pAAV-G-EF1a
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepAAV-G-EF1a
VectorTypeAAV Vector
Antibiotic InformationBacterial: Kanamycin
Sequencing PrimersEF1a sequencing primer
5'--TCA GAC AGT GGT TCA AAG--3'
Additional InformationThe gene expression is driven by a EF1a promoter, without any Tag or reporter.
Original Vector: 7042bp
Vector without Insert Casette: 5266bp
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


ORIGIN
        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta acctgcgcgc tcgctcgctc     
      481 actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg     
      541 agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc cttgtagtta     
      601 atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat cgcctaggga     
      661 gtgggaattg gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag     
      721 aagttggggg gaggggtcgg caattgaacc ggtgcctaga gaaggtggcg cggggtaaac     
      781 tgggaaagtg atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat     
      841 ataagtgcag tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag     
      901 gtaagtgccg tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg     
      961 ccttgaatta cttccacctg gctgcagtac gtgattcttg atcccgagct tcgggttgga     
     1021 agtgggtggg agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt     
     1081 gaggcctggc ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt     
     1141 ctcgctgctt tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt     
     1201 tttttctggc aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt     
     1261 tttggggccg cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg     
     1321 ggcctgcgag cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct     
     1381 ctggtgcctg gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg     
     1441 tcggcaccag ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca     
     1501 aaatggagga cgcggcgctc gggagagcgg gcgggtgagt cacccacaca aaggaaaagg     
     1561 gcctttccgt cctcagccgt cgcttcatgt gactccacgg agtaccgggc gccgtccagg     
     1621 cacctcgatt agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt     
     1681 tatgcgatgg agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac     
     1741 ttgatgtaat tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag     
     1801 cctcagacag tggttcaaag tttttttctt ccatttcagg tgtcgtgagg aatttcgact     
     1861 gctagcgata tctctagact cgagtaccca tacgacgtcc cagactacgc tacgcgtctt     
     1921 aaggcgatcg cagacatgat aagatacatt gatgagtttg gacaaaccac aactagaatg     
     1981 cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt tgtaaccatt     
     2041 ataagctgca ataaacaagt taataacaac aattccattc attttatgtt tcaggttcag     
     2101 ggggagatgt gggaggtttt ttaaagcaag taaaacctct acaaatgtgg tagtcgaaat     
     2161 tcccgataag gatcttccta gagcatggct acgtagataa gtagcatggc gggttaatca     
     2221 ttaactacaa ggaaccccta gtgatggagt tggccactcc ctctctgcgc gctcgctcgc     
     2281 tcactgaggc cgggcgacca aaggtcgccc gacgcccggg ctttgcccgg gcggcctcag     
     2341 tgagcgagcg agcgcgcagg gatcccggtg tgaaataccg cacagatgcg taaggagaaa     
     2401 ataccgcatc aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg     
     2461 gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg     
     2521 ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa     
     2581 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg     
     2641 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc     
     2701 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc     
     2761 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc     
     2821 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg     
     2881 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc     
     2941 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga     
     3001 gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc     
     3061 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac     
     3121 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg     
     3181 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc     
     3241 acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa     
     3301 ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta     
     3361 ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt     
     3421 tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag     
     3481 tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag caataaacca     
     3541 gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc     
     3601 tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt     
     3661 tgttgaaaaa ggatcttcac ctagatcctt ttcacgtaga aagccagtcc gcagaaacgg     
     3721 tgctgacccc ggatgaatgt cagctactgg gctatctgga caagggaaaa cgcaagcgca     
     3781 aagagaaagc aggtagcttg cagtgggctt acatggcgat agctagactg ggcggtttta     
     3841 tggacagcaa gcgaaccgga attgccagct ggggcgccct ctggtaaggt tgggaagccc     
     3901 tgcaaagtaa actggatggc tttctcgccg ccaaggatct gatggcgcag gggatcaagc     
     3961 tctgatcaag agacaggatg aggatcgttt cgcatgattg aacaagatgg attgcacgca     
     4021 ggttctccgg ccgcttgggt ggagaggcta ttcggctatg actgggcaca acagacaatc     
     4081 ggctgctctg atgccgccgt gttccggctg tcagcgcagg ggcgcccggt tctttttgtc     
     4141 aagaccgacc tgtccggtgc cctgaatgaa ctgcaagacg aggcagcgcg gctatcgtgg     
     4201 ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga agcgggaagg     
     4261 gactggctgc tattgggcga agtgccgggg caggatctcc tgtcatctca ccttgctcct     
     4321 gccgagaaag tatccatcat ggctgatgca atgcggcggc tgcatacgct tgatccggct     
     4381 acctgcccat tcgaccacca agcgaaacat cgcatcgagc gagcacgtac tcggatggaa     
     4441 gccggtcttg tcgatcagga tgatctggac gaagagcatc aggggctcgc gccagccgaa     
     4501 ctgttcgcca ggctcaaggc gagcatgccc gacggcgagg atctcgtcgt gacccatggc     
     4561 gatgcctgct tgccgaatat catggtggaa aatggccgct tttctggatt catcgactgt     
     4621 ggccggctgg gtgtggcgga ccgctatcag gacatagcgt tggctacccg tgatattgct     
     4681 gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc     
     4741 gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt tcttctgaat tttgttaaaa     
     4801 tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaca tcccttataa     
     4861 atcaaaagaa tagaccgcga tagggttgag tgttgttcca gtttggaaca agagtccact     
     4921 attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc     
     4981 actacgtgaa ccatcaccca aatcaagttt tttgcggtcg aggtgccgta aagctctaaa     
     5041 tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc     
     5101 gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt     
     5161 cacgctgcgc gtaaccacca cacccgcgcg cttaatgcgc cgctacaggg cgcgtccatt     
     5221 cgccattcag gatcgaatta attcttaatt aacatcatca ataatatacc tt
                                    LOCUS       dna                      5272 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    457..462
                     /dbxref="REBASE:HpaI"
     misc_binding    457..462
                     /dbxref="REBASE:HincII"
     Promoter        670..1848
                     /gene="EF1a prom"
     ORF             968..1588
                     /sequence="ORF_2 rf(4)"
     misc_binding    1236..1241
                     /dbxref="REBASE:BglII"
     misc_binding    1283..1288
                     /dbxref="REBASE:ApaI"
     misc_binding    1494..1499
                     /dbxref="REBASE:SacI"
     misc_binding    1867..1872
                     /dbxref="REBASE:EcoRV"
     misc_binding    1873..1878
                     /dbxref="REBASE:XbaI"
     misc_binding    2360..2365
                     /dbxref="REBASE:BamHI"
     Rep_Origin      2584..3203
                     /gene="pBR322 origin"
     Promoter        3856..3905
                     /gene="NEOKAN prom"
     misc_binding    3963..3968
                     /dbxref="REBASE:BclI"
     ORF             3994..4788
                     /sequence="ORF_1 rf(1)"
     Marker          3997..4785
                     /gene="NTP_II marker"
     misc_binding    4523..4528
                     /dbxref="REBASE:SphI"
     misc_binding    4554..4559
                     /dbxref="REBASE:NcoI"
     Rep_Origin      4893..5198
                     /gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
      AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61    gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
      CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

