pAAV-G-CMV
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepAAV-G-CMV
VectorTypeAAV Vector
Antibiotic InformationBacterial: Kanamycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`

AAV insert reverse primer
5`---CAC TGC ATT CTA GTT GTG GTT TGT CC---3`
Additional InformationThe gene expression is driven by a CMV promoter, without any Tag or reporter.
Original Vector: 6409bp
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta acctgcgcgc tcgctcgctc
481 actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg
541 agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc cttgtagtta
601 atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat cgcctagggt
661 tccgcgttac ataacttacg gtaaatggcc cgcctggctg accgcccaac gacccccgcc
721 cattgacgtc aataatgacg tatgttccca tagtaacgcc aatagggact ttccattgac
781 gtcaatgggt ggagtattta cggtaaactg cccacttggc agtacatcaa gtgtatcata
841 tgccaagtac gccccctatt gacgtcaatg acggtaaatg gcccgcctgg cattatgccc
901 agtacatgac cttatgggac tttcctactt ggcagtacat ctacgtttag tcatcgctat
961 taccatggtg atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg
1021 gggatttcca agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca
1081 acgggacttt ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg
1141 tgtacggtgg gaggtctata taagcagagc tcgtttagtg aaccgtcaga tcgcctggag
1201 acgccatcca cgctgttttg acctccatag aagaaccgag tttaaactcc ctatcagtga
1261 tagagatctc cctatcagtg atagagagct agcgatatca acaagtttgt acaaaaaagc
1321 tgaacgagaa acgtaaaatg atataaatat caatatatta aattagattt tgcataaaaa
1381 acagactaca taatactgta aaacacaaca tatccagtca ctatggcggc cgcattaggc
1441 accccaggct ttacacttta tgcttccggc tcgtataatg tgtggatttt gagttaggat
1501 ccgtcgagat tttcaggagc taaggaagct aaaatggaga aaaaaatcac tggatatacc
1561 accgttgata tatcccaatg gcatcgtaaa gaacattttg aggcatttca gtcagttgct
1621 caatgtacct ataaccagac cgttcagctg gatattacgg cctttttaaa gaccgtaaag
1681 aaaaataagc acaagtttta tccggccttt attcacattc ttgcccgcct gatgaatgct
1741 catccggaat tccgtatggc aatgaaagac ggtgagctgg tgatatggga tagtgttcac
1801 ccttgttaca ccgttttcca tgagcaaact gaaacgtttt catcgctctg gagtgaatac
1861 cacgacgatt tccggcagtt tctacacata tattcgcaag atgtggcgtg ttacggtgaa
1921 aacctggcct atttccctaa agggtttatt gagaatatgt ttttcgtctc agccaatccc
1981 tgggtgagtt tcaccagttt tgatttaaac gtggccaata tggacaactt cttcgccccc
2041 gttttcacca tgggcaaata ttatacgcaa ggcgacaagg tgctgatgcc gctggcgatt
2101 caggttcatc atgccgtttg tgatggcttc catgtcggca gaatgcttaa tgaattacaa
2161 cagtactgcg atgagtggca gggcggggcg taaagatctg gatccggctt actaaaagcc
2221 agataacagt atgcgtattt gcgcgctgat ttttgcggta taagaatata tactgatatg
2281 tatacccgaa gtatgtcaaa aagaggtatg ctatgaagca gcgtattaca gtgacagttg
2341 acagcgacag ctatcagttg ctcaaggcat atatgatgtc aatatctccg gtctggtaag
2401 cacaaccatg cagaatgaag cccgtcgtct gcgtgccgaa cgctggaaag cggaaaatca
2461 ggaagggatg gctgaggtcg cccggtttat tgaaatgaac ggctcttttg ctgacgagaa
2521 caggggctgg tgaaatgcag tttaaggttt acacctataa aagagagagc cgttatcgtc
2581 tgtttgtgga tgtacagagt gatattattg acacgcccgg gcgacggatg gtgatccccc
2641 tggccagtgc acgtctgctg tcagataaag tctcccgtga actttacccg gtggtgcata
2701 tcggggatga aagctggcgc atgatgacca ccgatatggc cagtgtgccg gtctccgtta
2761 tcggggaaga agtggctgat ctcagccacc gcgaaaatga catcaaaaac gccattaacc
2821 tgatgttctg gggaatataa atgtcaggct cccttataca cagccagtct gcaggtcgac
2881 catagtgact ggatatgttg tgttttacag tattatgtag tctgtttttt atgcaaaatc
2941 taatttaata tattgatatt tatatcattt tacgtttctc gttcagcttt cttgtacaaa
3001 gtggttgata tctgactcga gtacccatac gacgtcccag actacgctac gcgtcttaag
3061 gcgatcgcag acatgataag atacattgat gagtttggac aaaccacaac tagaatgcag
3121 tgaaaaaaat gctttatttg tgaaatttgt gatgctattg ctttatttgt aaccattata
3181 agctgcaata aacaagttaa taacaacaat tccattcatt ttatgtttca ggttcagggg
3241 gagatgtggg aggtttttta aagcaagtaa aacctctaca aatgtggtag tcgaaattcc
3301 cgataaggat cttcctagag catggctacg tagataagta gcatggcggg ttaatcatta
3361 actacaagga acccctagtg atggagttgg ccactccctc tctgcgcgct cgctcgctca
3421 ctgaggccgg gcgaccaaag gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga
3481 gcgagcgagc gcgcagggat cccggtgtga aataccgcac agatgcgtaa ggagaaaata
3541 ccgcatcagg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct
3601 gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga
3661 taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc
3721 cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg
3781 ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg
3841 aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt
3901 tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt
3961 gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg
4021 cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact
4081 ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt
4141 cttgaagtgg tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct
4201 gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac
4261 cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc
4321 tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg
4381 ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta
4441 aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca
4501 atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc
4561 ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc
4621 tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc
4681 agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat
4741 taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt
4801 tgaaaaagga tcttcaccta gatccttttc acgtagaaag ccagtccgca gaaacggtgc
4861 tgaccccgga tgaatgtcag ctactgggct atctggacaa gggaaaacgc aagcgcaaag
4921 agaaagcagg tagcttgcag tgggcttaca tggcgatagc tagactgggc ggttttatgg
4981 acagcaagcg aaccggaatt gccagctggg gcgccctctg gtaaggttgg gaagccctgc
