pAAV-G-CAGGS
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepAAV-G-CAGGS
VectorTypeAAV Vector
Antibiotic InformationBacterial: Kanamycin
Sequencing PrimersCAGGS sequencing primer:
5`---GCA ACG TGC TGG TTG TTG---3`
AAV insert reverse primer:
5`---CAC TGC ATT CTA GTT GTG GTT TGT CC---3`
Additional InformationThe gene expression is driven by a CAGGS promoter, without a reporter.
Original Vector: 7648bp
Vector without Insert Casette: 5941bp
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta acctgcgcgc tcgctcgctc     
      481 actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg     
      541 agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc cttgtagtta     
      601 atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat cgcctaggcc     
      661 ggccacgcgt ggcgcgttga cattgattat tgactagtta ttaatagtaa tcaattacgg     
      721 ggtcattagt tcatagccca tatatggagt tccgcgttac ataacttacg gtaaatggcc     
      781 cgcctggctg accgcccaac gacccccgcc cattgacgtc aataatgacg tatgttccca     
      841 tagtaacgcc aatagggact ttccattgac gtcaatgggt ggactattta cggtaaactg     
      901 cccacttggc agtacatcaa gtgtatcata tgccaagtac gccccctatt gacgtcaatg     
      961 acggtaaatg gcccgcctgg cattatgccc agtacatgac cttatgggac tttcctactt     
     1021 ggcagtacat ctacgtatta gtcatcgcta ttaccatggg tcgaggtgag ccccacgttc     
     1081 tgcttcactc tccccatctc ccccccctcc ccacccccaa ttttgtattt atttattttt     
     1141 taattatttt gtgcagcgat gggggcgggg gggggggggc gcgcgccagg cggggcgggg     
     1201 cggggcgagg ggcggggcgg ggcgaggcgg agaggtgcgg cggcagccaa tcagagcggc     
     1261 gcgctccgaa agtttccttt tatggcgagg cggcggcggc ggcggcccta taaaaagcga     
     1321 agcgcgcggc gggcgggagt cgctgcgttg ccttcgcccc gtgccccgct ccgcgccgcc     
     1381 tcgcgccgcc cgccccggct ctgactgacc gcgttactcc cacaggtgag cgggcgggac     
     1441 ggcccttctc ctccgggctg taattagcgc ttggtttaat gacggctcgt ttcttttctg     
     1501 tggctgcgtg aaagccttaa agggctccgg gagggccctt tgtgcggggg ggagcggctc     
     1561 ggggggtgcg tgcgtgtgtg tgtgcgtggg gagcgccgcg tgcggcccgc gctgcccggc     
     1621 ggctgtgagc gctgcgggcg cggcgcgggg ctttgtgcgc tccgcgtgtg cgcgagggga     
     1681 gcgcggccgg gggcggtgcc ccgcggtgcg ggggggctgc gaggggaaca aaggctgcgt     
     1741 gcggggtgtg tgcgtggggg ggtgagcagg gggtgtgggc gcggcggtcg ggctgtaacc     
     1801 cccccctgca cccccctccc cgagttgctg agcacggccc ggcttcgggt gcggggctcc     
     1861 gtgcggggcg tggcgcgggg ctcgccgtgc cgggcggggg gtggcggcag gtgggggtgc     
     1921 cgggcggggc ggggccgcct cgggccgggg agggctcggg ggaggggcgc ggcggccccg     
     1981 gagcgccggc ggctgtcgag gcgcggcgag ccgcagccat tgccttttat ggtaatcgtg     
     2041 cgagagggcg cagggacttc ctttgtccca aatctggcgg agccgaaatc tgggaggcgc     
     2101 cgccgcaccc cctctagcgg gcgcgggcga agcggtgcgg cgccggcagg aaggaaatgg     
     2161 gcggggaggg ccttcgtgcg tcgccgcgcc gccgtcccct tctccatctc cagcctcggg     
     2221 gctgccgcag ggggacggct gccttcgggg gggacggggc agggcggggt tcggcttctg     
     2281 gcgtgtgacc ggcggctcta gagcctctgc taaccatgtt catgccttct tctttttcct     
     2341 acagctcctg ggcaacgtgc tggttgttgt gctgtctcat cattttggca aagaattggc     
     2401 gcgccgagct cgtttagtga accgtcagat cgcctggaga cgccatccac gctgttttga     
     2461 cctccataga agaaccgagt ttaaactccc tatcagtgat agagatctcc ctatcagtga     
     2521 tagagagcta gcgatatcaa caagtttgta caaaaaagct gaacgagaaa cgtaaaatga     
     2581 tataaatatc aatatattaa attagatttt gcataaaaaa cagactacat aatactgtaa     
     2641 aacacaacat atccagtcac tatggcggcc gcattaggca ccccaggctt tacactttat     
     2701 gcttccggct cgtataatgt gtggattttg agttaggatc cgtcgagatt ttcaggagct     
     2761 aaggaagcta aaatggagaa aaaaatcact ggatatacca ccgttgatat atcccaatgg     
     2821 catcgtaaag aacattttga ggcatttcag tcagttgctc aatgtaccta taaccagacc     
     2881 gttcagctgg atattacggc ctttttaaag accgtaaaga aaaataagca caagttttat     
     2941 ccggccttta ttcacattct tgcccgcctg atgaatgctc atccggaatt ccgtatggca     
     3001 atgaaagacg gtgagctggt gatatgggat agtgttcacc cttgttacac cgttttccat     
     3061 gagcaaactg aaacgttttc atcgctctgg agtgaatacc acgacgattt ccggcagttt     
