pAAV-G-PGK
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepAAV-G-PGK
VectorTypeAAV Plasmid
Antibiotic InformationBacterial: Kanamycin
Sequencing PrimersPGK sequencing primer
5'---AAT TCT ACC GGG TAG GGG AGG CGC T---3'
Additional InformationThe gene expression is driven by a PGK promoter, without any Tag or reporter.
Original vector size: 6304bp
Vector without insert: 4592bp
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta acctgcgcgc tcgctcgctc     
      481 actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg     
      541 agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc cttgtagtta     
      601 atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat cgcctaggca     
      661 attgccggta ggcgccaacc ggctccgttc tttggtggcc ccttcgcgcc accttctact     
      721 cctcccctag tcaggaagtt cccccccgcc ccgcagctcg cgtcgtgcag gacgtgacaa     
      781 atggaagtag cacgtctcac tagtctcgtg cagatggaca gcaccgctga gcaatggaag     
      841 cgggtaggcc tttggggcag cggccaatag cagctttgct ccttcgcttt ctgggctcag     
      901 aggctgggaa ggggtgggtc cgggggcggg ctcaggggcg ggctcagggg cggggcgggc     
      961 gcccgaaggt cctccggagg cccggcattc tgcacgcttc aaaagcgcac gtctgccgcg     
     1021 ctgttctcct cttcctcatc tccgggcctt tcgacggtac cgagctcgtt tagtgaaccg     
     1081 tcagatcgcc tggagacgcc atccacgctg ttttgacctc catagaagaa ccgagtttaa     
     1141 actccctatc agtgatagag atctccctat cagtgataga gagctagcga tatcaacaag     
     1201 tttgtacaaa aaagctgaac gagaaacgta aaatgatata aatatcaata tattaaatta     
     1261 gattttgcat aaaaaacaga ctacataata ctgtaaaaca caacatatcc agtcactatg     
     1321 gcggccgcat taggcacccc aggctttaca ctttatgctt ccggctcgta taatgtgtgg     
     1381 attttgagtt aggatccgtc gagattttca ggagctaagg aagctaaaat ggagaaaaaa     
     1441 atcactggat ataccaccgt tgatatatcc caatggcatc gtaaagaaca ttttgaggca     
     1501 tttcagtcag ttgctcaatg tacctataac cagaccgttc agctggatat tacggccttt     
     1561 ttaaagaccg taaagaaaaa taagcacaag ttttatccgg cctttattca cattcttgcc     
     1621 cgcctgatga atgctcatcc ggaattccgt atggcaatga aagacggtga gctggtgata     
     1681 tgggatagtg ttcacccttg ttacaccgtt ttccatgagc aaactgaaac gttttcatcg     
     1741 ctctggagtg aataccacga cgatttccgg cagtttctac acatatattc gcaagatgtg     
     1801 gcgtgttacg gtgaaaacct ggcctatttc cctaaagggt ttattgagaa tatgtttttc     
     1861 gtctcagcca atccctgggt gagtttcacc agttttgatt taaacgtggc caatatggac     
     1921 aacttcttcg cccccgtttt caccatgggc aaatattata cgcaaggcga caaggtgctg     
     1981 atgccgctgg cgattcaggt tcatcatgcc gtttgtgatg gcttccatgt cggcagaatg     
     2041 cttaatgaat tacaacagta ctgcgatgag tggcagggcg gggcgtaaag atctggatcc     
     2101 ggcttactaa aagccagata acagtatgcg tatttgcgcg ctgatttttg cggtataaga     
     2161 atatatactg atatgtatac ccgaagtatg tcaaaaagag gtatgctatg aagcagcgta     
     2221 ttacagtgac agttgacagc gacagctatc agttgctcaa ggcatatatg atgtcaatat     
     2281 ctccggtctg gtaagcacaa ccatgcagaa tgaagcccgt cgtctgcgtg ccgaacgctg     
     2341 gaaagcggaa aatcaggaag ggatggctga ggtcgcccgg tttattgaaa tgaacggctc     
     2401 ttttgctgac gagaacaggg gctggtgaaa tgcagtttaa ggtttacacc tataaaagag     
     2461 agagccgtta tcgtctgttt gtggatgtac agagtgatat tattgacacg cccgggcgac     
     2521 ggatggtgat ccccctggcc agtgcacgtc tgctgtcaga taaagtctcc cgtgaacttt     
     2581 acccggtggt gcatatcggg gatgaaagct ggcgcatgat gaccaccgat atggccagtg     
     2641 tgccggtctc cgttatcggg gaagaagtgg ctgatctcag ccaccgcgaa aatgacatca     
     2701 aaaacgccat taacctgatg ttctggggaa tataaatgtc aggctccctt atacacagcc     
     2761 agtctgcagg tcgaccatag tgactggata tgttgtgttt tacagtatta tgtagtctgt     
     2821 tttttatgca aaatctaatt taatatattg atatttatat cattttacgt ttctcgttca     
     2881 gctttcttgt acaaagtggt tgatatctga ctcgagtacc catacgacgt cccagactac     
     2941 gctacgcgtc ttaaggcgat cgcagacatg ataagataca ttgatgagtt tggacaaacc     
     3001 acaactagaa tgcagtgaaa aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta     
     3061 tttgtaacca ttataagctg caataaacaa gttaataaca acaattccat tcattttatg     
     3121 tttcaggttc agggggagat gtgggaggtt ttttaaagca agtaaaacct ctacaaatgt     
     3181 ggtagtcgaa attcccgata aggatcttcc tagagcatgg ctacgtagat aagtagcatg     
     3241 gcgggttaat cattaactac aaggaacccc tagtgatgga gttggccact ccctctctgc     
     3301 gcgctcgctc gctcactgag gccgggcgac caaaggtcgc ccgacgcccg ggctttgccc     
     3361 gggcggcctc agtgagcgag cgagcgcgca gggatcccgg tgtgaaatac cgcacagatg     
     3421 cgtaaggaga aaataccgca tcaggcgctc ttccgcttcc tcgctcactg actcgctgcg     
     3481 ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc     
     3541 cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag     
     3601 gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca     
     3661 tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca     
     3721 ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg     
     3781 atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag     
     3841 gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt     
     3901 tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca     
     3961 cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg     
     4021 cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt     
     4081 tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc     
     4141 cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg     
     4201 cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg     
     4261 gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta     
     4321 gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg     
     4381 gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg     
     4441 ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc     
     4501 atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc     
     4561 agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc     
     4621 ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag     
     4681 tttgcgcaac gttgttgaaa aaggatcttc acctagatcc ttttcacgta gaaagccagt     
     4741 ccgcagaaac ggtgctgacc ccggatgaat gtcagctact gggctatctg gacaagggaa     
     4801 aacgcaagcg caaagagaaa gcaggtagct tgcagtgggc ttacatggcg atagctagac     
     4861 tgggcggttt tatggacagc aagcgaaccg gaattgccag ctggggcgcc ctctggtaag     
     4921 gttgggaagc cctgcaaagt aaactggatg gctttctcgc cgccaaggat ctgatggcgc     
     4981 aggggatcaa gctctgatca agagacagga tgaggatcgt ttcgcatgat tgaacaagat     
     5041 ggattgcacg caggttctcc ggccgcttgg gtggagaggc tattcggcta tgactgggca     
     5101 caacagacaa tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg     
     5161 gttctttttg tcaagaccga cctgtccggt gccctgaatg aactgcaaga cgaggcagcg     
     5221 cggctatcgt ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact     
     5281 gaagcgggaa gggactggct gctattgggc gaagtgccgg ggcaggatct cctgtcatct     
     5341 caccttgctc ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg     
     5401 cttgatccgg ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt     
     5461 actcggatgg aagccggtct tgtcgatcag gatgatctgg acgaagagca tcaggggctc     
     5521 gcgccagccg aactgttcgc caggctcaag gcgagcatgc ccgacggcga ggatctcgtc     
     5581 gtgacccatg gcgatgcctg cttgccgaat atcatggtgg aaaatggccg cttttctgga     
     5641 ttcatcgact gtggccggct gggtgtggcg gaccgctatc aggacatagc gttggctacc     
     5701 cgtgatattg ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt gctttacggt     
     5761 atcgccgctc ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga     
     5821 attttgttaa aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa     
     5881 catcccttat aaatcaaaag aatagaccgc gatagggttg agtgttgttc cagtttggaa     
     5941 caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca     
     6001 gggcgatggc ccactacgtg aaccatcacc caaatcaagt tttttgcggt cgaggtgccg     
     6061 taaagctcta aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc     
     6121 ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc     
     6181 aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcg cgcttaatgc gccgctacag     
     6241 ggcgcgtcca ttcgccattc aggatcgaat taattcttaa ttaacatcat caataatata     
     6301 cctt                                                                
                                    LOCUS       dna                      6304 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    457..462
                     /dbxref="REBASE:HpaI"
     misc_binding    846..851
                     /dbxref="REBASE:StuI"
     misc_binding    1056..1061
                     /dbxref="REBASE:KpnI"
     misc_binding    1062..1067
                     /dbxref="REBASE:SacI"
     Regulatory_Seq  1143..1182
                     /gene="tetO reg"
     Other Gene      1196..1320
                     /gene="attR1 other"
     Other Gene      1220..1320
                     /gene="attR2 other"
     misc_binding    1321..1328
                     /dbxref="REBASE:NotI"
     Marker          1429..2088
                     /gene="CAT marker"
     ORF             1429..2088
                     /sequence="ORF_1 rf(1)"
     misc_binding    1642..1647
                     /dbxref="REBASE:EcoRI"
     Other Gene      2430..2735
                     /gene="ccdB other"
     misc_binding    2764..2769
                     /dbxref="REBASE:PstI"
     Other Gene      2776..2895
                     /gene="attR1 other"
     Other Gene      2776..2876
                     /gene="attR2 other"
     misc_binding    2911..2916
                     /dbxref="REBASE:XhoI"
     Rep_Origin      3616..4235
                     /gene="pBR322 origin"
     Promoter        4888..4937
                     /gene="NEOKAN prom"
     misc_binding    4995..5000
                     /dbxref="REBASE:BclI"
     ORF             5026..5820
                     /sequence="ORF_2 rf(1)"
     Marker          5029..5817
                     /gene="NTP_II marker"
     misc_binding    5555..5560
                     /dbxref="REBASE:SphI"
     Rep_Origin      5925..6230
                     /gene="f1 origin"
BASE COUNT    1580 a   1508 c   1682 g   1534 t    0 others
ORIGIN
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
      AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61    gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
      CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

                                               Encap other(162,310)>>> 
                                               |
121   cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
      GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181   aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
      TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241   aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
      TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301   tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
      ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

          amp prom(365,393)<<< 
          |
361   ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
      CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

                                             HpaI 
                                             |
421   gttccgcgcacatttccccgaaaagtgccacctgacgttaacctgcgcgctcgctcgctc 480
      CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGGACGCGCGAGCGAGCGAG

481   actgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtg 540
      TGACTCCGGCGGGCCCGTTTCGGGCCCGCAGCCCGCTGGAAACCAGCGGGCCGGAGTCAC

541   agcgagcgagcgcgcagagagggagtggccaactccatcactaggggttccttgtagtta 600
      TCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGGAACATCAAT

601   atgattaacccgccatgctacttatctacgtagccatgctctaggaagatcgcctaggca 660
      TACTAATTGGGCGGTACGATGAATAGATGCATCGGTACGAGATCCTTCTAGCGGATCCGT

661   attgccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttctact 720
      TAACGGCCATCCGCGGTTGGCCGAGGCAAGAAACCACCGGGGAAGCGCGGTGGAAGATGA

721   cctcccctagtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaa 780
      GGAGGGGATCAGTCCTTCAAGGGGGGGCGGGGCGTCGAGCGCAGCACGTCCTGCACTGTT

781   atggaagtagcacgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaag 840
      TACCTTCATCGTGCAGAGTGATCAGAGCACGTCTACCTGTCGTGGCGACTCGTTACCTTC

              StuI 
              |
841   cgggtaggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcag 900
      GCCCATCCGGAAACCCCGTCGCCGGTTATCGTCGAAACGAGGAAGCGAAAGACCCGAGTC

901   aggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggc 960
      TCCGACCCTTCCCCACCCAGGCCCCCGCCCGAGTCCCCGCCCGAGTCCCCGCCCCGCCCG

961   gcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcg 1020
      CGGGCTTCCAGGAGGCCTCCGGGCCGTAAGACGTGCGAAGTTTTCGCGTGCAGACGGCGC

                                              KpnI  SacI 
                                              |     |
1021  ctgttctcctcttcctcatctccgggcctttcgacggtaccgagctcgtttagtgaaccg 1080
      GACAAGAGGAGAAGGAGTAGAGGCCCGGAAAGCTGCCATGGCTCGAGCAAATCACTTGGC

1081  tcagatcgcctggagacgccatccacgctgttttgacctccatagaagaaccgagtttaa 1140
      AGTCTAGCGGACCTCTGCGGTAGGTGCGACAAAACTGGAGGTATCTTCTTGGCTCAAATT

        tetO reg(1143,1182)>>>                               attR1 other(1196,1320)>>> 
        |                                                    |
1141  actccctatcagtgatagagatctccctatcagtgatagagagctagcgatatcaacaag 1200
      TGAGGGATAGTCACTATCTCTAGAGGGATAGTCACTATCTCTCGATCGCTATAGTTGTTC

                         attR2 other(1220,1320)<<< 
                         |
1201  tttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaatta 1260
      AAACATGTTTTTTCGACTTGCTCTTTGCATTTTACTATATTTATAGTTATATAATTTAAT

1261  gattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatg 1320
      CTAAAACGTATTTTTTGTCTGATGTATTATGACATTTTGTGTTGTATAGGTCAGTGATAC

        NotI 
        |
1321  gcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtgg 1380
      CGCCGGCGTAATCCGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATATTACACACC

                                                      ORF_1 rf(1)(1429,2088)>>> 
                                                      |
                                                      CAT marker(1429,2088)>>> 
                                                      |
1381  attttgagttaggatccgtcgagattttcaggagctaaggaagctaaaatggagaaaaaa 1440
      TAAAACTCAATCCTAGGCAGCTCTAAAAGTCCTCGATTCCTTCGATTTTACCTCTTTTTT

1441  atcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggca 1500
      TAGTGACCTATATGGTGGCAACTATATAGGGTTACCGTAGCATTTCTTGTAAAACTCCGT

1501  tttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggccttt 1560
      AAAGTCAGTCAACGAGTTACATGGATATTGGTCTGGCAAGTCGACCTATAATGCCGGAAA

1561  ttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcc 1620
      AATTTCTGGCATTTCTTTTTATTCGTGTTCAAAATAGGCCGGAAATAAGTGTAAGAACGG

                            EcoRI 
                            |
1621  cgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgata 1680
      GCGGACTACTTACGAGTAGGCCTTAAGGCATACCGTTACTTTCTGCCACTCGACCACTAT

1681  tgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcg 1740
      ACCCTATCACAAGTGGGAACAATGTGGCAAAAGGTACTCGTTTGACTTTGCAAAAGTAGC

1741  ctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtg 1800
      GAGACCTCACTTATGGTGCTGCTAAAGGCCGTCAAAGATGTGTATATAAGCGTTCTACAC

1801  gcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttc 1860
      CGCACAATGCCACTTTTGGACCGGATAAAGGGATTTCCCAAATAACTCTTATACAAAAAG

1861  gtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggac 1920
      CAGAGTCGGTTAGGGACCCACTCAAAGTGGTCAAAACTAAATTTGCACCGGTTATACCTG

1921  aacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctg 1980
      TTGAAGAAGCGGGGGCAAAAGTGGTACCCGTTTATAATATGCGTTCCGCTGTTCCACGAC

1981  atgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatg 2040
      TACGGCGACCGCTAAGTCCAAGTAGTACGGCAAACACTACCGAAGGTACAGCCGTCTTAC

2041  cttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatcc 2100
      GAATTACTTAATGTTGTCATGACGCTACTCACCGTCCCGCCCCGCATTTCTAGACCTAGG

2101  ggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataaga 2160
      CCGAATGATTTTCGGTCTATTGTCATACGCATAAACGCGCGACTAAAAACGCCATATTCT

2161  atatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgaagcagcgta 2220
      TATATATGACTATACATATGGGCTTCATACAGTTTTTCTCCATACGATACTTCGTCGCAT

2221  ttacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatat 2280
      AATGTCACTGTCAACTGTCGCTGTCGATAGTCAACGAGTTCCGTATATACTACAGTTATA

2281  ctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctg 2340
      GAGGCCAGACCATTCGTGTTGGTACGTCTTACTTCGGGCAGCAGACGCACGGCTTGCGAC

2341  gaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctc 2400
      CTTTCGCCTTTTAGTCCTTCCCTACCGACTCCAGCGGGCCAAATAACTTTACTTGCCGAG

                                   ccdB other(2430,2735)>>> 
                                   |
2401  ttttgctgacgagaacaggggctggtgaaatgcagtttaaggtttacacctataaaagag 2460
      AAAACGACTGCTCTTGTCCCCGACCACTTTACGTCAAATTCCAAATGTGGATATTTTCTC

2461  agagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgac 2520
      TCTCGGCAATAGCAGACAAACACCTACATGTCTCACTATAATAACTGTGCGGGCCCGCTG

2521  ggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaacttt 2580
      CCTACCACTAGGGGGACCGGTCACGTGCAGACGACAGTCTATTTCAGAGGGCACTTGAAA

2581  acccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtg 2640
      TGGGCCACCACGTATAGCCCCTACTTTCGACCGCGTACTACTGGTGGCTATACCGGTCAC

2641  tgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatca 2700
      ACGGCCAGAGGCAATAGCCCCTTCTTCACCGACTAGAGTCGGTGGCGCTTTTACTGTAGT

2701  aaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagcc 2760
      TTTTGCGGTAATTGGACTACAAGACCCCTTATATTTACAGTCCGAGGGAATATGTGTCGG

                     attR2 other(2776,2876)>>> 
                     |
              PstI   attR1 other(2776,2895)<<< 
              |      |
2761  agtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgt 2820
      TCAGACGTCCAGCTGGTATCACTGACCTATACAACACAAAATGTCATAATACATCAGACA

2821  tttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttca 2880
      AAAAATACGTTTTAGATTAAATTATATAACTATAAATATAGTAAAATGCAAAGAGCAAGT

                                     XhoI 
                                     |
2881  gctttcttgtacaaagtggttgatatctgactcgagtacccatacgacgtcccagactac 2940
      CGAAAGAACATGTTTCACCAACTATAGACTGAGCTCATGGGTATGCTGCAGGGTCTGATG

2941  gctacgcgtcttaaggcgatcgcagacatgataagatacattgatgagtttggacaaacc 3000
      CGATGCGCAGAATTCCGCTAGCGTCTGTACTATTCTATGTAACTACTCAAACCTGTTTGG

3001  acaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgcttta 3060
      TGTTGATCTTACGTCACTTTTTTTACGAAATAAACACTTTAAACACTACGATAACGAAAT

3061  tttgtaaccattataagctgcaataaacaagttaataacaacaattccattcattttatg 3120
      AAACATTGGTAATATTCGACGTTATTTGTTCAATTATTGTTGTTAAGGTAAGTAAAATAC

3121  tttcaggttcagggggagatgtgggaggttttttaaagcaagtaaaacctctacaaatgt 3180
      AAAGTCCAAGTCCCCCTCTACACCCTCCAAAAAATTTCGTTCATTTTGGAGATGTTTACA

3181  ggtagtcgaaattcccgataaggatcttcctagagcatggctacgtagataagtagcatg 3240
      CCATCAGCTTTAAGGGCTATTCCTAGAAGGATCTCGTACCGATGCATCTATTCATCGTAC

3241  gcgggttaatcattaactacaaggaacccctagtgatggagttggccactccctctctgc 3300
      CGCCCAATTAGTAATTGATGTTCCTTGGGGATCACTACCTCAACCGGTGAGGGAGAGACG

3301  gcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgccc 3360
      CGCGAGCGAGCGAGTGACTCCGGCCCGCTGGTTTCCAGCGGGCTGCGGGCCCGAAACGGG

3361  gggcggcctcagtgagcgagcgagcgcgcagggatcccggtgtgaaataccgcacagatg 3420
      CCCGCCGGAGTCACTCGCTCGCTCGCGCGTCCCTAGGGCCACACTTTATGGCGTGTCTAC

3421  cgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcg 3480
      GCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGC

3481  ctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatc 3540
      GAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAG

3541  cacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccag 3600
      GTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTC

                     pBR322 origin(3616,4235)<<< 
                     |
3601  gaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagca 3660
      CTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGT

3661  tcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagatacca 3720
      AGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGT

3721  ggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccgg 3780
      CCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCC

3781  atacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag 3840
      TATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATC

3841  gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgt 3900
      CATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCA

3901  tcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagaca 3960
      AGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGT

3961  cgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtagg 4020
      GCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCC

4021  cggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatt 4080
      GCCACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAA

4081  tggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatc 4140
      ACCATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAG

4141  cggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcg 4200
      GCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGC

4201  cagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtg 4260
      GTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCAC

4261  gaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcaccta 4320
      CTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGAT

4321  gatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttg 4380
      CTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAAC

4381  gtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcg 4440
      CAGACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGC

4441  ttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttacc 4500
      AAGTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGG

4501  atctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatc 4560
      TAGACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAG

4561  agcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgc 4620
      TCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCG

4621  ctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatag 4680
      GAGGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATC

4681  tttgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgtagaaagccagt 4740
      AAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCA

4741  ccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaa 4800
      GGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTT

4801  aacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagac 4860
      TTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTG

                                 NEOKAN prom(4888,4937)>>> 
                                 |
4861  tgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaag 4920
      ACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTC

4921  gttgggaagccctgcaaagtaaactggatggctttctcgccgccaaggatctgatggcgc 4980
      CAACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCG

                                                      NTP_II marker(5029,5817)>>> 
                                                      |
                     BclI                          ORF_2 rf(1)(5026,5820)>>> 
                     |                             |  |
4981  aggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagat 5040
      TCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTA

5041  ggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggca 5100
      CCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGT

5101  caacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccg 5160
      GTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGC

5161  gttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcg 5220
      CAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGC

5221  cggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcact 5280
      GCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGA

5281  gaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatct 5340
      CTTCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGA

5341  caccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacg 5400
      GTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGC

5401  cttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgt 5460
      GAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCA

5461  actcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctc 5520
      TGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAG

                                             SphI 
                                             |
5521  gcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtc 5580
      CGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAG

5581  gtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctgga 5640
      CACTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCT

5641  ttcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacc 5700
      AAGTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGG

5701  cgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggt 5760
      GCACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCA

5761  atcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctga 5820
      TAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACT

5821  attttgttaaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaa 5880
      TAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTT

                                                  f1 origin(5925,6230)<<< 
                                                  |
5881  catcccttataaatcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaa 5940
      GTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTT

5941  caagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatca 6000
      GTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGT

6001  gggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccg 6060
      CCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGC

6061  taaagctctaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagcc 6120
      ATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGG

6121  ggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggc 6180
      CCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCG

6181  aagtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacag 6240
      TTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTC

6241  ggcgcgtccattcgccattcaggatcgaattaattcttaattaacatcatcaataatata 6300
      CCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATAT

6301  cctt 6304
      GGAA