5041 aaagtaaact ggatggcttt ctcgccgcca aggatctgat ggcgcagggg atcaagctct
5101 gatcaagaga caggatgagg atcgtttcgc atgattgaac aagatggatt gcacgcaggt
5161 tctccggccg cttgggtgga gaggctattc ggctatgact gggcacaaca gacaatcggc
5221 tgctctgatg ccgccgtgtt ccggctgtca gcgcaggggc gcccggttct ttttgtcaag
5281 accgacctgt ccggtgccct gaatgaactg caagacgagg cagcgcggct atcgtggctg
5341 gccacgacgg gcgttccttg cgcagctgtg ctcgacgttg tcactgaagc gggaagggac
5401 tggctgctat tgggcgaagt gccggggcag gatctcctgt catctcacct tgctcctgcc
5461 gagaaagtat ccatcatggc tgatgcaatg cggcggctgc atacgcttga tccggctacc
5521 tgcccattcg accaccaagc gaaacatcgc atcgagcgag cacgtactcg gatggaagcc
5581 ggtcttgtcg atcaggatga tctggacgaa gagcatcagg ggctcgcgcc agccgaactg
5641 ttcgccaggc tcaaggcgag catgcccgac ggcgaggatc tcgtcgtgac ccatggcgat
5701 gcctgcttgc cgaatatcat ggtggaaaat ggccgctttt ctggattcat cgactgtggc
5761 cggctgggtg tggcggaccg ctatcaggac atagcgttgg ctacccgtga tattgctgaa
5821 gagcttggcg gcgaatgggc tgaccgcttc ctcgtgcttt acggtatcgc cgctcccgat
5881 tcgcagcgca tcgccttcta tcgccttctt gacgagttct tctgaatttt gttaaaattt
5941 ttgttaaatc agctcatttt ttaaccaata ggccgaaatc ggcaacatcc cttataaatc
6001 aaaagaatag accgcgatag ggttgagtgt tgttccagtt tggaacaaga gtccactatt
6061 aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc tatcagggcg atggcccact
6121 acgtgaacca tcacccaaat caagtttttt gcggtcgagg tgccgtaaag ctctaaatcg
6181 gaaccctaaa gggagccccc gatttagagc ttgacgggga aagccggcga acgtggcgag
6241 aaaggaaggg aagaaagcga aaggagcggg cgctagggcg ctggcaagtg tagcggtcac
6301 gctgcgcgta accaccacac ccgcgcgctt aatgcgccgc tacagggcgc gtccattcgc
6361 cattcaggat cgaattaatt cttaattaac atcatcaata atatacctt
                                    LOCUS       dna                      6409 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
misc_binding 837..842
/dbxref="REBASE:NdeI"
Promoter 1111..1192
/gene="CMV prom"
misc_binding 1167..1172
/dbxref="REBASE:SacI"
Regulatory_Seq 1248..1287
/gene="tetO reg"
Other Gene 1301..1425
/gene="attR1 other"
Other Gene 1325..1425
/gene="attR2 other"
misc_binding 1426..1433
/dbxref="REBASE:NotI"
Marker 1534..2193
/gene="CAT marker"
ORF 1534..2193
/sequence="ORF_1 rf(1)"
misc_binding 1747..1752
/dbxref="REBASE:EcoRI"
Other Gene 2535..2840
/gene="ccdB other"
misc_binding 2869..2874
/dbxref="REBASE:PstI"
Other Gene 2881..3000
/gene="attR1 other"
Other Gene 2881..2981
/gene="attR2 other"
misc_binding 3016..3021
/dbxref="REBASE:XhoI"
Rep_Origin 3721..4340
/gene="pBR322 origin"
Promoter 4993..5042
/gene="NEOKAN prom"
misc_binding 5100..5105
/dbxref="REBASE:BclI"
ORF 5131..5925
/sequence="ORF_2 rf(1)"
Marker 5134..5922
/gene="NTP_II marker"
misc_binding 5660..5665
/dbxref="REBASE:SphI"
Rep_Origin 6030..6335
/gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaacctgcgcgctcgctcgctc 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGGACGCGCGAGCGAGCGAG

481 actgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtg 540
TGACTCCGGCGGGCCCGTTTCGGGCCCGCAGCCCGCTGGAAACCAGCGGGCCGGAGTCAC

541 agcgagcgagcgcgcagagagggagtggccaactccatcactaggggttccttgtagtta 600
TCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGGAACATCAAT

601 atgattaacccgccatgctacttatctacgtagccatgctctaggaagatcgcctagggt 660
TACTAATTGGGCGGTACGATGAATAGATGCATCGGTACGAGATCCTTCTAGCGGATCCCA

661 tccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcc 720
AGGCGCAATGTATTGAATGCCATTTACCGGGCGGACCGACTGGCGGGTTGCTGGGGGCGG

721 cattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgac 780
GTAACTGCAGTTATTACTGCATACAAGGGTATCATTGCGGTTATCCCTGAAAGGTAACTG

NdeI
|
781 gtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcata 840
CAGTTACCCACCTCATAAATGCCATTTGACGGGTGAACCGTCATGTAGTTCACATAGTAT

841 tgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgccc 900
ACGGTTCATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGACCGTAATACGGG

901 agtacatgaccttatgggactttcctacttggcagtacatctacgtttagtcatcgctat 960
TCATGTACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCAAATCAGTAGCGATA

961 taccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacg 1020
ATGGTACCACTACGCCAAAACCGTCATGTAGTTACCCGCACCTATCGCCAAACTGAGTGC

1021 gggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatca 1080
CCCTAAAGGTTCAGAGGTGGGGTAACTGCAGTTACCCTCAAACAAAACCGTGGTTTTAGT

CMV prom(1111,1192)>>>
|
1081 acgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcg 1140
TGCCCTGAAAGGTTTTACAGCATTGTTGAGGCGGGGTAACTGCGTTTACCCGCCATCCGC

SacI
|
1141 tgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggag 1200
ACATGCCACCCTCCAGATATATTCGTCTCGAGCAAATCACTTGGCAGTCTAGCGGACCTC

tetO reg(1248,1287)>>>
|
1201 acgccatccacgctgttttgacctccatagaagaaccgagtttaaactccctatcagtga 1260
TGCGGTAGGTGCGACAAAACTGGAGGTATCTTCTTGGCTCAAATTTGAGGGATAGTCACT

attR1 other(1301,1425)>>>
|
1261 tagagatctccctatcagtgatagagagctagcgatatcaacaagtttgtacaaaaaagc 1320
ATCTCTAGAGGGATAGTCACTATCTCTCGATCGCTATAGTTGTTCAAACATGTTTTTTCG

attR2 other(1325,1425)<<<
|
1321 tgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaa 1380
ACTTGCTCTTTGCATTTTACTATATTTATAGTTATATAATTTAATCTAAAACGTATTTTT

NotI
|
1381 acagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggc 1440
TGTCTGATGTATTATGACATTTTGTGTTGTATAGGTCAGTGATACCGCCGGCGTAATCCG

1441 accccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggat 1500
TGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATATTACACACCTAAAACTCAATCCTA

ORF_1 rf(1)(1534,2193)>>>
|
CAT marker(1534,2193)>>>
|
1501 ccgtcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatatacc 1560
GGCAGCTCTAAAAGTCCTCGATTCCTTCGATTTTACCTCTTTTTTTAGTGACCTATATGG

1561 accgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgct 1620
TGGCAACTATATAGGGTTACCGTAGCATTTCTTGTAAAACTCCGTAAAGTCAGTCAACGA

1621 caatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaag 1680
GTTACATGGATATTGGTCTGGCAAGTCGACCTATAATGCCGGAAAAATTTCTGGCATTTC

1681 aaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgct 1740
TTTTTATTCGTGTTCAAAATAGGCCGGAAATAAGTGTAAGAACGGGCGGACTACTTACGA

EcoRI
|
1741 catccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcac 1800
GTAGGCCTTAAGGCATACCGTTACTTTCTGCCACTCGACCACTATACCCTATCACAAGTG

1801 ccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaatac 1860
GGAACAATGTGGCAAAAGGTACTCGTTTGACTTTGCAAAAGTAGCGAGACCTCACTTATG

1861 cacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaa 1920
GTGCTGCTAAAGGCCGTCAAAGATGTGTATATAAGCGTTCTACACCGCACAATGCCACTT

1921 aacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccc 1980
TTGGACCGGATAAAGGGATTTCCCAAATAACTCTTATACAAAAAGCAGAGTCGGTTAGGG

1981 tgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgccccc 2040
ACCCACTCAAAGTGGTCAAAACTAAATTTGCACCGGTTATACCTGTTGAAGAAGCGGGGG

2041 gttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgatt 2100
CAAAAGTGGTACCCGTTTATAATATGCGTTCCGCTGTTCCACGACTACGGCGACCGCTAA

2101 caggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaa 2160
GTCCAAGTAGTACGGCAAACACTACCGAAGGTACAGCCGTCTTACGAATTACTTAATGTT

2161 cagtactgcgatgagtggcagggcggggcgtaaagatctggatccggcttactaaaagcc 2220
GTCATGACGCTACTCACCGTCCCGCCCCGCATTTCTAGACCTAGGCCGAATGATTTTCGG

2221 agataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatg 2280
TCTATTGTCATACGCATAAACGCGCGACTAAAAACGCCATATTCTTATATATGACTATAC

2281 tatacccgaagtatgtcaaaaagaggtatgctatgaagcagcgtattacagtgacagttg 2340
ATATGGGCTTCATACAGTTTTTCTCCATACGATACTTCGTCGCATAATGTCACTGTCAAC

2341 acagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaag 2400
TGTCGCTGTCGATAGTCAACGAGTTCCGTATATACTACAGTTATAGAGGCCAGACCATTC

2401 cacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatca 2460
GTGTTGGTACGTCTTACTTCGGGCAGCAGACGCACGGCTTGCGACCTTTCGCCTTTTAGT

2461 ggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaa 2520
CCTTCCCTACCGACTCCAGCGGGCCAAATAACTTTACTTGCCGAGAAAACGACTGCTCTT

ccdB other(2535,2840)>>>
|
2521 caggggctggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtc 2580
GTCCCCGACCACTTTACGTCAAATTCCAAATGTGGATATTTTCTCTCTCGGCAATAGCAG

2581 tgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccc 2640
ACAAACACCTACATGTCTCACTATAATAACTGTGCGGGCCCGCTGCCTACCACTAGGGGG

2641 tggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcata 2700
ACCGGTCACGTGCAGACGACAGTCTATTTCAGAGGGCACTTGAAATGGGCCACCACGTAT

2701 tcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgtta 2760
AGCCCCTACTTTCGACCGCGTACTACTGGTGGCTATACCGGTCACACGGCCAGAGGCAAT

2761 tcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacc 2820
AGCCCCTTCTTCACCGACTAGAGTCGGTGGCGCTTTTACTGTAGTTTTTGCGGTAATTGG

PstI
|
2821 tgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgac 2880
ACTACAAGACCCCTTATATTTACAGTCCGAGGGAATATGTGTCGGTCAGACGTCCAGCTG

attR1 other(2881,3000)<<<
|
attR2 other(2881,2981)>>>
|
2881 catagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatc 2940
GTATCACTGACCTATACAACACAAAATGTCATAATACATCAGACAAAAAATACGTTTTAG

2941 taatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaa 3000
ATTAAATTATATAACTATAAATATAGTAAAATGCAAAGAGCAAGTCGAAAGAACATGTTT

XhoI
|
3001 gtggttgatatctgactcgagtacccatacgacgtcccagactacgctacgcgtcttaag 3060
CACCAACTATAGACTGAGCTCATGGGTATGCTGCAGGGTCTGATGCGATGCGCAGAATTC

3061 gcgatcgcagacatgataagatacattgatgagtttggacaaaccacaactagaatgcag 3120
CGCTAGCGTCTGTACTATTCTATGTAACTACTCAAACCTGTTTGGTGTTGATCTTACGTC

3121 tgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattata 3180
ACTTTTTTTACGAAATAAACACTTTAAACACTACGATAACGAAATAAACATTGGTAATAT

3181 agctgcaataaacaagttaataacaacaattccattcattttatgtttcaggttcagggg 3240
TCGACGTTATTTGTTCAATTATTGTTGTTAAGGTAAGTAAAATACAAAGTCCAAGTCCCC

3241 gagatgtgggaggttttttaaagcaagtaaaacctctacaaatgtggtagtcgaaattcc 3300
CTCTACACCCTCCAAAAAATTTCGTTCATTTTGGAGATGTTTACACCATCAGCTTTAAGG