                                               Encap other(162,310)>>> 
                                               |
121   cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
      GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181   aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
      TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241   aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
      TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301   tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
      ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

          amp prom(365,393)<<< 
          |
361   ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
      CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

                                             HincII 
                                             |
                                             HpaI 
                                             |
421   gttccgcgcacatttccccgaaaagtgccacctgacgttaacctgcgcgctcgctcgctc 480
      CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGGACGCGCGAGCGAGCGAG

481   actgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtg 540
      TGACTCCGGCGGGCCCGTTTCGGGCCCGCAGCCCGCTGGAAACCAGCGGGCCGGAGTCAC

541   agcgagcgagcgcgcagagagggagtggccaactccatcactaggggttccttgtagtta 600
      TCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGGAACATCAAT

601   atgattaacccgccatgctacttatctacgtagccatgctctaggaagatcgcctaggga 660
      TACTAATTGGGCGGTACGATGAATAGATGCATCGGTACGAGATCCTTCTAGCGGATCCCT

               EF1a prom(670,1848)>>> 
               |
661   gtgggaattggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgag 720
      CACCCTTAACCGAGGCCACGGGCAGTCACCCGTCTCGCGTGTAGCGGGTGTCAGGGGCTC

721   aagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaac 780
      TTCAACCCCCCTCCCCAGCCGTTAACTTGGCCACGGATCTCTTCCACCGCGCCCCATTTG