     3121 ctacacatat attcgcaaga tgtggcgtgt tacggtgaaa acctggccta tttccctaaa     
     3181 gggtttattg agaatatgtt tttcgtctca gccaatccct gggtgagttt caccagtttt     
     3241 gatttaaacg tggccaatat ggacaacttc ttcgcccccg ttttcaccat gggcaaatat     
     3301 tatacgcaag gcgacaaggt gctgatgccg ctggcgattc aggttcatca tgccgtttgt     
     3361 gatggcttcc atgtcggcag aatgcttaat gaattacaac agtactgcga tgagtggcag     
     3421 ggcggggcgt aaagatctgg atccggctta ctaaaagcca gataacagta tgcgtatttg     
     3481 cgcgctgatt tttgcggtat aagaatatat actgatatgt atacccgaag tatgtcaaaa     
     3541 agaggtatgc tatgaagcag cgtattacag tgacagttga cagcgacagc tatcagttgc     
     3601 tcaaggcata tatgatgtca atatctccgg tctggtaagc acaaccatgc agaatgaagc     
     3661 ccgtcgtctg cgtgccgaac gctggaaagc ggaaaatcag gaagggatgg ctgaggtcgc     
     3721 ccggtttatt gaaatgaacg gctcttttgc tgacgagaac aggggctggt gaaatgcagt     
     3781 ttaaggttta cacctataaa agagagagcc gttatcgtct gtttgtggat gtacagagtg     
     3841 atattattga cacgcccggg cgacggatgg tgatccccct ggccagtgca cgtctgctgt     
     3901 cagataaagt ctcccgtgaa ctttacccgg tggtgcatat cggggatgaa agctggcgca     
     3961 tgatgaccac cgatatggcc agtgtgccgg tctccgttat cggggaagaa gtggctgatc     
     4021 tcagccaccg cgaaaatgac atcaaaaacg ccattaacct gatgttctgg ggaatataaa     
     4081 tgtcaggctc ccttatacac agccagtctg caggtcgacc atagtgactg gatatgttgt     
     4141 gttttacagt attatgtagt ctgtttttta tgcaaaatct aatttaatat attgatattt     
     4201 atatcatttt acgtttctcg ttcagctttc ttgtacaaag tggttgatat ctgactcgag     
     4261 tacccatacg acgtcccaga ctacgctacg cgtcttaagg cgatcgcaga catgataaga     
     4321 tacattgatg agtttggaca aaccacaact agaatgcagt gaaaaaaatg ctttatttgt     
     4381 gaaatttgtg atgctattgc tttatttgta accattataa gctgcaataa acaagttaat     
     4441 aacaacaatt ccattcattt tatgtttcag gttcaggggg agatgtggga ggttttttaa     
     4501 agcaagtaaa acctctacaa atgtggtagt cgaaattccc gataaggatc ttcctagagc     
     4561 atggctacgt agataagtag catggcgggt taatcattaa ctacaaggaa cccctagtga     
     4621 tggagttggc cactccctct ctgcgcgctc gctcgctcac tgaggccggg cgaccaaagg     
     4681 tcgcccgacg cccgggcttt gcccgggcgg cctcagtgag cgagcgagcg cgcagggatc     
     4741 ccggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc     
     4801 ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca     
     4861 ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg     
     4921 agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca     
     4981 taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa     
     5041 cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc     
     5101 tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc     
     5161 gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct     
     5221 gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg     
     5281 tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag     
     5341 gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta     
     5401 cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg     
     5461 aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt     
     5521 tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt     
     5581 ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag     
     5641 attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat     
     5701 ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc     
     5761 tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat     
     5821 aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc     
     5881 acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag     
     5941 aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag     
     6001 agtaagtagt tcgccagtta atagtttgcg caacgttgtt gaaaaaggat cttcacctag     
     6061 atccttttca cgtagaaagc cagtccgcag aaacggtgct gaccccggat gaatgtcagc     
     6121 tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt agcttgcagt     
     6181 gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga accggaattg     
     6241 ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg gatggctttc     