3301 cgataaggatcttcctagagcatggctacgtagataagtagcatggcgggttaatcatta 3360
GCTATTCCTAGAAGGATCTCGTACCGATGCATCTATTCATCGTACCGCCCAATTAGTAAT

3361 actacaaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctca 3420
TGATGTTCCTTGGGGATCACTACCTCAACCGGTGAGGGAGAGACGCGCGAGCGAGCGAGT

3421 ctgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtga 3480
GACTCCGGCCCGCTGGTTTCCAGCGGGCTGCGGGCCCGAAACGGGCCCGCCGGAGTCACT

3481 gcgagcgagcgcgcagggatcccggtgtgaaataccgcacagatgcgtaaggagaaaata 3540
CGCTCGCTCGCGCGTCCCTAGGGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTTAT

3541 ccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggct 3600
GGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCCGA

3601 gcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcagggga 3660
CGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCCCT

3661 taacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggc 3720
ATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCCG

pBR322 origin(3721,4340)<<<
|
3721 cgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacg 3780
GCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTGC

3781 ctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctgg 3840
GAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGACC

3841 aagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctt 3900
TTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGAA

3901 tctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggt 3960
AGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGCCA

3961 gtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctg 4020
CATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCGAC

4021 cgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccact 4080
GCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGA

4081 ggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagtt 4140
CCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTCAA

4141 cttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctct 4200
GAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCGAGA

4201 gctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccac 4260
CGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGGTG

4261 cgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatc 4320
GCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAG

4321 tcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacg 4380
AGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGTGC

4381 ttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaatta 4440
AATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTAAT

4441 aaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttacca 4500
TTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAATGGT

4501 atgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgc 4560
TACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAACG

4561 ctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgc 4620
GACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCACG

4621 tgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagcc 4680
ACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTCGG

4681 agccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctat 4740
TCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGATA

4741 taattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgt 4800
ATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAACA

4801 tgaaaaaggatcttcacctagatccttttcacgtagaaagccagtccgcagaaacggtgc 4860
ACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCACG

4861 tgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaag 4920
ACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTTTC

4921 agaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatgg 4980
TCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAAATACC

NEOKAN prom(4993,5042)>>>
|
4981 acagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgc 5040
TGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGACG

5041 aaagtaaactggatggctttctcgccgccaaggatctgatggcgcaggggatcaagctct 5100
TTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGAGA

NTP_II marker(5134,5922)>>>
|
BclI ORF_2 rf(1)(5131,5925)>>>
| | |
5101 gatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggt 5160
CTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTCCA

5161 tctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggc 5220
AGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGCCG

5221 tgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaag 5280
ACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGTTC

5281 accgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctg 5340
TGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCGAC

5341 gccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggac 5400
CGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCCTG

5401 tggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgcc 5460
ACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGACGG

5461 gagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacc 5520
CTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCCGATGG

5521 tgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagcc 5580
ACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTCGG

5581 ggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactg 5640
CCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTGAC

SphI
|
5641 ttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgat 5700
AAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGCTA

5701 gcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggc 5760
CGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACACCG

5761 cggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaa 5820
GCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAACGACTT

5821 gagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgat 5880
CTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGCTA

5881 tcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattttgttaaaattt 5940
AGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTAAA

5941 ttgttaaatcagctcattttttaaccaataggccgaaatcggcaacatcccttataaatc 6000
AACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTTAG

f1 origin(6030,6335)<<<
|
6001 aaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaagagtccactatt 6060
TTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGATAA

6061 aaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccact 6120
TTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGTGA

6121 acgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaaagctctaaatcg 6180
TGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTAGC

6181 gaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgag 6240
CTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGCTC

6241 aaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcac 6300
TTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAGTG

6301 gctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacagggcgcgtccattcgc 6360
CGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAGCG

6361 cattcaggatcgaattaattcttaattaacatcatcaataatatacctt 6409
GTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA