pAAV-G-MSCV
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepAAV-G-MSCV
VectorTypeAAV Vector
Antibiotic InformationBacterial: Kanamycin
Sequencing PrimersMSCV sequencing primer
5'--GCC CAC AAC CCC TCA CTT--3'
Additional InformationThe gene expression is driven by a MSCV promoter, without any Tag or reporter.
Original Vector: 6198bp
Vector without Insert Casette: 4479bp
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta acctgcgcgc tcgctcgctc     
      481 actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg     
      541 agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc cttgtagtta     
      601 atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat cgcctaggtg     
      661 aaagacccca cctgtaggtt tggcaagtta gcttaagtaa cgccattttg caaggcatgg     
      721 aaaatacata actgagaata gagaagttca gatcaaggtt aggaacagag agacagcaga     
      781 atatgggcca aacaggatat ctgtggtaag cagttcctgc cccggctcag ggccaagaac     
      841 agatggtccc cagatgcggt cccgccctca gcagtttcta gcgaaccatc agatgtttcc     
      901 agggtgcccc aaggacctga aatgaccctg tgccttattt gaactaacca atcagtttgc     
      961 ttcttgcttc tgtttgtgtg cttctgctcc ctgagctcaa taaaagagcc cacaacccct     
     1021 cacttggtgg gccagtcctc tgatagactg tgtcccctgg atacccgtat ggtaccgcta     
     1081 gcgatatctg actcgagtac ccatacgacg tcccagacta cgctacgcgt cttaaggcga     
     1141 tcgcagacat gataagatac attgatgagt ttggacaaac cacaactaga atgcagtgaa     
     1201 aaaaatgctt tatttgtgaa atttgtgatg ctattgcttt atttgtaacc attataagct     
     1261 gcaataaaca agttaataac aacaattcca ttcattttat gtttcaggtt cagggggaga     
     1321 tgtgggaggt tttttaaagc aagtaaaacc tctacaaatg tggtagtcga aattcccgat     
     1381 aaggatcttc ctagagcatg gctacgtaga taagtagcat ggcgggttaa tcattaacta     
     1441 caaggaaccc ctagtgatgg agttggccac tccctctctg cgcgctcgct cgctcactga     
     1501 ggccgggcga ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct cagtgagcga     
     1561 gcgagcgcgc agggatcccg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc     
     1621 atcaggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg     
     1681 cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac     
     1741 gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg     
     1801 ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca     
     1861 agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc     
     1921 tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc     
     1981 ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag     
     2041 gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc     
     2101 ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca     
     2161 gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg     
     2221 aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg     
     2281 aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct     
     2341 ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa     
     2401 gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa     
     2461 gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa     
     2521 tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc     
     2581 ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga     
     2641 ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca     
     2701 atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc     
     2761 ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat     
     2821 tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgaa     
