pRetroG-CMV-GFP-stop
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepRetroG-CMV-GFP-stop
VectorTypeRetroviral Blank Control Vector
Antibiotic InformationBacterial: Ampicillin
Mammalian: Puromycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


 1 tttgaaagac cccacccgta ggtggcaagc tagcttaagt aacgccactt tgcaaggcat     
61 ggaaaaatac ataactgaga atagaaaagt tcagatcaag gtcaggaaca aagaaacagc
121 tgaataccaa acaggatatc tgtggtaagc ggttcctgcc ccggctcagg gccaagaaca
181 gatgagacag ctgagtgatg ggccaaacag gatatctgtg gtaagcagtt cctgccccgg
241 ctcggggcca agaacagatg gtccccagat gcggtccagc cctcagcagt ttctagtgaa
301 tcatcagatg tttccagggt gccccaagga cctgaaaatg accctgtacc ttatttgaac
361 taaccaatca gttcgcttct cgcttctgtt cgcgcgcttc cgctctccga gctcaataaa
421 agagcccaca acccctcact cggcgcgcca gtcttccgat agactgcgtc gcccgggtac
481 ccgtattccc aataaagcct cttgctgttt gcatccgaat cgtggtctcg ctgttccttg
541 ggagggtctc ctctgagtga ttgactaccc acgacggggg tctttcattt gggggctcgt
601 ccgggatttg gagacccctg cccagggacc accgacccac caccgggagg taagctggcc
661 agcaacttat ctgtgtctgt ccgattgtct agtgtctatg tttgatgtta tgcgcctgcg
721 tctgtactag ttagctaact agctctgtat ctggcggacc cgtggtggaa ctgacgagtt
781 ctgaacaccc ggccgcaacc ctgggagacg tcccagggac tttgggggcc gtttttgtgg
841 cccgacctga ggaagggagt cgatgtggaa tccgaccccg tcaggatatg tggttctggt
901 aggagacgag aacctaaaac agttcccgcc tccgtctgaa tttttgcttt cggtttggaa
961 ccgaagccgc gcgtcttgtc tgctgcagcg ctgcagcatc gttctgtgtt gtctctgtct
1021 gactgtgttt ctgtatttgt ctgaaaatta gggccagact gttaccactc ccttaagttt
1081 gaccttaggt cactggaaag atgtcgagcg gatcgctcac aaccagtcgg tagatgtcaa
1141 gaagagacgt tgggttacct tctgctctgc agaatggcca acctttaacg tcggatggcc
1201 gcgagacggc acctttaacc gagacctcat cacccaggtt aagatcaagg tcttttcacc
1261 tggcccgcat ggacacccag accaggtccc ctacatcgtg acctgggaag ccttggcttt
1321 tgacccccct ccctgggtca agccctttgt acaccctaag cctccgcctc ctcttcctcc
1381 atccgccccg tctctccccc ttgaacctcc tcgttcgacc ccgcctcgat cctcccttta
1441 tccagccctc actccttctc taggcgccgg aatgatcccc cgggctgcag gtcggccgcc
1501 acgaccggtg ccgccaccat cccctgaccc acgcccctga cccctcacaa ggagacgacc
1561 ttccatgacc gagtacaagc ccacggtgcg cctcgccacc cgcgacgacg tcccccgggc
1621 cgtacgcacc ctcgccgccg cgttcgccga ctaccccgcc acgcgccaca ccgtcgaccc
1681 ggaccgccac atcgagcggg tcaccgagct gcaagaactc ttcctcacgc gcgtcgggct
1741 cgacatcggc aaggtgtggg tcgcggacga cggcgccgcg gtggcggtct ggaccacgcc
1801 ggagagcgtc gaagcggggg cggtgttcgc cgagatcggc ccgcgcatgg ccgagttgag
1861 cggttcccgg ctggccgcgc agcaacagat ggaaggcctc ctggcgccgc accggcccaa
1921 ggagcccgcg tggttcctgg ccaccgtcgg cgtctcgccc gaccaccagg gcaagggtct
1981 gggcagcgcc gtcgtgctcc ccggagtgga ggcggccgag cgcgccgggg tgcccgcctt
2041 cctggagacc tccgcgcccc gcaacctccc cttctacgag cggctcggct tcaccgtcac
2101 cgccgacgtc gagtgcccga aggaccgcgc gacctggtgc atgacccgca agcccggtgc
2161 ctgacgcccg ccccacgacc cgcagcgccc gaccgaaagg agcgcacgac cccatggctc
2221 cgaccgaagc cacccggggc ggccccgccg accccgcacc cgcccccgag gcccaccgac
2281 tctagtaata gtaatcaatt acggggtcat tagttcatag cccatatatg gagttccgcg
2341 ttacataact tacggtaaat ggcccgcctg gctgaccgcc caacgacccc cgcccattga
2401 cgtcaataat gacgtatgtt cccatagtaa cgccaatagg gactttccat tgacgtcaat
2461 gggtggagta tttacggtaa actgcccact tggcagtaca tcaagtgtat catatgccaa
2521 gtacgccccc tattgacgtc aatgacggta aatggcccgc ctggcattat gcccagtaca
2581 tgaccttatg ggactttcct acttggcagt acatctacgt attagtcatc gctattacca
2641 tggtgatgcg gttttggcag tacatcaatg ggcgtggata gcggtttgac tcacggggat
2701 ttccaagtct ccaccccatt gacgtcaatg ggagtttgtt ttggcaccaa aatcaacggg
2761 actttccaaa atgtcgtaac aactccgccc cattgacgca aatgggcggt aggcgtgtac
2821 ggtgggaggt ctatataagc agagctggtt tagtgaaccg tcagatccgc tagcgctacc
2881 ggactcagat ctcgaggcca ccatggtgag caagggcgag gagctgttca ccggggtggt
2941 gcccatcctg gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga
3001 gggcgagggc gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa
3061 gctgcccgtg ccctggccca ccctcgtgac caccctgacc tacggcgtgc agtgcttcag
3121 ccgctacccc gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta
3181 cgtccaggag cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt
3241 gaagttcgag ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga
3301 ggacggcaac atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat
3361 catggccgac aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga
3421 ggacggcagc gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc
3481 cgtgctgctg cccgacaacc actacctgag cacccagtcc gccctgagca aagaccccaa
3541 cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg
3601 catggacgag ctgtacaagt aagaattcgt taggccatta aggcctgtcg acaagcggcc
3661 gcctcggcca aacatcgata aaataaaaga ttttatttag tctccagaaa aaggggggaa
3721 tgaaagaccc cacctgtagg tttggcaagc tagcttaagt aacgccattt tgcaaggcat
3781 ggaaaaatac ataactgaga atagagaagt tcagatcaag gtcaggaaca gatggaacag
3841 ctgaatatgg gccaaacagg atatctgtgg taagcagttc ctgccccggc tcagggccaa
3901 gaacagatgg aacagctgaa tatgggccaa acaggatatc tgtggtaagc agttcctgcc
3961 ccggctcagg gccaagaaca gatggtcccc agatgcggtc cagccctcag cagtttctag
4021 agaaccatca gatgtttcca gggtgcccca aggacctgaa atgaccctgt gccttatttg
4081 aactaaccaa tcagttcgct tctcgcttct gttcgcgcgc ttctgctccc cgagctcaat
4141 aaaagagccc acaacccctc actcggggcg ccagtcctcc gattgactga gtcgcccggg
4201 tacccgtgta tccaataaac cctcttgcag ttgcatccga cttgtggtct cgctgttcct
4261 tgggagggtc tcctctgagt gattgactac ccgtcagcgg gggtctttca tttgggggct
4321 cgtccgggat cgggagaccc ctgcccaggg accaccgacc caccaccggg aggtaagctg
4381 gctgcctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga
4441 cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag
4501 cgggtgttgg cgggtgtcgg ggcgcagcca tgacccagtc acgtagcgat agcggagtgt
4561 actgataact tcgtataatg tatgctatac gaagttatta ggtctgaaga ggagtttacg
4621 tccagccaag ctagggccgc gatccggaac ccttaatata acttcgtata atgtatgcta
4681 tacgaagtta tcagtactgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
4741 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgct
4801 cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat
4861 cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga
4921 acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt
4981 ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt
5041 ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc
5101 gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa
5161 gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct
5221 ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta
5281 actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg
5341 gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc
5401 ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta
5461 ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg
5521 gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt
5581 tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg
5641 tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta
5701 aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg
5761 aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg
5821 tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc
5881 gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg
5941 agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg
6001 aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctgcag
6061 gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat
6121 caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc
6181 cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc
6241 ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa
6301 ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaacac
6361 gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt
6421 cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc
6481 gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa
6541 caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca
6601 tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat
6661 acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa
6721 aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc
6781 gtatcacgag gccctttcgt cttcaagaat tgctagcaat tgctagcaat tgctagcaat
6841 tcataccaga tcaccgaaaa ctgtcctcca aatgtgtccc cctcacactc ccaaattcgc
6901 gggcttctgc ctcttagacc actctaccct attccccaca ctcaccggag ccaaagccgc
6961 ggcccttccg tttctttgct
//
                                    LOCUS       dna                      6980 bp                                   
FEATURES Location/Qualifiers
Other Gene 659..1468
/gene="psi_plus_pack other"
ORF 1460..2215
/sequence="ORF_3 rf(5)"
Marker 1565..2164
/gene="puro marker"
Promoter 2786..2867
/gene="CMV prom"
misc_binding 2887..2892
/dbxref="REBASE:BglII"
misc_binding 2891..2896
/dbxref="REBASE:XhoI"
Reporter 2903..3619
/gene="EGFP reporter"
ORF 2903..3622
/sequence="ORF_1 rf(2)"
misc_binding 3623..3628
/dbxref="REBASE:EcoRI"
misc_binding 3655..3662
/dbxref="REBASE:NotI"
misc_binding 3674..3679
/dbxref="REBASE:ClaI"
Other Gene 3761..4312
/gene="5_LTR2 other"
misc_binding 4016..4021
/dbxref="REBASE:XbaI"
Other Gene 4565..4598
/gene="loxP other"
Other Gene 4658..4691
/gene="loxP other"
Rep_Origin 4967..5586
/gene="pBR322 origin"
Marker 5741..6601
/gene="amp marker"
ORF 5741..6601
/sequence="ORF_2 rf(5)"
Promoter 6643..6671
/gene="amp prom"
BASE COUNT 1613 a 2046 c 1802 g 1519 t 0 others
ORIGIN
1 tttgaaagac cccacccgta ggtggcaagc tagcttaagt aacgccactt tgcaaggcat
61 ggaaaaatac ataactgaga atagaaaagt tcagatcaag gtcaggaaca aagaaacagc
121 tgaataccaa acaggatatc tgtggtaagc ggttcctgcc ccggctcagg gccaagaaca
181 gatgagacag ctgagtgatg ggccaaacag gatatctgtg gtaagcagtt cctgccccgg
241 ctcggggcca agaacagatg gtccccagat gcggtccagc cctcagcagt ttctagtgaa
301 tcatcagatg tttccagggt gccccaagga cctgaaaatg accctgtacc ttatttgaac
361 taaccaatca gttcgcttct cgcttctgtt cgcgcgcttc cgctctccga gctcaataaa
421 agagcccaca acccctcact cggcgcgcca gtcttccgat agactgcgtc gcccgggtac
481 ccgtattccc aataaagcct cttgctgttt gcatccgaat cgtggtctcg ctgttccttg
541 ggagggtctc ctctgagtga ttgactaccc acgacggggg tctttcattt gggggctcgt
601 ccgggatttg gagacccctg cccagggacc accgacccac caccgggagg taagctggcc
661 agcaacttat ctgtgtctgt ccgattgtct agtgtctatg tttgatgtta tgcgcctgcg
721 tctgtactag ttagctaact agctctgtat ctggcggacc cgtggtggaa ctgacgagtt
781 ctgaacaccc ggccgcaacc ctgggagacg tcccagggac tttgggggcc gtttttgtgg
841 cccgacctga ggaagggagt cgatgtggaa tccgaccccg tcaggatatg tggttctggt
901 aggagacgag aacctaaaac agttcccgcc tccgtctgaa tttttgcttt cggtttggaa
961 ccgaagccgc gcgtcttgtc tgctgcagcg ctgcagcatc gttctgtgtt gtctctgtct
1021 gactgtgttt ctgtatttgt ctgaaaatta gggccagact gttaccactc ccttaagttt
1081 gaccttaggt cactggaaag atgtcgagcg gatcgctcac aaccagtcgg tagatgtcaa
1141 gaagagacgt tgggttacct tctgctctgc agaatggcca acctttaacg tcggatggcc
1201 gcgagacggc acctttaacc gagacctcat cacccaggtt aagatcaagg tcttttcacc
1261 tggcccgcat ggacacccag accaggtccc ctacatcgtg acctgggaag ccttggcttt
1321 tgacccccct ccctgggtca agccctttgt acaccctaag cctccgcctc ctcttcctcc
1381 atccgccccg tctctccccc ttgaacctcc tcgttcgacc ccgcctcgat cctcccttta
1441 tccagccctc actccttctc taggcgccgg aatgatcccc cgggctgcag gtcggccgcc
1501 acgaccggtg ccgccaccat cccctgaccc acgcccctga cccctcacaa ggagacgacc
1561 ttccatgacc gagtacaagc ccacggtgcg cctcgccacc cgcgacgacg tcccccgggc
1621 cgtacgcacc ctcgccgccg cgttcgccga ctaccccgcc acgcgccaca ccgtcgaccc
1681 ggaccgccac atcgagcggg tcaccgagct gcaagaactc ttcctcacgc gcgtcgggct
1741 cgacatcggc aaggtgtggg tcgcggacga cggcgccgcg gtggcggtct ggaccacgcc
1801 ggagagcgtc gaagcggggg cggtgttcgc cgagatcggc ccgcgcatgg ccgagttgag
1861 cggttcccgg ctggccgcgc agcaacagat ggaaggcctc ctggcgccgc accggcccaa
1921 ggagcccgcg tggttcctgg ccaccgtcgg cgtctcgccc gaccaccagg gcaagggtct
1981 gggcagcgcc gtcgtgctcc ccggagtgga ggcggccgag cgcgccgggg tgcccgcctt
2041 cctggagacc tccgcgcccc gcaacctccc cttctacgag cggctcggct tcaccgtcac
2101 cgccgacgtc gagtgcccga aggaccgcgc gacctggtgc atgacccgca agcccggtgc
2161 ctgacgcccg ccccacgacc cgcagcgccc gaccgaaagg agcgcacgac cccatggctc
2221 cgaccgaagc cacccggggc ggccccgccg accccgcacc cgcccccgag gcccaccgac
2281 tctagtaata gtaatcaatt acggggtcat tagttcatag cccatatatg gagttccgcg
2341 ttacataact tacggtaaat ggcccgcctg gctgaccgcc caacgacccc cgcccattga
2401 cgtcaataat gacgtatgtt cccatagtaa cgccaatagg gactttccat tgacgtcaat
2461 gggtggagta tttacggtaa actgcccact tggcagtaca tcaagtgtat catatgccaa
2521 gtacgccccc tattgacgtc aatgacggta aatggcccgc ctggcattat gcccagtaca
2581 tgaccttatg ggactttcct acttggcagt acatctacgt attagtcatc gctattacca
2641 tggtgatgcg gttttggcag tacatcaatg ggcgtggata gcggtttgac tcacggggat
2701 ttccaagtct ccaccccatt gacgtcaatg ggagtttgtt ttggcaccaa aatcaacggg
2761 actttccaaa atgtcgtaac aactccgccc cattgacgca aatgggcggt aggcgtgtac
2821 ggtgggaggt ctatataagc agagctggtt tagtgaaccg tcagatccgc tagcgctacc
2881 ggactcagat ctcgaggcca ccatggtgag caagggcgag gagctgttca ccggggtggt
2941 gcccatcctg gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga
3001 gggcgagggc gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa
3061 gctgcccgtg ccctggccca ccctcgtgac caccctgacc tacggcgtgc agtgcttcag
3121 ccgctacccc gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta
3181 cgtccaggag cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt
3241 gaagttcgag ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga
3301 ggacggcaac atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat
3361 catggccgac aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga
3421 ggacggcagc gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc
3481 cgtgctgctg cccgacaacc actacctgag cacccagtcc gccctgagca aagaccccaa
3541 cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg
3601 catggacgag ctgtacaagt aagaattcgt taggccatta aggcctgtcg acaagcggcc
3661 gcctcggcca aacatcgata aaataaaaga ttttatttag tctccagaaa aaggggggaa
3721 tgaaagaccc cacctgtagg tttggcaagc tagcttaagt aacgccattt tgcaaggcat
3781 ggaaaaatac ataactgaga atagagaagt tcagatcaag gtcaggaaca gatggaacag
3841 ctgaatatgg gccaaacagg atatctgtgg taagcagttc ctgccccggc tcagggccaa
3901 gaacagatgg aacagctgaa tatgggccaa acaggatatc tgtggtaagc agttcctgcc
3961 ccggctcagg gccaagaaca gatggtcccc agatgcggtc cagccctcag cagtttctag
4021 agaaccatca gatgtttcca gggtgcccca aggacctgaa atgaccctgt gccttatttg
4081 aactaaccaa tcagttcgct tctcgcttct gttcgcgcgc ttctgctccc cgagctcaat
4141 aaaagagccc acaacccctc actcggggcg ccagtcctcc gattgactga gtcgcccggg
4201 tacccgtgta tccaataaac cctcttgcag ttgcatccga cttgtggtct cgctgttcct
4261 tgggagggtc tcctctgagt gattgactac ccgtcagcgg gggtctttca tttgggggct
4321 cgtccgggat cgggagaccc ctgcccaggg accaccgacc caccaccggg aggtaagctg
4381 gctgcctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga
4441 cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag
4501 cgggtgttgg cgggtgtcgg ggcgcagcca tgacccagtc acgtagcgat agcggagtgt
4561 actgataact tcgtataatg tatgctatac gaagttatta ggtctgaaga ggagtttacg
4621 tccagccaag ctagggccgc gatccggaac ccttaatata acttcgtata atgtatgcta
4681 tacgaagtta tcagtactgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
4741 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgct
4801 cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat
4861 cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga
4921 acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt
4981 ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt
5041 ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc
5101 gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa
5161 gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct
5221 ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta
5281 actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg
5341 gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc
5401 ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta
5461 ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg
5521 gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt
5581 tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg
5641 tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta
5701 aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg
5761 aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg
5821 tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc
5881 gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg
5941 agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg
6001 aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctgcag
6061 gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat
6121 caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc
6181 cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc
6241 ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa
6301 ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaacac
6361 gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt
6421 cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc
6481 gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa
6541 caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca
6601 tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat
6661 acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa
6721 aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc
6781 gtatcacgag gccctttcgt cttcaagaat tgctagcaat tgctagcaat tgctagcaat
6841 tcataccaga tcaccgaaaa ctgtcctcca aatgtgtccc cctcacactc ccaaattcgc
6901 gggcttctgc ctcttagacc actctaccct attccccaca ctcaccggag ccaaagccgc
6961 ggcccttccg tttctttgct
//
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     tttgaaagaccccacccgtaggtggcaagctagcttaagtaacgccactttgcaaggcat 60
AAACTTTCTGGGGTGGGCATCCACCGTTCGATCGAATTCATTGCGGTGAAACGTTCCGTA

61 ggaaaaatacataactgagaatagaaaagttcagatcaaggtcaggaacaaagaaacagc 120
CCTTTTTATGTATTGACTCTTATCTTTTCAAGTCTAGTTCCAGTCCTTGTTTCTTTGTCG

121 tgaataccaaacaggatatctgtggtaagcggttcctgccccggctcagggccaagaaca 180
ACTTATGGTTTGTCCTATAGACACCATTCGCCAAGGACGGGGCCGAGTCCCGGTTCTTGT

181 gatgagacagctgagtgatgggccaaacaggatatctgtggtaagcagttcctgccccgg 240
CTACTCTGTCGACTCACTACCCGGTTTGTCCTATAGACACCATTCGTCAAGGACGGGGCC

241 ctcggggccaagaacagatggtccccagatgcggtccagccctcagcagtttctagtgaa 300
GAGCCCCGGTTCTTGTCTACCAGGGGTCTACGCCAGGTCGGGAGTCGTCAAAGATCACTT

301 tcatcagatgtttccagggtgccccaaggacctgaaaatgaccctgtaccttatttgaac 360
AGTAGTCTACAAAGGTCCCACGGGGTTCCTGGACTTTTACTGGGACATGGAATAAACTTG

361 taaccaatcagttcgcttctcgcttctgttcgcgcgcttccgctctccgagctcaataaa 420
ATTGGTTAGTCAAGCGAAGAGCGAAGACAAGCGCGCGAAGGCGAGAGGCTCGAGTTATTT

421 agagcccacaacccctcactcggcgcgccagtcttccgatagactgcgtcgcccgggtac 480
TCTCGGGTGTTGGGGAGTGAGCCGCGCGGTCAGAAGGCTATCTGACGCAGCGGGCCCATG

481 ccgtattcccaataaagcctcttgctgtttgcatccgaatcgtggtctcgctgttccttg 540
GGCATAAGGGTTATTTCGGAGAACGACAAACGTAGGCTTAGCACCAGAGCGACAAGGAAC

541 ggagggtctcctctgagtgattgactacccacgacgggggtctttcatttgggggctcgt 600
CCTCCCAGAGGAGACTCACTAACTGATGGGTGCTGCCCCCAGAAAGTAAACCCCCGAGCA

psi_plus_pack other(659,1468)>>>
|
601 ccgggatttggagacccctgcccagggaccaccgacccaccaccgggaggtaagctggcc 660
GGCCCTAAACCTCTGGGGACGGGTCCCTGGTGGCTGGGTGGTGGCCCTCCATTCGACCGG

661 agcaacttatctgtgtctgtccgattgtctagtgtctatgtttgatgttatgcgcctgcg 720
TCGTTGAATAGACACAGACAGGCTAACAGATCACAGATACAAACTACAATACGCGGACGC

721 tctgtactagttagctaactagctctgtatctggcggacccgtggtggaactgacgagtt 780
AGACATGATCAATCGATTGATCGAGACATAGACCGCCTGGGCACCACCTTGACTGCTCAA

781 ctgaacacccggccgcaaccctgggagacgtcccagggactttgggggccgtttttgtgg 840
GACTTGTGGGCCGGCGTTGGGACCCTCTGCAGGGTCCCTGAAACCCCCGGCAAAAACACC

841 cccgacctgaggaagggagtcgatgtggaatccgaccccgtcaggatatgtggttctggt 900
GGGCTGGACTCCTTCCCTCAGCTACACCTTAGGCTGGGGCAGTCCTATACACCAAGACCA

901 aggagacgagaacctaaaacagttcccgcctccgtctgaatttttgctttcggtttggaa 960
TCCTCTGCTCTTGGATTTTGTCAAGGGCGGAGGCAGACTTAAAAACGAAAGCCAAACCTT

961 ccgaagccgcgcgtcttgtctgctgcagcgctgcagcatcgttctgtgttgtctctgtct 1020
GGCTTCGGCGCGCAGAACAGACGACGTCGCGACGTCGTAGCAAGACACAACAGAGACAGA

1021 gactgtgtttctgtatttgtctgaaaattagggccagactgttaccactcccttaagttt 1080
CTGACACAAAGACATAAACAGACTTTTAATCCCGGTCTGACAATGGTGAGGGAATTCAAA

1081 gaccttaggtcactggaaagatgtcgagcggatcgctcacaaccagtcggtagatgtcaa 1140
CTGGAATCCAGTGACCTTTCTACAGCTCGCCTAGCGAGTGTTGGTCAGCCATCTACAGTT

1141 gaagagacgttgggttaccttctgctctgcagaatggccaacctttaacgtcggatggcc 1200
CTTCTCTGCAACCCAATGGAAGACGAGACGTCTTACCGGTTGGAAATTGCAGCCTACCGG

1201 gcgagacggcacctttaaccgagacctcatcacccaggttaagatcaaggtcttttcacc 1260
CGCTCTGCCGTGGAAATTGGCTCTGGAGTAGTGGGTCCAATTCTAGTTCCAGAAAAGTGG

1261 tggcccgcatggacacccagaccaggtcccctacatcgtgacctgggaagccttggcttt 1320
ACCGGGCGTACCTGTGGGTCTGGTCCAGGGGATGTAGCACTGGACCCTTCGGAACCGAAA

1321 tgacccccctccctgggtcaagccctttgtacaccctaagcctccgcctcctcttcctcc 1380
ACTGGGGGGAGGGACCCAGTTCGGGAAACATGTGGGATTCGGAGGCGGAGGAGAAGGAGG

1381 atccgccccgtctctcccccttgaacctcctcgttcgaccccgcctcgatcctcccttta 1440
TAGGCGGGGCAGAGAGGGGGAACTTGGAGGAGCAAGCTGGGGCGGAGCTAGGAGGGAAAT

ORF_3 rf(5)(1460,2215)<<<
|
1441 tccagccctcactccttctctaggcgccggaatgatcccccgggctgcaggtcggccgcc 1500
AGGTCGGGAGTGAGGAAGAGATCCGCGGCCTTACTAGGGGGCCCGACGTCCAGCCGGCGG

1501 acgaccggtgccgccaccatcccctgacccacgcccctgacccctcacaaggagacgacc 1560
TGCTGGCCACGGCGGTGGTAGGGGACTGGGTGCGGGGACTGGGGAGTGTTCCTCTGCTGG

puro marker(1565,2164)>>>
|
1561 ttccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtcccccgggc 1620
AAGGTACTGGCTCATGTTCGGGTGCCACGCGGAGCGGTGGGCGCTGCTGCAGGGGGCCCG

1621 cgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgaccc 1680
GCATGCGTGGGAGCGGCGGCGCAAGCGGCTGATGGGGCGGTGCGCGGTGTGGCAGCTGGG

1681 ggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggct 1740
CCTGGCGGTGTAGCTCGCCCAGTGGCTCGACGTTCTTGAGAAGGAGTGCGCGCAGCCCGA

1741 cgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgcc 1800
GCTGTAGCCGTTCCACACCCAGCGCCTGCTGCCGCGGCGCCACCGCCAGACCTGGTGCGG

1801 ggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgag 1860
CCTCTCGCAGCTTCGCCCCCGCCACAAGCGGCTCTAGCCGGGCGCGTACCGGCTCAACTC

1861 cggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaa 1920
GCCAAGGGCCGACCGGCGCGTCGTTGTCTACCTTCCGGAGGACCGCGGCGTGGCCGGGTT

1921 ggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtct 1980
CCTCGGGCGCACCAAGGACCGGTGGCAGCCGCAGAGCGGGCTGGTGGTCCCGTTCCCAGA

1981 gggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgcctt 2040
CCCGTCGCGGCAGCACGAGGGGCCTCACCTCCGCCGGCTCGCGCGGCCCCACGGGCGGAA

2041 cctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcac 2100
GGACCTCTGGAGGCGCGGGGCGTTGGAGGGGAAGATGCTCGCCGAGCCGAAGTGGCAGTG

2101 cgccgacgtcgagtgcccgaaggaccgcgcgacctggtgcatgacccgcaagcccggtgc 2160
GCGGCTGCAGCTCACGGGCTTCCTGGCGCGCTGGACCACGTACTGGGCGTTCGGGCCACG

2161 ctgacgcccgccccacgacccgcagcgcccgaccgaaaggagcgcacgaccccatggctc 2220
GACTGCGGGCGGGGTGCTGGGCGTCGCGGGCTGGCTTTCCTCGCGTGCTGGGGTACCGAG

2221 cgaccgaagccACCCGgggcggccccgccgaccccgcacccgcccccgaggcccaccgac 2280
GCTGGCTTCGGTGGGCCCCGCCGGGGCGGCTGGGGCGTGGGCGGGGGCTCCGGGTGGCTG

2281 tctagtaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcg 2340
AGATCATTATCATTAGTTAATGCCCCAGTAATCAAGTATCGGGTATATACCTCAAGGCGC

2341 ttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattga 2400
AATGTATTGAATGCCATTTACCGGGCGGACCGACTGGCGGGTTGCTGGGGGCGGGTAACT

2401 cgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaat 2460
GCAGTTATTACTGCATACAAGGGTATCATTGCGGTTATCCCTGAAAGGTAACTGCAGTTA

2461 gggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaa 2520
CCCACCTCATAAATGCCATTTGACGGGTGAACCGTCATGTAGTTCACATAGTATACGGTT

2521 gtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtaca 2580
CATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGACCGTAATACGGGTCATGT

2581 tgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattacca 2640
ACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCATAATCAGTAGCGATAATGGT

2641 tggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggat 2700
ACCACTACGCCAAAACCGTCATGTAGTTACCCGCACCTATCGCCAAACTGAGTGCCCCTA

2701 ttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacggg 2760
AAGGTTCAGAGGTGGGGTAACTGCAGTTACCCTCAAACAAAACCGTGGTTTTAGTTGCCC

CMV prom(2786,2867)>>>
|
2761 actttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtac 2820
TGAAAGGTTTTACAGCATTGTTGAGGCGGGGTAACTGCGTTTACCCGCCATCCGCACATG

2821 ggtgggaggtctatataagcagagctggtttagtgaaccgtcagatccgctagcgctacc 2880
CCACCCTCCAGATATATTCGTCTCGACCAAATCACTTGGCAGTCTAGGCGATCGCGATGG

XhoI EGFP reporter(2903,3619)>>>
| |
BglII ORF_1 rf(2)(2903,3622)>>>
| | |
2881 ggactcagatctcgaggccaccatggtgagcaagggcgaggagctgttcaccggggtggt 2940
CCTGAGTCTAGAGCTCCGGTGGTACCACTCGTTCCCGCTCCTCGACAAGTGGCCCCACCA

2941 gcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcga 3000
CGGGTAGGACCAGCTCGACCTGCCGCTGCATTTGCCGGTGTTCAAGTCGCACAGGCCGCT

3001 gggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaa 3060
CCCGCTCCCGCTACGGTGGATGCCGTTCGACTGGGACTTCAAGTAGACGTGGTGGCCGTT

3061 gctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcag 3120
CGACGGGCACGGGACCGGGTGGGAGCACTGGTGGGACTGGATGCCGCACGTCACGAAGTC

3121 ccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggcta 3180
GGCGATGGGGCTGGTGTACTTCGTCGTGCTGAAGAAGTTCAGGCGGTACGGGCTTCCGAT

3181 cgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggt 3240
GCAGGTCCTCGCGTGGTAGAAGAAGTTCCTGCTGCCGTTGATGTTCTGGGCGCGGCTCCA

3241 gaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaagga 3300
CTTCAAGCTCCCGCTGTGGGACCACTTGGCGTAGCTCGACTTCCCGTAGCTGAAGTTCCT

3301 ggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatat 3360
CCTGCCGTTGTAGGACCCCGTGTTCGACCTCATGTTGATGTTGTCGGTGTTGCAGATATA

3361 catggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcga 3420
GTACCGGCTGTTCGTCTTCTTGCCGTAGTTCCACTTGAAGTTCTAGGCGGTGTTGTAGCT

3421 ggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccc 3480
CCTGCCGTCGCACGTCGAGCGGCTGGTGATGGTCGTCTTGTGGGGGTAGCCGCTGCCGGG

3481 cgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaa 3540
GCACGACGACGGGCTGTTGGTGATGGACTCGTGGGTCAGGCGGGACTCGTTTCTGGGGTT

3541 cgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcgg 3600
GCTCTTCGCGCTAGTGTACCAGGACGACCTCAAGCACTGGCGGCGGCCCTAGTGAGAGCC

EcoRI NotI
| |
3601 catggacgagctgtacaagtaagaattcgttaggccattaaggcctgtcgacaagcggcc 3660
GTACCTGCTCGACATGTTCATTCTTAAGCAATCCGGTAATTCCGGACAGCTGTTCGCCGG

ClaI
|
3661 gcctcggccaaacatcgataaaataaaagattttatttagtctccagaaaaaggggggaa 3720
CGGAGCCGGTTTGTAGCTATTTTATTTTCTAAAATAAATCAGAGGTCTTTTTCCCCCCTT

5_LTR2 other(3761,4312)>>>
|
3721 tgaaagaccccacctgtaggtttggcaagctagcttaagtaacgccattttgcaaggcat 3780
ACTTTCTGGGGTGGACATCCAAACCGTTCGATCGAATTCATTGCGGTAAAACGTTCCGTA

3781 ggaaaaatacataactgagaatagagaagttcagatcaaggtcaggaacagatggaacag 3840
CCTTTTTATGTATTGACTCTTATCTCTTCAAGTCTAGTTCCAGTCCTTGTCTACCTTGTC

3841 ctgaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaa 3900
GACTTATACCCGGTTTGTCCTATAGACACCATTCGTCAAGGACGGGGCCGAGTCCCGGTT

3901 gaacagatggaacagctgaatatgggccaaacaggatatctgtggtaagcagttcctgcc 3960
CTTGTCTACCTTGTCGACTTATACCCGGTTTGTCCTATAGACACCATTCGTCAAGGACGG

XbaI
|
3961 ccggctcagggccaagaacagatggtccccagatgcggtccagccctcagcagtttctag 4020
GGCCGAGTCCCGGTTCTTGTCTACCAGGGGTCTACGCCAGGTCGGGAGTCGTCAAAGATC

4021 agaaccatcagatgtttccagggtgccccaaggacctgaaatgaccctgtgccttatttg 4080
TCTTGGTAGTCTACAAAGGTCCCACGGGGTTCCTGGACTTTACTGGGACACGGAATAAAC

4081 aactaaccaatcagttcgcttctcgcttctgttcgcgcgcttctgctccccgagctcaat 4140
TTGATTGGTTAGTCAAGCGAAGAGCGAAGACAAGCGCGCGAAGACGAGGGGCTCGAGTTA

4141 aaaagagcccacaacccctcactcggggcgccagtcctccgattgactgagtcgcccggg 4200
TTTTCTCGGGTGTTGGGGAGTGAGCCCCGCGGTCAGGAGGCTAACTGACTCAGCGGGCCC

4201 tacccgtgtatccaataaaccctcttgcagttgcatccgacttgtggtctcgctgttcct 4260
ATGGGCACATAGGTTATTTGGGAGAACGTCAACGTAGGCTGAACACCAGAGCGACAAGGA

4261 tgggagggtctcctctgagtgattgactacccgtcagcgggggtctttcatttgggggct 4320
ACCCTCCCAGAGGAGACTCACTAACTGATGGGCAGTCGCCCCCAGAAAGTAAACCCCCGA

4321 cgtccgggatcgggagacccctgcccagggaccaccgacccaccaccgggaggtaagctg 4380
GCAGGCCCTAGCCCTCTGGGGACGGGTCCCTGGTGGCTGGGTGGTGGCCCTCCATTCGAC

4381 gctgcctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggaga 4440
CGACGGAGCGCGCAAAGCCACTACTGCCACTTTTGGAGACTGTGTACGTCGAGGGCCTCT

4441 cggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcag 4500
GCCAGTGTCGAACAGACATTCGCCTACGGCCCTCGTCTGTTCGGGCAGTCCCGCGCAGTC

4501 cgggtgttggcgggtgtcggggcgcagccatgacccagtcacgtagcgatagcggagtgt 4560
GCCCACAACCGCCCACAGCCCCGCGTCGGTACTGGGTCAGTGCATCGCTATCGCCTCACA

loxP other(4565,4598)<<<
|
4561 actgataacttcgtataatgtatgctatacgaagttattaggtctgaagaggagtttacg 4620
TGACTATTGAAGCATATTACATACGATATGCTTCAATAATCCAGACTTCTCCTCAAATGC

loxP other(4658,4691)<<<
|
4621 tccagccaagctagggccgcgatccggaacccttaatataacttcgtataatgtatgcta 4680
AGGTCGGTTCGATCCCGGCGCTAGGCCTTGGGAATTATATTGAAGCATATTACATACGAT

4681 tacgaagttatcagtactggcttaactatgcggcatcagagcagattgtactgagagtgc 4740
ATGCTTCAATAGTCATGACCGAATTGATACGCCGTAGTCTCGTCTAACATGACTCTCACG

4741 accatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgct 4800
TGGTATACGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGA

4801 cttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtat 4860
GAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATA

4861 cagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaaga 4920
GTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCT

pBR322 origin(4967,5586)<<<
|
4921 acatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgt 4980
TGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCA

4981 ttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggt 5040
AAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCA

5041 ggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc 5100
CCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACG

5101 gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaa 5160
CGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTT

5161 gcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgct 5220
CGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGCCACATCCAGCAAGCGA

5221 ccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggta 5280
GGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCAT

5281 actatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactg 5340
TGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGAC

5341 gtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggc 5400
CATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTCAAGAACTTCACCACCG

5401 ctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagtta 5460
GATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCGAGACGACTTCGGTCAAT

5461 ccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtg 5520
GGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCAC

5521 gtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctt 5580
CAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAA

5581 tgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttgg 5640
ACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACC

5641 tcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagtttta 5700
AGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTAATTTTTACTTCAAAAT

amp marker(5741,6601)<<<
|
ORF_2 rf(5)(5741,6601)<<<
|
5701 aatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtg 5760
TTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAATGGTTACGAATTAGTCAC

5761 aggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcg 5820
TCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGC

5821 tgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgc 5880
ACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCACGACGTTACTATGGCG

5881 gagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccg 5940
CTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGC

5941 agcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccggg 6000
TCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGATAATTAACAACGGCCC

6001 aagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctgcag 6060
TTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAACAACGGTAACGACGTC

6061 gcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgat 6120
CGTAGCACCACAGTGCGAGCAGCAAACCATACCGAAGTAAGTCGAGGCCAAGGGTTGCTA

6121 caaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctc 6180
GTTCCGCTCAATGTACTAGGGGGTACAACACGTTTTTTCGCCAATCGAGGAAGCCAGGAG

6181 cgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgc 6240
GCTAGCAACAGTCTTCATTCAACCGGCGTCACAATAGTGAGTACCAATACCGTCGTGACG

6241 ataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaa 6300
TATTAAGAGAATGACAGTACGGTAGGCATTCTACGAAAAGACACTGACCACTCATGAGTT

6301 ccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaacac 6360
GGTTCAGTAAGACTCTTATCACATACGCCGCTGGCTCAACGAGAACGGGCCGCAGTTGTG

6361 gggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttctt 6420
CCCTATTATGGCGCGGTGTATCGTCTTGAAATTTTCACGAGTAGTAACCTTTTGCAAGAA

6421 cggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactc 6480
GCCCCGCTTTTGAGAGTTCCTAGAATGGCGACAACTCTAGGTCAAGCTACATTGGGTGAG

6481 gtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaa 6540
CACGTGGGTTGACTAGAAGTCGTAGAAAATGAAAGTGGTCGCAAAGACCCACTCGTTTTT

6541 caggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactca 6600
GTCCTTCCGTTTTACGGCGTTTTTTCCCTTATTCCCGCTGTGCCTTTACAACTTATGAGT

amp prom(6643,6671)<<<
|
6601 tactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggat 6660
ATGAGAAGGAAAAAGTTATAATAACTTCGTAAATAGTCCCAATAACAGAGTACTCGCCTA

6661 acatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaa 6720
TGTATAAACTTACATAAATCTTTTTATTTGTTTATCCCCAAGGCGCGTGTAAAGGGGCTT

6721 aagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggc 6780
TTCACGGTGGACTGCAGATTCTTTGGTAATAATAGTACTGTAATTGGATATTTTTATCCG

6781 gtatcacgaggccctttcgtcttcaagaattgctagcaattgctagcaattgctagcaat 6840
CATAGTGCTCCGGGAAAGCAGAAGTTCTTAACGATCGTTAACGATCGTTAACGATCGTTA

6841 tcataccagatcaccgaaaactgtcctccaaatgtgtccccctcacactcccaaattcgc 6900
AGTATGGTCTAGTGGCTTTTGACAGGAGGTTTACACAGGGGGAGTGTGAGGGTTTAAGCG

6901 gggcttctgcctcttagaccactctaccctattccccacactcaccggagccaaagccgc 6960
CCCGAAGACGGAGAATCTGGTGAGATGGGATAAGGGGTGTGAGTGGCCTCGGTTTCGGCG

6961 ggcccttccgtttctttgct 6980
CCGGGAAGGCAAAGAAACGA
                                    LOCUS       dna                      6980 bp                                   
FEATURES Location/Qualifiers
Other Gene 659..1468
/gene="psi_plus_pack other"
ORF 1460..2215
/sequence="ORF_3 rf(5)"
Marker 1565..2164
/gene="puro marker"
Promoter 2786..2867
/gene="CMV prom"
misc_binding 2887..2892
/dbxref="REBASE:BglII"
misc_binding 2891..2896
/dbxref="REBASE:XhoI"
Reporter 2903..3619
/gene="EGFP reporter"
ORF 2903..3622
/sequence="ORF_1 rf(2)"
misc_binding 3623..3628
/dbxref="REBASE:EcoRI"
misc_binding 3655..3662
/dbxref="REBASE:NotI"
misc_binding 3674..3679
/dbxref="REBASE:ClaI"
Other Gene 3761..4312
/gene="5_LTR2 other"
misc_binding 4016..4021
/dbxref="REBASE:XbaI"
Other Gene 4565..4598
/gene="loxP other"
Other Gene 4658..4691
/gene="loxP other"
Rep_Origin 4967..5586
/gene="pBR322 origin"
Marker 5741..6601
/gene="amp marker"
ORF 5741..6601
/sequence="ORF_2 rf(5)"
Promoter 6643..6671
/gene="amp prom"
BASE COUNT 1613 a 2046 c 1802 g 1519 t 0 others