     6301 tcgccgccaa ggatctgatg gcgcagggga tcaagctctg atcaagagac aggatgagga     
     6361 tcgtttcgca tgattgaaca agatggattg cacgcaggtt ctccggccgc ttgggtggag     
     6421 aggctattcg gctatgactg ggcacaacag acaatcggct gctctgatgc cgccgtgttc     
     6481 cggctgtcag cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc cggtgccctg     
     6541 aatgaactgc aagacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc     
     6601 gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt gggcgaagtg     
     6661 ccggggcagg atctcctgtc atctcacctt gctcctgccg agaaagtatc catcatggct     
     6721 gatgcaatgc ggcggctgca tacgcttgat ccggctacct gcccattcga ccaccaagcg     
     6781 aaacatcgca tcgagcgagc acgtactcgg atggaagccg gtcttgtcga tcaggatgat     
     6841 ctggacgaag agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgagc     
     6901 atgcccgacg gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc gaatatcatg     
     6961 gtggaaaatg gccgcttttc tggattcatc gactgtggcc ggctgggtgt ggcggaccgc     
     7021 tatcaggaca tagcgttggc tacccgtgat attgctgaag agcttggcgg cgaatgggct     
     7081 gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat cgccttctat     
     7141 cgccttcttg acgagttctt ctgaattttg ttaaaatttt tgttaaatca gctcattttt     
     7201 taaccaatag gccgaaatcg gcaacatccc ttataaatca aaagaataga ccgcgatagg     
     7261 gttgagtgtt gttccagttt ggaacaagag tccactatta aagaacgtgg actccaacgt     
     7321 caaagggcga aaaaccgtct atcagggcga tggcccacta cgtgaaccat cacccaaatc     
     7381 aagttttttg cggtcgaggt gccgtaaagc tctaaatcgg aaccctaaag ggagcccccg     
     7441 atttagagct tgacggggaa agccggcgaa cgtggcgaga aaggaaggga agaaagcgaa     
     7501 aggagcgggc gctagggcgc tggcaagtgt agcggtcacg ctgcgcgtaa ccaccacacc     
     7561 cgcgcgctta atgcgccgct acagggcgcg tccattcgcc attcaggatc gaattaattc     
     7621 ttaattaaca tcatcaataa tatacctt
                                    LOCUS       dna                      7648 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    457..462
                     /dbxref="REBASE:HpaI"
     misc_binding    927..932
                     /dbxref="REBASE:NdeI"
     Promoter        1059..1336
                     /gene="cBA prom"
     ORF             1476..2207
                     /sequence="ORF_3 rf(6)"
     misc_binding    1533..1538
                     /dbxref="REBASE:ApaI"
     misc_binding    2297..2302
                     /dbxref="REBASE:XbaI"
     misc_binding    2406..2411
                     /dbxref="REBASE:SacI"
     Regulatory_Seq  2487..2526
                     /gene="tetO reg"
     Other Gene      2540..2664
                     /gene="attR1 other"
     Other Gene      2564..2664
                     /gene="attR2 other"
     misc_binding    2665..2672
                     /dbxref="REBASE:NotI"
     Marker          2773..3432
                     /gene="CAT marker"
     ORF             2773..3432
                     /sequence="ORF_1 rf(1)"
     misc_binding    2986..2991
                     /dbxref="REBASE:EcoRI"
     Other Gene      3774..4079
                     /gene="ccdB other"
     misc_binding    4108..4113
                     /dbxref="REBASE:PstI"
     Other Gene      4120..4239
                     /gene="attR1 other"
     Other Gene      4120..4220
                     /gene="attR2 other"
     misc_binding    4255..4260
                     /dbxref="REBASE:XhoI"
     Rep_Origin      4960..5579
                     /gene="pBR322 origin"
     Promoter        6232..6281
                     /gene="NEOKAN prom"
     misc_binding    6339..6344
                     /dbxref="REBASE:BclI"
     ORF             6370..7164
                     /sequence="ORF_2 rf(1)"
     Marker          6373..7161
                     /gene="NTP_II marker"
     misc_binding    6899..6904
                     /dbxref="REBASE:SphI"
     Rep_Origin      7269..7574
                     /gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
      AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61    gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
      CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

                                               Encap other(162,310)>>> 
                                               |
121   cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
      GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181   aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
      TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241   aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
      TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301   tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
      ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

          amp prom(365,393)<<< 
          |
361   ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
      CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

                                             HpaI 
                                             |
421   gttccgcgcacatttccccgaaaagtgccacctgacgttaacctgcgcgctcgctcgctc 480
      CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGGACGCGCGAGCGAGCGAG

481   actgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtg 540
      TGACTCCGGCGGGCCCGTTTCGGGCCCGCAGCCCGCTGGAAACCAGCGGGCCGGAGTCAC

541   agcgagcgagcgcgcagagagggagtggccaactccatcactaggggttccttgtagtta 600
      TCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGGAACATCAAT

601   atgattaacccgccatgctacttatctacgtagccatgctctaggaagatcgcctaggcc 660
      TACTAATTGGGCGGTACGATGAATAGATGCATCGGTACGAGATCCTTCTAGCGGATCCGG

661   ggccacgcgtggcgcgttgacattgattattgactagttattaatagtaatcaattacgg 720
      CCGGTGCGCACCGCGCAACTGTAACTAATAACTGATCAATAATTATCATTAGTTAATGCC

721   ggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcc 780
      CCAGTAATCAAGTATCGGGTATATACCTCAAGGCGCAATGTATTGAATGCCATTTACCGG

781   cgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttccca 840
      GCGGACCGACTGGCGGGTTGCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAAGGGT

841   tagtaacgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactg 900
      ATCATTGCGGTTATCCCTGAAAGGTAACTGCAGTTACCCACCTGATAAATGCCATTTGAC

                                  NdeI 
                                  |
901   cccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatg 960
      GGGTGAACCGTCATGTAGTTCACATAGTATACGGTTCATGCGGGGGATAACTGCAGTTAC

961   acggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctactt 1020
      TGCCATTTACCGGGCGGACCGTAATACGGGTCATGTACTGGAATACCCTGAAAGGATGAA

                                            cBA prom(1059,1336)>>> 
                                            |
1021  ggcagtacatctacgtattagtcatcgctattaccatgggtcgaggtgagccccacgttc 1080
      CCGTCATGTAGATGCATAATCAGTAGCGATAATGGTACCCAGCTCCACTCGGGGTGCAAG

1081  tgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttt 1140
      ACGAAGTGAGAGGGGTAGAGGGGGGGGAGGGGTGGGGGTTAAAACATAAATAAATAAAAA