     2881 aaaggatctt cacctagatc cttttcacgt agaaagccag tccgcagaaa cggtgctgac     
     2941 cccggatgaa tgtcagctac tgggctatct ggacaaggga aaacgcaagc gcaaagagaa     
     3001 agcaggtagc ttgcagtggg cttacatggc gatagctaga ctgggcggtt ttatggacag     
     3061 caagcgaacc ggaattgcca gctggggcgc cctctggtaa ggttgggaag ccctgcaaag     
     3121 taaactggat ggctttctcg ccgccaagga tctgatggcg caggggatca agctctgatc     
     3181 aagagacagg atgaggatcg tttcgcatga ttgaacaaga tggattgcac gcaggttctc     
     3241 cggccgcttg ggtggagagg ctattcggct atgactgggc acaacagaca atcggctgct     
     3301 ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg     
     3361 acctgtccgg tgccctgaat gaactgcaag acgaggcagc gcggctatcg tggctggcca     
     3421 cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac tgaagcggga agggactggc     
     3481 tgctattggg cgaagtgccg gggcaggatc tcctgtcatc tcaccttgct cctgccgaga     
     3541 aagtatccat catggctgat gcaatgcggc ggctgcatac gcttgatccg gctacctgcc     
     3601 cattcgacca ccaagcgaaa catcgcatcg agcgagcacg tactcggatg gaagccggtc     
     3661 ttgtcgatca ggatgatctg gacgaagagc atcaggggct cgcgccagcc gaactgttcg     
     3721 ccaggctcaa ggcgagcatg cccgacggcg aggatctcgt cgtgacccat ggcgatgcct     
     3781 gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg attcatcgac tgtggccggc     
     3841 tgggtgtggc ggaccgctat caggacatag cgttggctac ccgtgatatt gctgaagagc     
     3901 ttggcggcga atgggctgac cgcttcctcg tgctttacgg tatcgccgct cccgattcgc     
     3961 agcgcatcgc cttctatcgc cttcttgacg agttcttctg aattttgtta aaatttttgt     
     4021 taaatcagct cattttttaa ccaataggcc gaaatcggca acatccctta taaatcaaaa     
     4081 gaatagaccg cgatagggtt gagtgttgtt ccagtttgga acaagagtcc actattaaag     
     4141 aacgtggact ccaacgtcaa agggcgaaaa accgtctatc agggcgatgg cccactacgt     
     4201 gaaccatcac ccaaatcaag ttttttgcgg tcgaggtgcc gtaaagctct aaatcggaac     
     4261 cctaaaggga gcccccgatt tagagcttga cggggaaagc cggcgaacgt ggcgagaaag     
     4321 gaagggaaga aagcgaaagg agcgggcgct agggcgctgg caagtgtagc ggtcacgctg     
     4381 cgcgtaacca ccacacccgc gcgcttaatg cgccgctaca gggcgcgtcc attcgccatt     
     4441 caggatcgaa ttaattctta attaacatca tcaataatat acctt
                                    LOCUS       dna                      4485 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    457..462
                     /dbxref="REBASE:HpaI"
     misc_binding    457..462
                     /dbxref="REBASE:HincII"
     misc_binding    993..998
                     /dbxref="REBASE:SacI"
     misc_binding    1071..1076
                     /dbxref="REBASE:KpnI"
     misc_binding    1092..1097
                     /dbxref="REBASE:XhoI"
     misc_binding    1573..1578
                     /dbxref="REBASE:BamHI"
     Rep_Origin      1797..2416
                     /gene="pBR322 origin"
     Promoter        3069..3118
                     /gene="NEOKAN prom"
     misc_binding    3176..3181
                     /dbxref="REBASE:BclI"
     ORF             3207..4001
                     /sequence="ORF_1 rf(3)"
     Marker          3210..3998
                     /gene="NTP_II marker"
     misc_binding    3736..3741
                     /dbxref="REBASE:SphI"
     misc_binding    3767..3772
                     /dbxref="REBASE:NcoI"
     Rep_Origin      4106..4411
                     /gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
      AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61    gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
      CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