781   tgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtat 840
      ACCCTTTCACTACAGCACATGACCGAGGCGGAAAAAGGGCTCCCACCCCCTCTTGGCATA

841   ataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacag 900
      TATTCACGTCATCAGCGGCACTTGCAAGAAAAAGCGTTGCCCAAACGGCGGTCTTGTGTC

901   gtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtg 960
      CATTCACGGCACACACCAAGGGCGCCCGGACCGGAGAAATGCCCAATACCGGGAACGCAC

             ORF_2 rf(4)(968,1588)<<< 
             |
961   ccttgaattacttccacctggctgcagtacgtgattcttgatcccgagcttcgggttgga 1020
      GGAACTTAATGAAGGTGGACCGACGTCATGCACTAAGAACTAGGGCTCGAAGCCCAACCT

1021  agtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagtt 1080
      TCACCCACCCTCTCAAGCTCCGGAACGCGAATTCCTCGGGGAAGCGGAGCACGAACTCAA

1081  gaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgt 1140
      CTCCGGACCGGACCCGCGACCCCGGCGGCGCACGCTTAGACCACCGTGGAAGCGCGGACA

1141  ctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctt 1200
      GAGCGACGAAAGCTATTCAGAGATCGGTAAATTTTAAAAACTACTGGACGACGCTGCGAA

                                          BglII 
                                          |
1201  tttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtt 1260
      AAAAAGACCGTTCTATCAGAACATTTACGCCCGGTTCTAGACGTGTGACCATAAAGCCAA

                                 ApaI 
                                 |
1261  tttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcgg 1320
      AAACCCCGGCGCCCGCCGCTGCCCCGGGCACGCAGGGTCGCGTGTACAAGCCGCTCCGCC

1321  ggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgct 1380
      CCGGACGCTCGCGCCGGTGGCTCTTAGCCTGCCCCCATCAGAGTTCGACCGGCCGGACGA

1381  ctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccgg 1440
      GACCACGGACCGGAGCGCGGCGGCACATAGCGGGGCGGGACCCGCCGTTCCGACCGGGCC

                                                                SacI 
                                                                |
1441  tcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctca 1500
      AGCCGTGGTCAACGCACTCGCCTTTCTACCGGCGAAGGGCCGGGACGACGTCCCTCGAGT

1501  aaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagg 1560
      TTTACCTCCTGCGCCGCGAGCCCTCTCGCCCGCCCACTCAGTGGGTGTGTTTCCTTTTCC

1561  gcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccagg 1620
      CGGAAAGGCAGGAGTCGGCAGCGAAGTACACTGAGGTGCCTCATGGCCCGCGGCAGGTCC

1621  cacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttt 1680
      GTGGAGCTAATCAAGAGCTCGAAAACCTCATGCAGCAGAAATCCAACCCCCCTCCCCAAA

1681  tatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcac 1740
      ATACGCTACCTCAAAGGGGTGTGACTCACCCACCTCTGACTTCAATCCGGTCGAACCGTG

1741  ttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcattctcaag 1800
      AACTACATTAAGAGGAACCTTAAACGGGAAAAACTCAAACCTAGAACCAAGTAAGAGTTC

1801  cctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgaggaatttcgact 1860
      GGAGTCTGTCACCAAGTTTCAAAAAAAGAAGGTAAAGTCCACAGCACTCCTTAAAGCTGA

                   XbaI 
                   |
               EcoRV 
               |   |
1861  gctagcgatatctctagactcgagtacccatacgacgtcccagactacgctacgcgtctt 1920
      CGATCGCTATAGAGATCTGAGCTCATGGGTATGCTGCAGGGTCTGATGCGATGCGCAGAA

1921  aaggcgatcgcagacatgataagatacattgatgagtttggacaaaccacaactagaatg 1980
      TTCCGCTAGCGTCTGTACTATTCTATGTAACTACTCAAACCTGTTTGGTGTTGATCTTAC

1981  cagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccatt 2040
      GTCACTTTTTTTACGAAATAAACACTTTAAACACTACGATAACGAAATAAACATTGGTAA

2041  ataagctgcaataaacaagttaataacaacaattccattcattttatgtttcaggttcag 2100
      TATTCGACGTTATTTGTTCAATTATTGTTGTTAAGGTAAGTAAAATACAAAGTCCAAGTC