1141  taattattttgtgcagcgatgggggcgggggggggggggcgcgcgccaggcggggcgggg 1200
      ATTAATAAAACACGTCGCTACCCCCGCCCCCCCCCCCCCGCGCGCGGTCCGCCCCGCCCC

1201  cggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggc 1260
      GCCCCGCTCCCCGCCCCGCCCCGCTCCGCCTCTCCACGCCGCCGTCGGTTAGTCTCGCCG

1261  gcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcga 1320
      CGCGAGGCTTTCAAAGGAAAATACCGCTCCGCCGCCGCCGCCGCCGGGATATTTTTCGCT

1321  agcgcgcggcgggcgggagtcgctgcgttgccttcgccccgtgccccgctccgcgccgcc 1380
      TCGCGCGCCGCCCGCCCTCAGCGACGCAACGGAAGCGGGGCACGGGGCGAGGCGCGGCGG

1381  tcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggac 1440
      AGCGCGGCGGGCGGGGCCGAGACTGACTGGCGCAATGAGGGTGTCCACTCGCCCGCCCTG

                                         ORF_3 rf(6)(1476,2207)<<< 
                                         |
1441  ggcccttctcctccgggctgtaattagcgcttggtttaatgacggctcgtttcttttctg 1500
      CCGGGAAGAGGAGGCCCGACATTAATCGCGAACCAAATTACTGCCGAGCAAAGAAAAGAC

                                           ApaI 
                                           |
1501  tggctgcgtgaaagccttaaagggctccgggagggccctttgtgcgggggggagcggctc 1560
      ACCGACGCACTTTCGGAATTTCCCGAGGCCCTCCCGGGAAACACGCCCCCCCTCGCCGAG

1561  ggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggcccgcgctgcccggc 1620
      CCCCCCACGCACGCACACACACACGCACCCCTCGCGGCGCACGCCGGGCGCGACGGGCCG

1621  ggctgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcgtgtgcgcgagggga 1680
      CCGACACTCGCGACGCCCGCGCCGCGCCCCGAAACACGCGAGGCGCACACGCGCTCCCCT

1681  gcgcggccgggggcggtgccccgcggtgcgggggggctgcgaggggaacaaaggctgcgt 1740
      CGCGCCGGCCCCCGCCACGGGGCGCCACGCCCCCCCGACGCTCCCCTTGTTTCCGACGCA

1741  gcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcggcggtcgggctgtaacc 1800
      CGCCCCACACACGCACCCCCCCACTCGTCCCCCACACCCGCGCCGCCAGCCCGACATTGG

1801  cccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctcc 1860
      GGGGGGACGTGGGGGGAGGGGCTCAACGACTCGTGCCGGGCCGAAGCCCACGCCCCGAGG

1861  gtgcggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgc 1920
      CACGCCCCGCACCGCGCCCCGAGCGGCACGGCCCGCCCCCCACCGCCGTCCACCCCCACG

1921  cgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggccccg 1980
      GCCCGCCCCGCCCCGGCGGAGCCCGGCCCCTCCCGAGCCCCCTCCCCGCGCCGCCGGGGC

1981  gagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtg 2040
      CTCGCGGCCGCCGACAGCTCCGCGCCGCTCGGCGTCGGTAACGGAAAATACCATTAGCAC

2041  cgagagggcgcagggacttcctttgtcccaaatctggcggagccgaaatctgggaggcgc 2100
      GCTCTCCCGCGTCCCTGAAGGAAACAGGGTTTAGACCGCCTCGGCTTTAGACCCTCCGCG

2101  cgccgcaccccctctagcgggcgcgggcgaagcggtgcggcgccggcaggaaggaaatgg 2160
      GCGGCGTGGGGGAGATCGCCCGCGCCCGCTTCGCCACGCCGCGGCCGTCCTTCCTTTACC

2161  gcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccatctccagcctcggg 2220
      CGCCCCTCCCGGAAGCACGCAGCGGCGCGGCGGCAGGGGAAGAGGTAGAGGTCGGAGCCC

2221  gctgccgcagggggacggctgccttcgggggggacggggcagggcggggttcggcttctg 2280
      CGACGGCGTCCCCCTGCCGACGGAAGCCCCCCCTGCCCCGTCCCGCCCCAAGCCGAAGAC

                       XbaI 
                       |
2281  gcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcct 2340
      CGCACACTGGCCGCCGAGATCTCGGAGACGATTGGTACAAGTACGGAAGAAGAAAAAGGA

2341  acagctcctgggcaacgtgctggttgttgtgctgtctcatcattttggcaaagaattggc 2400
      TGTCGAGGACCCGTTGCACGACCAACAACACGACAGAGTAGTAAAACCGTTTCTTAACCG

                SacI 
                |
2401  gcgccgagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttga 2460
      CGCGGCTCGAGCAAATCACTTGGCAGTCTAGCGGACCTCTGCGGTAGGTGCGACAAAACT

                                tetO reg(2487,2526)>>> 
                                |
2461  cctccatagaagaaccgagtttaaactccctatcagtgatagagatctccctatcagtga 2520
      GGAGGTATCTTCTTGGCTCAAATTTGAGGGATAGTCACTATCTCTAGAGGGATAGTCACT

                                                 attR2 other(2564,2664)<<< 
                                                 |
                         attR1 other(2540,2664)>>> 
                         |                       |
2521  tagagagctagcgatatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatga 2580
      ATCTCTCGATCGCTATAGTTGTTCAAACATGTTTTTTCGACTTGCTCTTTGCATTTTACT

2581  tataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaa 2640
      ATATTTATAGTTATATAATTTAATCTAAAACGTATTTTTTGTCTGATGTATTATGACATT

                                NotI 
                                |
2641  aacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttat 2700
      TTGTGTTGTATAGGTCAGTGATACCGCCGGCGTAATCCGTGGGGTCCGAAATGTGAAATA

2701  gcttccggctcgtataatgtgtggattttgagttaggatccgtcgagattttcaggagct 2760
      CGAAGGCCGAGCATATTACACACCTAAAACTCAATCCTAGGCAGCTCTAAAAGTCCTCGA

                  CAT marker(2773,3432)>>> 
                  |
                  ORF_1 rf(1)(2773,3432)>>> 
                  |
2761  aaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatgg 2820
      TTCCTTCGATTTTACCTCTTTTTTTAGTGACCTATATGGTGGCAACTATATAGGGTTACC

2821  catcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagacc 2880
      GTAGCATTTCTTGTAAAACTCCGTAAAGTCAGTCAACGAGTTACATGGATATTGGTCTGG

2881  gttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttat 2940
      CAAGTCGACCTATAATGCCGGAAAAATTTCTGGCATTTCTTTTTATTCGTGTTCAAAATA

                                                    EcoRI 
                                                    |
2941  ccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggca 3000
      GGCCGGAAATAAGTGTAAGAACGGGCGGACTACTTACGAGTAGGCCTTAAGGCATACCGT

3001  atgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccat 3060
      TACTTTCTGCCACTCGACCACTATACCCTATCACAAGTGGGAACAATGTGGCAAAAGGTA

3061  gagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagttt 3120
      CTCGTTTGACTTTGCAAAAGTAGCGAGACCTCACTTATGGTGCTGCTAAAGGCCGTCAAA

3121  ctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaa 3180
      GATGTGTATATAAGCGTTCTACACCGCACAATGCCACTTTTGGACCGGATAAAGGGATTT

3181  gggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagtttt 3240
      CCCAAATAACTCTTATACAAAAAGCAGAGTCGGTTAGGGACCCACTCAAAGTGGTCAAAA

3241  gatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatat 3300
      CTAAATTTGCACCGGTTATACCTGTTGAAGAAGCGGGGGCAAAAGTGGTACCCGTTTATA

3301  tatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgt 3360
      ATATGCGTTCCGCTGTTCCACGACTACGGCGACCGCTAAGTCCAAGTAGTACGGCAAACA

3361  gatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcag 3420
      CTACCGAAGGTACAGCCGTCTTACGAATTACTTAATGTTGTCATGACGCTACTCACCGTC