                                               Encap other(162,310)>>> 
                                               |
121   cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
      GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181   aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
      TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241   aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
      TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301   tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
      ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

          amp prom(365,393)<<< 
          |
361   ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
      CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

                                             HincII 
                                             |
                                             HpaI 
                                             |
421   gttccgcgcacatttccccgaaaagtgccacctgacgttaacctgcgcgctcgctcgctc 480
      CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGGACGCGCGAGCGAGCGAG

481   actgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtg 540
      TGACTCCGGCGGGCCCGTTTCGGGCCCGCAGCCCGCTGGAAACCAGCGGGCCGGAGTCAC

541   agcgagcgagcgcgcagagagggagtggccaactccatcactaggggttccttgtagtta 600
      TCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGGAACATCAAT

601   atgattaacccgccatgctacttatctacgtagccatgctctaggaagatcgcctaggtg 660
      TACTAATTGGGCGGTACGATGAATAGATGCATCGGTACGAGATCCTTCTAGCGGATCCAC

661   aaagaccccacctgtaggtttggcaagttagcttaagtaacgccattttgcaaggcatgg 720
      TTTCTGGGGTGGACATCCAAACCGTTCAATCGAATTCATTGCGGTAAAACGTTCCGTACC

721   aaaatacataactgagaatagagaagttcagatcaaggttaggaacagagagacagcaga 780
      TTTTATGTATTGACTCTTATCTCTTCAAGTCTAGTTCCAATCCTTGTCTCTCTGTCGTCT

781   atatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaac 840
      TATACCCGGTTTGTCCTATAGACACCATTCGTCAAGGACGGGGCCGAGTCCCGGTTCTTG

841   agatggtccccagatgcggtcccgccctcagcagtttctagcgaaccatcagatgtttcc 900
      TCTACCAGGGGTCTACGCCAGGGCGGGAGTCGTCAAAGATCGCTTGGTAGTCTACAAAGG

901   agggtgccccaaggacctgaaatgaccctgtgccttatttgaactaaccaatcagtttgc 960
      TCCCACGGGGTTCCTGGACTTTACTGGGACACGGAATAAACTTGATTGGTTAGTCAAACG

                                           SacI 
                                           |
961   ttcttgcttctgtttgtgtgcttctgctccctgagctcaataaaagagcccacaacccct 1020
      AAGAACGAAGACAAACACACGAAGACGAGGGACTCGAGTTATTTTCTCGGGTGTTGGGGA

                                                             KpnI 
                                                             |
1021  cacttggtgggccagtcctctgatagactgtgtcccctggatacccgtatggtaccgcta 1080
      GTGAACCACCCGGTCAGGAGACTATCTGACACAGGGGACCTATGGGCATACCATGGCGAT

                  XhoI 
                  |
1081  gcgatatctgactcgagtacccatacgacgtcccagactacgctacgcgtcttaaggcga 1140
      CGCTATAGACTGAGCTCATGGGTATGCTGCAGGGTCTGATGCGATGCGCAGAATTCCGCT

1141  tcgcagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaa 1200
      AGCGTCTGTACTATTCTATGTAACTACTCAAACCTGTTTGGTGTTGATCTTACGTCACTT

1201  aaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagct 1260
      TTTTTACGAAATAAACACTTTAAACACTACGATAACGAAATAAACATTGGTAATATTCGA

1261  gcaataaacaagttaataacaacaattccattcattttatgtttcaggttcagggggaga 1320
      CGTTATTTGTTCAATTATTGTTGTTAAGGTAAGTAAAATACAAAGTCCAAGTCCCCCTCT

1321  tgtgggaggttttttaaagcaagtaaaacctctacaaatgtggtagtcgaaattcccgat 1380
      ACACCCTCCAAAAAATTTCGTTCATTTTGGAGATGTTTACACCATCAGCTTTAAGGGCTA

1381  aaggatcttcctagagcatggctacgtagataagtagcatggcgggttaatcattaacta 1440
      TTCCTAGAAGGATCTCGTACCGATGCATCTATTCATCGTACCGCCCAATTAGTAATTGAT

1441  caaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactga 1500
      GTTCCTTGGGGATCACTACCTCAACCGGTGAGGGAGAGACGCGCGAGCGAGCGAGTGACT

1501  ggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcga 1560
      CCGGCCCGCTGGTTTCCAGCGGGCTGCGGGCCCGAAACGGGCCCGCCGGAGTCACTCGCT

                   BamHI 
                   |
1561  gcgagcgcgcagggatcccggtgtgaaataccgcacagatgcgtaaggagaaaataccgc 1620
      CGCTCGCGCGTCCCTAGGGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTTATGGCG

1621  atcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcgg 1680
      TAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCCGACGCC

1681  cgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataac 1740
      GCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCCCTATTG

                                                              pBR322 origin(1797,2416)<<< 
                                                              |
1741  gcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcg 1800
      CGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCCGGCGC

1801  ttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctca 1860
      AACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTGCGAGT

1861  agtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagc 1920
      TCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGACCTTCG

1921  tccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctc 1980
      AGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGAAAGAG

1981  ccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtag 2040
      GGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGCCACATC

2041  gtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgcc 2100
      CAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCGACGCGG

2101  ttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggca 2160
      AATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGACCGT

2161  gcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttg 2220
      CGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTCAAGAAC

2221  aagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctg 2280
      TTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCGAGACGAC

2281  aagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgct 2340
      TTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGGTGGCGA

2341  ggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaa 2400
      CCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAGAGTT

2401  gaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaa 2460
      CTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGTGCAATT

2461  gggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaa 2520
      CCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTAATTTTT

2521  tgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgc 2580
      ACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAATGGTTACG

2581  ttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctga 2640
      AATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAACGGACT

2641  ctccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgca 2700
      GAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCACGACGT

2701  atgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagcc 2760
      TACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTCGGTCGG

2761  ggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaat 2820
      CCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGATAATTA

2821  tgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgaa 2880
      ACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAACAACTT

2881  aaaggatcttcacctagatccttttcacgtagaaagccagtccgcagaaacggtgctgac 2940
      TTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCACGACTG

2941  cccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaa 3000
      GGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTTTCTCTT

3001  agcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacag 3060
      TCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAAATACCTGTC

              NEOKAN prom(3069,3118)>>> 
              |
3061  caagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaag 3120
      GTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGACGTTTC

                                                              BclI 
                                                              |
3121  taaactggatggctttctcgccgccaaggatctgatggcgcaggggatcaagctctgatc 3180
      ATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGAGACTAG

                                   NTP_II marker(3210,3998)>>> 
                                   |
                                ORF_1 rf(3)(3207,4001)>>> 
                                |  |
3181  aagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctc 3240
      TTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTCCAAGAG

3241  cggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgct 3300
      GCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGCCGACGA

3301  ctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccg 3360
      GACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGTTCTGGC

3361  acctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggcca 3420
      TGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCGACCGGT

3421  cgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggc 3480
      GCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCCTGACCG

3481  tgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgaga 3540
      ACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGACGGCTCT

3541  aagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcc 3600
      TTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCCGATGGACGG

3601  cattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtc 3660
      GTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTCGGCCAG

3661  ttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcg 3720
      AACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTGACAAGC

                          SphI                       NcoI 
                          |                          |
3721  ccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcct 3780
      GGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGCTACGGA

3781  gcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggc 3840
      CGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACACCGGCCG

3841  tgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagc 3900
      ACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAACGACTTCTCG

3901  ttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgc 3960
      AACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGCTAAGCG

3961  agcgcatcgccttctatcgccttcttgacgagttcttctgaattttgttaaaatttttgt 4020
      TCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTAAAAACA

4021  taaatcagctcattttttaaccaataggccgaaatcggcaacatcccttataaatcaaaa 4080
      ATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTTAGTTTT

                               f1 origin(4106,4411)<<< 
                               |
4081  gaatagaccgcgatagggttgagtgttgttccagtttggaacaagagtccactattaaag 4140
      CTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGATAATTTC

4141  aacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgt 4200
      TTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGTGATGCA

4201  gaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaaagctctaaatcggaac 4260
      CTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTAGCCTTG

4261  cctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaag 4320
      GGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGCTCTTTC

4321  gaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctg 4380
      CTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAGTGCGAC

4381  cgcgtaaccaccacacccgcgcgcttaatgcgccgctacagggcgcgtccattcgccatt 4440
      GCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAGCGGTAA

4441  caggatcgaattaattcttaattaacatcatcaataatatacctt 4485
      GTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA