
6841 acaaagtggt gatgtaatga ctcgagcacc accaccacca ccactgagat ccggctgcta
6901 acaaagcccg aaaggaagct gagttggctg ctgccaccgc tgagcaataa ctagcataac
6961 cccttggggc ctctaaacgg gtcttgaggg gttttttgct gaaaggagga actatatccg
7021 gat
                                    LOCUS       dna                      7023 bp                                   
FEATURES Location/Qualifiers
Rep_Origin 29..335
/gene="f1 origin"
Marker 560..1375
/gene="kan2 marker"
ORF 560..1375
/sequence="ORF_3 rf(6)"
misc_binding 1249..1254
/dbxref="REBASE:ClaI"
misc_binding 1284..1289
/dbxref="REBASE:NruI"
Rep_Origin 1481..2100
/gene="pBR322 origin"
Other Gene 2515..2706
/gene="ROP other"
misc_binding 3179..3189
/dbxref="REBASE:BglI"
Regulatory_Seq 3515..4606
/gene="lacI reg"
ORF 3515..4474
/sequence="ORF_2 rf(6)"
misc_binding 3738..3743
/dbxref="REBASE:HpaI"
misc_binding 3794..3799
/dbxref="REBASE:EcoRV"
misc_binding 4035..4040
/dbxref="REBASE:ApaI"
misc_binding 4228..4233
/dbxref="REBASE:BclI"
misc_binding 4771..4776
/dbxref="REBASE:SphI"
misc_binding 4964..4969
/dbxref="REBASE:BglII"
Promoter 4984..5002
/gene="T7 prom"
Regulatory_Seq 5002..5029
/gene="lacO reg"
misc_binding 5030..5035
/dbxref="REBASE:XbaI"
misc_binding 5128..5133
/dbxref="REBASE:NdeI"
misc_binding 5271..5278
/dbxref="REBASE:NotI"
Marker 5379..6038
/gene="CAT marker"
ORF 5379..6038
/sequence="ORF_1 rf(3)"
misc_binding 5592..5597
/dbxref="REBASE:EcoRI"
Other Gene 6380..6685
/gene="ccdB other"
misc_binding 6714..6719
/dbxref="REBASE:PstI"
misc_binding 6861..6866
/dbxref="REBASE:XhoI"
Terminator 6895..7023
/gene="T7 term"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
                                  f1 origin(29,335)>>> 
|
1 tggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcg 60
ACCGCTTACCCTGCGCGGGACATCGCCGCGTAATTCGCGCCGCCCACACCACCAATGCGC

61 cagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttc 120
GTCGCACTGGCGATGTGAACGGTCGCGGGATCGCGGGCGAGGAAAGCGAAAGAAGGGAAG

121 ctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagg 180
GAAAGAGCGGTGCAAGCGGCCGAAAGGGGCAGTTCGAGATTTAGCCCCCGAGGGAAATCC

181 gttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttc 240
CAAGGCTAAATCACGAAATGCCGTGGAGCTGGGGTTTTTTGAACTAATCCCACTACCAAG

241 acgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgtt 300
TGCATCACCCGGTAGCGGGACTATCTGCCAAAAAGCGGGAAACTGCAACCTCAGGTGCAA

301 ctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattc 360
GAAATTATCACCTGAGAACAAGGTTTGACCTTGTTGTGAGTTGGGATAGAGCCAGATAAG

361 ttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgattta 420
AAAACTAAATATTCCCTAAAACGGCTAAAGCCGGATAACCAATTTTTTACTCGACTAAAT

421 acaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcaggtggcacttt 480
TGTTTTTAAATTGCGCTTAAAATTGTTTTATAATTGCAAATGTTAAAGTCCACCGTGAAA

481 tcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgta 540
AGCCCCTTTACACGCGCCTTGGGGATAAACAAATAAAAAGATTTATGTAAGTTTATACAT

ORF_3 rf(6)(560,1375)<<<
|
kan2 marker(560,1375)<<<
|
541 tccgctcatgaattaattcttagaaaaactcatcgagcatcaaatgaaactgcaatttat 600
AGGCGAGTACTTAATTAAGAATCTTTTTGAGTAGCTCGTAGTTTACTTTGACGTTAAATA

601 tcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaa 660
AGTATAGTCCTAATAGTTATGGTATAAAAACTTTTTCGGCAAAGACATTACTTCCTCTTT

661 actcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgattccgactc 720
TGAGTGGCTCCGTCAAGGTATCCTACCGTTCTAGGACCATAGCCAGACGCTAAGGCTGAG

721 gtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtgaga 780
CAGGTTGTAGTTATGTTGGATAATTAAAGGGGAGCAGTTTTTATTCCAATAGTTCACTCT

781 aatcaccatgagtgacgactgaatccggtgagaatggcaaaagtttatgcatttctttcc 840
TTAGTGGTACTCACTGCTGACTTAGGCCACTCTTACCGTTTTCAAATACGTAAAGAAAGG

841 agacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaac 900
TCTGAACAAGTTGTCCGGTCGGTAATGCGAGCAGTAGTTTTAGTGAGCGTAGTTGGTTTG

901 cgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggac 960
GCAATAAGTAAGCACTAACGCGGACTCGCTCTGCTTTATGCGCTAGCGACAATTTTCCTG

961 aattacaaacaggaatcgaatgcaaccggcgcaggaacactgccagcgcatcaacaatat 1020
TTAATGTTTGTCCTTAGCTTACGTTGGCCGCGTCCTTGTGACGGTCGCGTAGTTGTTATA

1021 tttcacctgaatcaggatattcttctaatacctggaatgctgttttcccggggatcgcag 1080
AAAGTGGACTTAGTCCTATAAGAAGATTATGGACCTTACGACAAAAGGGCCCCTAGCGTC

1081 tggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggca 1140
ACCACTCATTGGTACGTAGTAGTCCTCATGCCTATTTTACGAACTACCAGCCTTCTCCGT

1141 taaattccgtcagccagtttagtctgaccatctcatctgtaacatcattggcaacgctac 1200
ATTTAAGGCAGTCGGTCAAATCAGACTGGTAGAGTAGACATTGTAGTAACCGTTGCGATG

ClaI
|
1201 ctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaatcgatagattg 1260
GAAACGGTACAAAGTCTTTGTTGAGACCGCGTAGCCCGAAGGGTATGTTAGCTATCTAAC

NruI
|
1261 tcgcacctgattgcccgacattatcgcgagcccatttatacccatataaatcagcatcca 1320
AGCGTGGACTAACGGGCTGTAATAGCGCTCGGGTAAATATGGGTATATTTAGTCGTAGGT

1321 tgttggaatttaatcgcggcctagagcaagacgtttcccgttgaatatggctcataacac 1380
ACAACCTTAAATTAGCGCCGGATCTCGTTCTGCAAAGGGCAACTTATACCGAGTATTGTG

1381 cccttgtattactgtttatgtaagcagacagttttattgttcatgaccaaaatcccttaa 1440
GGGAACATAATGACAAATACATTCGTCTGTCAAAATAACAAGTACTGGTTTTAGGGAATT

pBR322 origin(1481,2100)>>>
|
1441 cgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttga 1500
GCACTCAAAAGCAAGGTGACTCGCAGTCTGGGGCATCTTTTCTAGTTTCCTAGAAGAACT

1501 gatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcg 1560
CTAGGAAAAAAAGACGCGCATTAGACGACGAACGTTTGTTTTTTTGGTGGCGATGGTCGC

1561 gtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagc 1620
CACCAAACAAACGGCCTAGTTCTCGATGGTTGAGAAAAAGGCTTCCATTGACCGAAGTCG

1621 agagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaag 1680
TCTCGCGTCTATGGTTTATGACAGGAAGATCACATCGGCATCAATCCGGTGGTGAAGTTC

1681 aactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcc 1740
TTGAGACATCGTGGCGGATGTATGGAGCGAGACGATTAGGACAATGGTCACCGACGACGG

1741 agtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcg 1800
TCACCGCTATTCAGCACAGAATGGCCCAACCTGAGTTCTGCTATCAATGGCCTATTCCGC

1801 cagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctac 1860
GTCGCCAGCCCGACTTGCCCCCCAAGCACGTGTGTCGGGTCGAACCTCGCTTGCTGGATG

1861 accgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggaga 1920
TGGCTTGACTCTATGGATGTCGCACTCGATACTCTTTCGCGGTGCGAAGGGCTTCCCTCT

1921 aaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagctt 1980
TTCCGCCTGTCCATAGGCCATTCGCCGTCCCAGCCTTGTCCTCTCGCGTGCTCCCTCGAA

1981 ccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgag 2040
GGTCCCCCTTTGCGGACCATAGAAATATCAGGACAGCCCAAAGCGGTGGAGACTGAACTC

2041 cgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcg 2100
GCAGCTAAAAACACTACGAGCAGTCCCCCCGCCTCGGATACCTTTTTGCGGTCGTTGCGC

2101 gcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgtta 2160
CGGAAAAATGCCAAGGACCGGAAAACGACCGGAAAACGAGTGTACAAGAAAGGACGCAAT

2161 tcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgc 2220
AGGGGACTAAGACACCTATTGGCATAATGGCGGAAACTCACTCGACTATGGCGAGCGGCG

2221 agccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcgg 2280
TCGGCTTGCTGGCTCGCGTCGCTCAGTCACTCGCTCCTTCGCCTTCTCGCGGACTACGCC

2281 tattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagta 2340
ATAAAAGAGGAATGCGTAGACACGCCATAAAGTGTGGCGTATATACCACGTGAGAGTCAT

2341 caatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactg 2400
GTTAGACGAGACTACGGCGTATCAATTCGGTCATATGTGAGGCGATAGCGATGCACTGAC

2401 ggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtct 2460
CCAGTACCGACGCGGGGCTGTGGGCGGTTGTGGGCGACTGCGCGGGACTGCCCGAACAGA

ROP other(2515,2706)<<<
|
2461 gctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagag 2520
CGAGGGCCGTAGGCGAATGTCTGTTCGACACTGGCAGAGGCCCTCGACGTACACAGTCTC

2521 gttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtc 2580
CAAAAGTGGCAGTAGTGGCTTTGCGCGCTCCGTCGACGCCATTTCGAGTAGTCGCACCAG

2581 gtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccag 2640
CACTTCGCTAAGTGTCTACAGACGGACAAGTAGGCGCAGGTCGAGCAACTCAAAGAGGTC

2641 aagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgttt 2700
TTCGCAATTACAGACCGAAGACTATTTCGCCCGGTACAATTCCCGCCAAAAAAGGACAAA

2701 ggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaa 2760
CCAGTGACTACGGAGGCACATTCCCCCTAAAGACAAGTACCCCCATTACTATGGCTACTT

2761 acgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacg 2820
TGCTCTCTCCTACGAGTGCTATGCCCAATGACTACTACTTGTACGGGCCAATGACCTTGC

2821 ttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcaggg 2880
AACACTCCCATTTGTTGACCGCCATACCTACGCCGCCCTGGTCTCTTTTTAGTGAGTCCC

2881 tcaatgccagcgcttcgttaatacagatgtaggtgttccacagggtagccagcagcatcc 2940
AGTTACGGTCGCGAAGCAATTATGTCTACATCCACAAGGTGTCCCATCGGTCGTCGTAGG

2941 tgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagacttta 3000
ACGCTACGTCTAGGCCTTGTATTACCACGTCCCGCGACTGAAGGCGCAAAGGTCTGAAAT

3001 cgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagca 3060
GCTTTGTGCCTTTGGCTTCTGGTAAGTACAACAACGAGTCCAGCGTCTGCAAAACGTCGT

3061 gcagtcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaacc 3120
CGTCAGCGAAGTGCAAGCGAGCGCATAGCCACTAAGTAAGACGATTGGTCATTCCGTTGG

3121 ccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggggccgc 3180
GGCGGTCGGATCGGCCCAGGAGTTGCTGTCCTCGTGCTAGTACGCGTGGGCACCCCGGCG

BglI
|
3181 catgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaa 3240
GTACGGCCGCTATTACCGGACGAAGAGCGGCTTTGCAAACCACCGCCCTGGTCACTGCTT

3241 ggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgc 3300
CCGAACTCGCTCCCGCACGTTCTAAGGCTTATGGCGTTCGCTGTCCGGCTAGTAGCAGCG

3301 gctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctac 3360
CGAGGTCGCTTTCGCCAGGAGCGGCTTTTACTGGGTCTCGCGACGGCCGTGGACAGGATG

3361 gagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgccca 3420
CTCAACGTACTATTTCTTCTGTCAGTATTCACGCCGCTGCTATCAGTACGGGGCGCGGGT

3421 ccggaaggagctgactgggttgaaggctctcaagggcatcggtcgagatcccggtgccta 3480
GGCCTTCCTCGACTGACCCAACTTCCGAGAGTTCCCGTAGCCAGCTCTAGGGCCACGGAT

lacI reg(3515,4606)<<<
|
ORF_2 rf(6)(3515,4474)<<<
|
3481 atgagtgagctaacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaa 3540
TACTCACTCGATTGAATGTAATTAACGCAACGCGAGTGACGGGCGAAAGGTCAGCCCTTT

3541 cctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtat 3600
GGACAGCACGGTCGACGTAATTACTTAGCCGGTTGCGCGCCCCTCTCCGCCAAACGCATA

3601 tgggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttca 3660
ACCCGCGGTCCCACCAAAAAGAAAAGTGGTCACTCTGCCCGTTGTCGACTAACGGGAAGT

3661 ccgcctggccctgagagagttgcagcaagcggtccacgctggtttgccccagcaggcgaa 3720
GGCGGACCGGGACTCTCTCAACGTCGTTCGCCAGGTGCGACCAAACGGGGTCGTCCGCTT

HpaI
|
3721 aatcctgtttgatggtggttaacggcgggatataacatgagctgtcttcggtatcgtcgt 3780
TTAGGACAAACTACCACCAATTGCCGCCCTATATTGTACTCGACAGAAGCCATAGCAGCA

EcoRV
|
3781 atcccactaccgagatatccgcaccaacgcgcagcccggactcggtaatggcgcgcattg 3840
TAGGGTGATGGCTCTATAGGCGTGGTTGCGCGTCGGGCCTGAGCCATTACCGCGCGTAAC

3841 cgcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgccctcattca 3900
GCGGGTCGCGGTAGACTAGCAACCGTTGGTCGTAGCGTCACCCTTGCTACGGGAGTAAGT

3901 gcatttgcatggtttgttgaaaaccggacatggcactccagtcgccttcccgttccgcta 3960
CGTAAACGTACCAAACAACTTTTGGCCTGTACCGTGAGGTCAGCGGAAGGGCAAGGCGAT

3961 tcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgccg 4020
AGCCGACTTAAACTAACGCTCACTCTATAAATACGGTCGGTCGGTCTGCGTCTGCGCGGC

ApaI
|
4021 agacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagat 4080
TCTGTCTTGAATTACCCGGGCGATTGTCGCGCTAAACGACCACTGGGTTACGCTGGTCTA

4081 gctccacgcccagtcgcgtaccgtcttcatgggagaaaataatactgttgatgggtgtct 4140
CGAGGTGCGGGTCAGCGCATGGCAGAAGTACCCTCTTTTATTATGACAACTACCCACAGA

4141 ggtcagagacatcaagaaataacgccggaacattagtgcaggcagcttccacagcaatgg 4200
CCAGTCTCTGTAGTTCTTTATTGCGGCCTTGTAATCACGTCCGTCGAAGGTGTCGTTACC

BclI
|
4201 catcctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagat 4260
GTAGGACCAGTAGGTCGCCTATCAATTACTAGTCGGGTGACTGCGCAACGCGCTCTTCTA

4261 tgtgcaccgccgctttacaggcttcgacgccgcttcgttctaccatcgacaccaccacgc 4320
ACACGTGGCGGCGAAATGTCCGAAGCTGCGGCGAAGCAAGATGGTAGCTGTGGTGGTGCG

4321 tggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgca 4380
ACCGTGGGTCAACTAGCCGCGCTCTAAATTAGCGGCGCTGTTAAACGCTGCCGCGCACGT

4381 gggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgccagttgttgtg 4440
CCCGGTCTGACCTCCACCGTTGCGGTTAGTCGTTGCTGACAAACGGGCGGTCAACAACAC

4441 ccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccgcgttt 4500
GGTGCGCCAACCCTTACATTAAGTCGAGGCGGTAGCGGCGAAGGTGAAAAAGGGCGCAAA

4501 tcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccgg 4560
AGCGTCTTTGCACCGACCGGACCAAGTGGTGCGCCCTTTGCCAGACTATTCTCTGTGGCC

4561 catactctgcgacatcgtataacgttactggtttcacattcaccaccctgaattgactct 4620
GTATGAGACGCTGTAGCATATTGCAATGACCAAAGTGTAAGTGGTGGGACTTAACTGAGA

4621 cttccgggcgctatcatgccataccgcgaaaggttttgcgccattcgatggtgtccggga 4680
GAAGGCCCGCGATAGTACGGTATGGCGCTTTCCAAAACGCGGTAAGCTACCACAGGCCCT

4681 tctcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgagg 4740
AGAGCTGCGAGAGGGAATACGCTGAGGACGTAATCCTTCGTCGGGTCATCATCCAACTCC

SphI
|
4741 ccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtccc 4800
GGCAACTCGTGGCGGCGGCGTTCCTTACCACGTACGTTCCTCTACCGCGGGTTGTCAGGG

4801 ccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtgg 4860
GGCCGGTGCCCCGGACGGTGGTATGGGTGCGGCTTTGTTCGCGAGTACTCGGGCTTCACC

4861 cgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtg 4920
GCTCGGGCTAGAAGGGGTAGCCACTACAGCCGCTATATCCGCGGTCGTTGGCGTGGACAC

BglII
|
4921 gcgccggtgatgccggccacgatgcgtccggcgtagaggatcgagatctcgatcccgcga 4980
CGCGGCCACTACGGCCGGTGCTACGCAGGCCGCATCTCCTAGCTCTAGAGCTAGGGCGCT

lacO reg(5002,5029)>>>
|
T7 prom(4984,5002)>>> XbaI
| | |
4981 aattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataa 5040
TTAATTATGCTGAGTGATATCCCCTTAACACTCGCCTATTGTTAAGGGGAGATCTTTATT

5041 ttttgtttaactttaagaaggagatataccatgggcagcagccatcatcatcatcatcac 5100
AAAACAAATTGAAATTCTTCCTCTATATGGTACCCGTCGTCGGTAGTAGTAGTAGTAGTG

NdeI
|
5101 agcagcggcctggtgccgcgcggcagccatatggctagctacatcacaagtttgtacaaa 5160
TCGTCGCCGGACCACGGCGCGCCGTCGGTATACCGATCGATGTAGTGTTCAAACATGTTT

5161 aaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcat 5220
TTTCGACTTGCTCTTTGCATTTTACTATATTTATAGTTATATAATTTAATCTAAAACGTA

NotI
|
5221 aaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcat 5280
TTTTTTGTCTGATGTATTATGACATTTTGTGTTGTATAGGTCAGTGATACCGCCGGCGTA

5281 taggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagtt 5340
ATCCGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATATTACACACCTAAAACTCAA

ORF_1 rf(3)(5379,6038)>>>
|
CAT marker(5379,6038)>>>
|
5341 aggatccgtcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggat 5400
TCCTAGGCAGCTCTAAAAGTCCTCGATTCCTTCGATTTTACCTCTTTTTTTAGTGACCTA

5401 ataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcag 5460
TATGGTGGCAACTATATAGGGTTACCGTAGCATTTCTTGTAAAACTCCGTAAAGTCAGTC

5461 ttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccg 5520
AACGAGTTACATGGATATTGGTCTGGCAAGTCGACCTATAATGCCGGAAAAATTTCTGGC

5521 taaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatga 5580
ATTTCTTTTTATTCGTGTTCAAAATAGGCCGGAAATAAGTGTAAGAACGGGCGGACTACT

EcoRI
|
5581 atgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtg 5640
TACGAGTAGGCCTTAAGGCATACCGTTACTTTCTGCCACTCGACCACTATACCCTATCAC

5641 ttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtg 5700
AAGTGGGAACAATGTGGCAAAAGGTACTCGTTTGACTTTGCAAAAGTAGCGAGACCTCAC

5701 aataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacg 5760
TTATGGTGCTGCTAAAGGCCGTCAAAGATGTGTATATAAGCGTTCTACACCGCACAATGC

5761 gtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagcca 5820
CACTTTTGGACCGGATAAAGGGATTTCCCAAATAACTCTTATACAAAAAGCAGAGTCGGT

5821 atccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcg 5880
TAGGGACCCACTCAAAGTGGTCAAAACTAAATTTGCACCGGTTATACCTGTTGAAGAAGC

5881 cccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctgg 5940
GGGGGCAAAAGTGGTACCCGTTTATAATATGCGTTCCGCTGTTCCACGACTACGGCGACC

5941 cgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaat 6000
GCTAAGTCCAAGTAGTACGGCAAACACTACCGAAGGTACAGCCGTCTTACGAATTACTTA

6001 tacaacagtactgcgatgagtggcagggcggggcgtaaacgcgtggatccggcttactaa 6060
ATGTTGTCATGACGCTACTCACCGTCCCGCCCCGCATTTGCGCACCTAGGCCGAATGATT

6061 aagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactg 6120
TTCGGTCTATTGTCATACGCATAAACGCGCGACTAAAAACGCCATATTCTTATATATGAC

6121 atatgtatacccgaagtatgtcaaaaagaggtatgctatgaagcagcgtattacagtgac 6180
TATACATATGGGCTTCATACAGTTTTTCTCCATACGATACTTCGTCGCATAATGTCACTG

6181 agttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctg 6240
TCAACTGTCGCTGTCGATAGTCAACGAGTTCCGTATATACTACAGTTATAGAGGCCAGAC

6241 gtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaa 6300
CATTCGTGTTGGTACGTCTTACTTCGGGCAGCAGACGCACGGCTTGCGACCTTTCGCCTT

6301 aatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgac 6360
TTAGTCCTTCCCTACCGACTCCAGCGGGCCAAATAACTTTACTTGCCGAGAAAACGACTG

ccdB other(6380,6685)>>>
|
6361 gagaacaggggctggtgaaatgcagtttaaggtttacacctataaaagagagagccgtta 6420
CTCTTGTCCCCGACCACTTTACGTCAAATTCCAAATGTGGATATTTTCTCTCTCGGCAAT

6421 tcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgat 6480
AGCAGACAAACACCTACATGTCTCACTATAATAACTGTGCGGGCCCGCTGCCTACCACTA

6481 ccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggt 6540
GGGGGACCGGTCACGTGCAGACGACAGTCTATTTCAGAGGGCACTTGAAATGGGCCACCA

6541 gcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctc 6600
CGTATAGCCCCTACTTTCGACCGCGTACTACTGGTGGCTATACCGGTCACACGGCCAGAG

6601 cgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccat 6660
GCAATAGCCCCTTCTTCACCGACTAGAGTCGGTGGCGCTTTTACTGTAGTTTTTGCGGTA

PstI
|
6661 taacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcagg 6720
ATTGGACTACAAGACCCCTTATATTTACAGTCCGAGGGAATATGTGTCGGTCAGACGTCC

6721 tcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgca 6780
AGCTGGTATCACTGACCTATACAACACAAAATGTCATAATACATCAGACAAAAAATACGT

6781 aaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgt 6840
TTTAGATTAAATTATATAACTATAAATATAGTAAAATGCAAAGAGCAAGTCGAAAGAACA

XhoI T7 term(6895,7023)>>>
| |
6841 acaaagtggtgatgtaatgactcgagcaccaccaccaccaccactgagatccggctgcta 6900
TGTTTCACCACTACATTACTGAGCTCGTGGTGGTGGTGGTGGTGACTCTAGGCCGACGAT

6901 acaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataac 6960
TGTTTCGGGCTTTCCTTCGACTCAACCGACGACGGTGGCGACTCGTTATTGATCGTATTG

6961 cccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccg 7020
GGGAACCCCGGAGATTTGCCCAGAACTCCCCAAAAAACGACTTTCCTCCTTGATATAGGC

7021 gat 7023
CTA