3421  ggcggggcgtaaagatctggatccggcttactaaaagccagataacagtatgcgtatttg 3480
      CCGCCCCGCATTTCTAGACCTAGGCCGAATGATTTTCGGTCTATTGTCATACGCATAAAC

3481  cgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaa 3540
      GCGCGACTAAAAACGCCATATTCTTATATATGACTATACATATGGGCTTCATACAGTTTT

3541  agaggtatgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgc 3600
      TCTCCATACGATACTTCGTCGCATAATGTCACTGTCAACTGTCGCTGTCGATAGTCAACG

3601  tcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagc 3660
      AGTTCCGTATATACTACAGTTATAGAGGCCAGACCATTCGTGTTGGTACGTCTTACTTCG

3661  ccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgc 3720
      GGCAGCAGACGCACGGCTTGCGACCTTTCGCCTTTTAGTCCTTCCCTACCGACTCCAGCG

                                                           ccdB other(3774,4079)>>> 
                                                           |
3721  ccggtttattgaaatgaacggctcttttgctgacgagaacaggggctggtgaaatgcagt 3780
      GGCCAAATAACTTTACTTGCCGAGAAAACGACTGCTCTTGTCCCCGACCACTTTACGTCA

3781  ttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtg 3840
      AATTCCAAATGTGGATATTTTCTCTCTCGGCAATAGCAGACAAACACCTACATGTCTCAC

3841  atattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgt 3900
      TATAATAACTGTGCGGGCCCGCTGCCTACCACTAGGGGGACCGGTCACGTGCAGACGACA

3901  cagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgca 3960
      GTCTATTTCAGAGGGCACTTGAAATGGGCCACCACGTATAGCCCCTACTTTCGACCGCGT

3961  tgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatc 4020
      ACTACTGGTGGCTATACCGGTCACACGGCCAGAGGCAATAGCCCCTTCTTCACCGACTAG

4021  tcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaa 4080
      AGTCGGTGGCGCTTTTACTGTAGTTTTTGCGGTAATTGGACTACAAGACCCCTTATATTT

                                             attR2 other(4120,4220)>>> 
                                             |
                                      PstI   attR1 other(4120,4239)<<< 
                                      |      |
4081  tgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgt 4140
      ACAGTCCGAGGGAATATGTGTCGGTCAGACGTCCAGCTGGTATCACTGACCTATACAACA

4141  gttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatattt 4200
      CAAAATGTCATAATACATCAGACAAAAAATACGTTTTAGATTAAATTATATAACTATAAA

                                                             XhoI 
                                                             |
4201  atatcattttacgtttctcgttcagctttcttgtacaaagtggttgatatctgactcgag 4260
      TATAGTAAAATGCAAAGAGCAAGTCGAAAGAACATGTTTCACCAACTATAGACTGAGCTC

4261  tacccatacgacgtcccagactacgctacgcgtcttaaggcgatcgcagacatgataaga 4320
      ATGGGTATGCTGCAGGGTCTGATGCGATGCGCAGAATTCCGCTAGCGTCTGTACTATTCT

4321  tacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgt 4380
      ATGTAACTACTCAAACCTGTTTGGTGTTGATCTTACGTCACTTTTTTTACGAAATAAACA

4381  gaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaat 4440
      CTTTAAACACTACGATAACGAAATAAACATTGGTAATATTCGACGTTATTTGTTCAATTA

4441  aacaacaattccattcattttatgtttcaggttcagggggagatgtgggaggttttttaa 4500
      TTGTTGTTAAGGTAAGTAAAATACAAAGTCCAAGTCCCCCTCTACACCCTCCAAAAAATT

4501  agcaagtaaaacctctacaaatgtggtagtcgaaattcccgataaggatcttcctagagc 4560
      TCGTTCATTTTGGAGATGTTTACACCATCAGCTTTAAGGGCTATTCCTAGAAGGATCTCG

4561  atggctacgtagataagtagcatggcgggttaatcattaactacaaggaacccctagtga 4620
      TACCGATGCATCTATTCATCGTACCGCCCAATTAGTAATTGATGTTCCTTGGGGATCACT

4621  tggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaagg 4680
      ACCTCAACCGGTGAGGGAGAGACGCGCGAGCGAGCGAGTGACTCCGGCCCGCTGGTTTCC

4681  tcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagggatc 4740
      AGCGGGCTGCGGGCCCGAAACGGGCCCGCCGGAGTCACTCGCTCGCTCGCGCGTCCCTAG

4741  ccggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgc 4800
      GGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCG

4801  ttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctca 4860
      AAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGT

4861  ctcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtg 4920
      GAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACAC

                                             pBR322 origin(4960,5579)<<< 
                                             |
4921  agcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttcca 4980
      TCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGT

4981  taggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaa 5040
      ATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTT

5041  cccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcc 5100
      GGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGG

5101  tgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggc 5160
      ACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCG

5161  gctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagct 5220
      CGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGA

5221  gggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcg 5280
      CCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGC

5281  tcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacag 5340
      AGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTC

5341  gattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaacta 5400
      CTAATCGTCTCGCTCCATACATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGAT

5401  cggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcgg 5460
      GCCGATGTGATCTTCCTGTCATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCC

5461  aaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttt 5520
      TTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAA

5521  tgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatctt 5580
      ACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAA

5581  ttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgag 5640
      AAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTC

5641  attatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaat 5700
      TAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTA

5701  ctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacc 5760
      GATTTCATATATACTCATTTGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGG

5761  tatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagat 5820
      ATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTA

5821  aactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagaccc 5880
      TTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGG

5881  acgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcag 5940
      TGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTC

5941  aagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctag 6000
      TTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATC

6001  agtaagtagttcgccagttaatagtttgcgcaacgttgttgaaaaaggatcttcacctag 6060
      TCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATC

6061  atccttttcacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagc 6120
      TAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCG

6121  tactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagt 6180
      ATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCA

                                                         NEOKAN prom(6232,6281)>>> 
                                                         |
6181  gggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattg 6240
      CCCGAATGTACCGCTATCGATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAAC

6241  ccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttc 6300
      GGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAG

                                             BclI 
                                             |
6301  tcgccgccaaggatctgatggcgcaggggatcaagctctgatcaagagacaggatgagga 6360
      AGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCT

                  NTP_II marker(6373,7161)>>> 
                  |
               ORF_2 rf(1)(6370,7164)>>> 
               |  |
6361  tcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggag 6420
      AGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTC

6421  aggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttc 6480
      TCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAG

6481  cggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctg 6540
      GCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGAC

6541  aatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgc 6600
      TTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACG

6601  gcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtg 6660
      CGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCAC

6661  ccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggct 6720
      GGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGA

6721  gatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcg 6780
      CTACGTTACGCCGCCGACGTATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGC

6781  aaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgat 6840
      TTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTA

6841  ctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagc 6900
      GACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCG

         SphI 
         |
6901  atgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatg 6960
      TACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTAC

6961  gtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgc 7020
      CACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCG

7021  tatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggct 7080
      ATAGTCCTGTATCGCAACCGATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGA

7081  gaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctat 7140
      CTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATA

7141  cgccttcttgacgagttcttctgaattttgttaaaatttttgttaaatcagctcattttt 7200
      GCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAA

7201  taaccaataggccgaaatcggcaacatcccttataaatcaaaagaatagaccgcgatagg 7260
      ATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCC

              f1 origin(7269,7574)<<< 
              |
7261  gttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgt 7320
      CAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCA

7321  caaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcacccaaatc 7380
      GTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAG

7381  aagttttttgcggtcgaggtgccgtaaagctctaaatcggaaccctaaagggagcccccg 7440
      TTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGC

7441  atttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaa 7500
      TAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTT

7501  aggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacc 7560
      TCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGG

7561  cgcgcgcttaatgcgccgctacagggcgcgtccattcgccattcaggatcgaattaattc 7620
      GCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAG

7621  ttaattaacatcatcaataatatacctt 7648
      AATTAATTGTAGTAGTTATTATATGGAA