2101  ggggagatgtgggaggttttttaaagcaagtaaaacctctacaaatgtggtagtcgaaat 2160
      CCCCTCTACACCCTCCAAAAAATTTCGTTCATTTTGGAGATGTTTACACCATCAGCTTTA

2161  tcccgataaggatcttcctagagcatggctacgtagataagtagcatggcgggttaatca 2220
      AGGGCTATTCCTAGAAGGATCTCGTACCGATGCATCTATTCATCGTACCGCCCAATTAGT

2221  ttaactacaaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgc 2280
      AATTGATGTTCCTTGGGGATCACTACCTCAACCGGTGAGGGAGAGACGCGCGAGCGAGCG

2281  tcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcag 2340
      AGTGACTCCGGCCCGCTGGTTTCCAGCGGGCTGCGGGCCCGAAACGGGCCCGCCGGAGTC

                          BamHI 
                          |
2341  tgagcgagcgagcgcgcagggatcccggtgtgaaataccgcacagatgcgtaaggagaaa 2400
      ACTCGCTCGCTCGCGCGTCCCTAGGGCCACACTTTATGGCGTGTCTACGCATTCCTCTTT

2401  ataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcg 2460
      TATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGC

2461  gctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcagg 2520
      CGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCC

2521  ggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaa 2580
      CCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTT

         pBR322 origin(2584,3203)<<< 
         |
2581  ggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcg 2640
      CCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGC

2641  acgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccc 2700
      TGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGG

2701  tggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgc 2760
      ACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCG

2761  ctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttc 2820
      GAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAG

2821  ggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccg 2880
      CCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGC

2881  ctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcc 2940
      GACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGG

2941  actggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacaga 3000
      TGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCT

3001  gttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgc 3060
      CAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCG

3061  tctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaac 3120
      AGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTG

3121  caccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagg 3180
      GTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCC

3181  atctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactc 3240
      TAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAG

3241  acgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaa 3300
      TGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTT

3301  ttaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagtta 3360
      AATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAAT

3361  ccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagt 3420
      GGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCA

3421  tgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccag 3480
      ACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTC

3481  tgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaacca 3540
      ACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGT

3541  gccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtc 3600
      CGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAG

3601  tattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgt 3660
      ATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCA

3661  tgttgaaaaaggatcttcacctagatccttttcacgtagaaagccagtccgcagaaacgg 3720
      ACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCC

3721  tgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgca 3780
      ACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGT

3781  aagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggtttta 3840
      TTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAAAT

                     NEOKAN prom(3856,3905)>>> 
                     |
3841  tggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccc 3900
      ACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGG

3901  tgcaaagtaaactggatggctttctcgccgccaaggatctgatggcgcaggggatcaagc 3960
      ACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCG

                                          NTP_II marker(3997,4785)>>> 
                                          |
         BclI                          ORF_1 rf(1)(3994,4788)>>> 
         |                             |  |
3961  tctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgca 4020
      AGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGT

4021  ggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatc 4080
      CCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAG

4081  ggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtc 4140
      CCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAG

4141  aagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtgg 4200
      TTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACC

4201  ctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagg 4260
      GACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCC

4261  gactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcct 4320
      CTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGA

4321  gccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggct 4380
      CGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCCGA

4381  acctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaa 4440
      TGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTT

4441  gccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaa 4500
      CGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTT

                                 SphI                       NcoI 
                                 |                          |
4501  ctgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggc 4560
      GACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCG

4561  gatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgt 4620
      CTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACA

4621  ggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgct 4680
      CCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAACGA

4681  gaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctccc 4740
      CTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGG

4741  gattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattttgttaaaa 4800
      CTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTT

4801  tttttgttaaatcagctcattttttaaccaataggccgaaatcggcaacatcccttataa 4860
      AAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATT

                                      f1 origin(4893,5198)<<< 
                                      |
4861  atcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaagagtccact 4920
      TAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGA

4921  attaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggccc 4980
      TAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGG

4981  actacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaaagctctaaa 5040
      TGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTT

5041  tcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggc 5100
      AGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCG

5101  gagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggt 5160
      CTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCA

5161  cacgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacagggcgcgtccatt 5220
      GTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAA

5221  cgccattcaggatcgaattaattcttaattaacatcatcaataatatacctt 5272
      GCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA