pLenti-Bi-cistronic
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepLenti-Bi-cistronic
VectorTypeLentivirus
Antibiotic InformationPuromycin
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag
541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg
601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact
661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct
721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt
781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac
841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc
901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc
961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa
1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg
1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata
1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc
1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga
1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc
1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca
1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag
1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta
1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga
1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg
1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg
1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc
1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg
1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat
1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac
1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat
1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca
2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga
2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg
2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa
2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga
2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag
2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa
2401 aattcaaaat tttcgggttt ttcgaaccta gcagacgtcg gcagtgaaaa aaatgcttta
2461 tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag
2521 ttaacaacaa gaattgcatt cattttatgt ttcaggttca gggggaggtg tgggaggttt
2581 tttaaagcaa gtaaaacctc tacaaatgtg gtatggctga ttatgatctc acctaggctc
2641 gagggatccc ccgggcgatc tgacggttca ctaaacgagc tctgcttata taggcctccc
2701 accgtacacg ccacctcgac ataaattcta ccgggtaggg gaggcgcttt tcccaaggca
2761 gtctggagca tgcgctttag cagccccgct gggcacttgg cgctacacaa gtggcctctg
2821 gcctcgcaca cattccacat ccaccggtag gcgccaaccg gctccgttct ttggtggccc
2881 cttcgcgcca ccttctactc ctcccctagt caggaagttc ccccccgccc cgcagctcgc
2941 gtcgtgcagg acgtgacaaa tggaagtagc acgtctcact agtctcgtgc agatggacag
3001 caccgctgag caatggaagc gggtaggcct ttggggcagc ggccaatagc agctttgctc
3061 cttcgctttc tgggctcaga ggctgggaag gggtgggtcc gggggcgggc tcaggggcgg
3121 gctcaggggc ggggcgggcg cccgaaggtc ctccggaggc ccggcattct gcacgcttca
3181 aaagcgcacg tctgccgcgc tgttctcctc ttcctcatct ccgggccttt cgacctatcg
3241 atcaattgag tacttacgta ggtaccgaat tcgatatcgg gcccgcggcc gcgtctagat
3301 gagtcgagta cccatacgac gtcccagact acgcttgagt ttaaacacgc gtggtgtgga
3361 aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca
3421 accaggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc
3481 aattagtcag caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc
3541 agttccgccc attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag
3601 gccgcctcgg cctctgagct attccagaag tagtgaggag gcttttttgg aggccatgac
3661 cgagtacaag cccacggtgc gcctcgccac ccgcgacgac gtccctcggg ccgtacgcac
3721 cctcgccgcc gcgttcgccg actaccccgc cacgcgccac accgtggacc cggaccgcca
3781 catcgagcgg gtcaccgagc tgcaagaact cttcctcacg cgcgtcgggc tcgacatcgg
3841 caaggtgtgg gtcgcggacg acggcgccgc ggtggcggtc tggaccacgc cggagagcgt
3901 cgaagcgggg gcggtgttcg ccgagatcgg cccgcgcatg gccgagttga gcggttcccg
3961 gctggccgcg cagcaacaga tggaagggct cctggcgccg caccggccca aggagcccgc
4021 gtggttcctg gccaccgtcg gcgtctcgcc cgaccaccag ggcaagggtc tgggcagcgc
4081 cgtcgtgctc cccggagtgg aggcggccga gcgcgccggg gtgcccgcct tcctggagac
4141 ctccgcgccc cgcaacctcc ccttctacga gcggctcggc ttcaccgtca ccgccgacgt
4201 cgaggtgccc gaaggaccgc gcacctggtg catgacccgc aagcccggtg cctgaacgcg
4261 ttccggaaat caacctctgg attacaaaat ttgtgaaaga ttgactggta ttcttaacta
4321 tgttgctcct tttacgctat gtggatacgc tgctttaatg cctttgtatc atgctattgc
4381 ttcccgtatg gctttcattt tctcctcctt gtataaatcc tggttgctgt ctctttatga
4441 ggagttgtgg cccgttgtca ggcaacgtgg cgtggtgtgc actgtgtttg ctgacgcaac
4501 ccccactggt tggggcattg ccaccacctg tcagctcctt tccgggactt tcgctttccc
4561 cctccctatt gccacggcgg aactcatcgc cgcctgcctt gcccgctgct ggacaggggc
4621 tcggctgttg ggcactgaca attccgtggt gttgtcgggg aagctgacgt cctttccatg
4681 gctgctcgcc tgtgttgcca cctggattct gcgcgggacg tccttctgct acgtcccttc
4741 ggccctcaat ccagcggacc ttccttcccg cggcctgctg ccggctctgc ggcctcttcc
4801 gcgtctcgcc ttcgccctca gacgagtcgg atctcccttt gggccgcctc cccgcctgtc
4861 cggatggaag ggctaattca ctcccaacga atacaagatc tgctttttgc ttgtactggg
4921 tctctctggt tagaccagat ctgagcctgg gagctctctg gctaactagg gaacccactg
4981 cttaagcctc aataaagctt gccttgagtg cttcaagtag tgtgtgcccg tctgttgtgt
5041 gactctggta actagagatc cctcagaccc ttttagtcag tgtggaaaat ctctagcagt
5101 agtagttcat gtcatcttat tattcagtat ttataacttg caaagaaatg aatatcagag
5161 agtgagagga acttgtttat tgcagcttat aatggttaca aataaagcaa tagcatcaca
5221 aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc
5281 aatgtatctt atcatgtctg gcatctatgt cgggtgcgga gaaagaggta atgaaatggc
5341 attatgggta ttatgggtct gcattaatga atcggccaac gatcccggtg tgaaataccg
5401 cacagatgcg taaggagaaa ataccgcatc aggcgctctt ccgcttcctc gctcactgac
5461 tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata
5521 cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa
5581 aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct
5641 gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa
5701 agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg
5761 cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca
5821 cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa
5881 ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg
5941 gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg
6001 tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg
6061 acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc
6121 tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag
6181 attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac
6241 gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc
6301 ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag
6361 taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt
6421 ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag
6481 ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca
6541 gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact
6601 ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca
6661 gttaatagtt tgcgcaacgt tgttgaaaaa ggatcttcac ctagatcctt ttcacgtaga
6721 aagccagtcc gcagaaacgg tgctgacccc ggatgaatgt cagctactgg gctatctgga
6781 caagggaaaa cgcaagcgca aagagaaagc aggtagcttg cagtgggctt acatggcgat
6841 agctagactg ggcggtttta tggacagcaa gcgaaccgga attgccagct ggggcgccct
6901 ctggtaaggt tgggaagccc tgcaaagtaa actggatggc tttctcgccg ccaaggatct
6961 gatggcgcag gggatcaagc tctgatcaag agacaggatg aggatcgttt cgcatgattg
7021 aacaagatgg attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg
7081 actgggcaca acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg
7141 ggcgcccggt tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaagacg
7201 aggcagcgcg gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg
7261 ttgtcactga agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc
7321 tgtcatctca ccttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc
7381 tgcatacgct tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc
7441 gagcacgtac tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc
7501 aggggctcgc gccagccgaa ctgttcgcca ggctcaaggc gagcatgccc gacggcgagg
7561 atctcgtcgt gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct
7621 tttctggatt catcgactgt ggccggctgg gtgtggcgga ccgctatcag gacatagcgt
7681 tggctacccg tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc
7741 tttacggtat cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt
7801 tcttctgaat tttgttaaaa tttttgttaa atcagctcat tttttaacca ataggccgaa
7861 atcggcaaca tcccttataa atcaaaagaa tagaccgcga tagggttgag tgttgttcca
7921 gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc
7981 gtctatcagg gcgatggccc actacgtgaa ccatcaccca aatcaagttt tttgcggtcg
8041 aggtgccgta aagctctaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg
8101 ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg
8161 gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgcgcg cttaatgcgc
8221 cgctacaggg cgcgtccatt cgccattcag gatcgaatta attcttaatt aacatcatca
8281 ataatatacc tt
                                    LOCUS       dna                      8292 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
Other Gene 715..895
/gene="HIV-1_5_LTR other"
Other Gene 1006..1050
/gene="HIV-1_psi_pack other"
misc_binding 1092..1097
/dbxref="REBASE:NruI"
Regulatory_Seq 1557..1790
/gene="RRE reg"
ORF 1600..2301
/sequence="ORF_1 rf(1)"
misc_binding 2638..2643
/dbxref="REBASE:XhoI"
misc_binding 2644..2649
/dbxref="REBASE:BamHI"
misc_binding 2650..2655
/dbxref="REBASE:XmaI"
misc_binding 2650..2655
/dbxref="REBASE:SmaI"
Promoter 2723..2656
/gene="Mini CMV prom"
Promoter 2724..3236
/gene="PGK prom"
misc_binding 3237..3242
/dbxref="REBASE:ClaI"
misc_binding 3261..3266
/dbxref="REBASE:KpnI"
misc_binding 3267..3272
/dbxref="REBASE:EcoRI"
misc_binding 3273..3278
/dbxref="REBASE:EcoRV"
misc_binding 3279..3284
/dbxref="REBASE:ApaI"
misc_binding 3285..3292
/dbxref="REBASE:NotI"
misc_binding 3294..3299
/dbxref="REBASE:XbaI"
Promoter 3353..3621
/gene="SV40 prom"
Rep_Origin 3520..3597
/gene="SV40 origin"
ORF 3587..4255
/sequence="ORF_2 rf(2)"
misc_binding 3600..3612
/dbxref="REBASE:SfiI"
Marker 3656..4255
/gene="puro marker"
Other Gene 4865..4917
/gene="delta_U3 other"
Other Gene 4918..5098
/gene="HIV-1_5_LTR other"
Rep_Origin 5604..6223
/gene="pBR322 origin"
Promoter 6876..6925
/gene="NEOKAN prom"
misc_binding 6983..6988
/dbxref="REBASE:BclI"
ORF 7014..7808
/sequence="ORF_3 rf(3)"
Marker 7017..7805
/gene="NTP_II marker"
Rep_Origin 7913..8218
/gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 540
CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541 caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 600
GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601 tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 660
ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

HIV-1_5_LTR other(715,895)>>>
|
661 gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 720
CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721 ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 780
GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781 aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 840
TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841 tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 900
AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901 gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 960
CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

HIV-1_psi_pack other(1006,1050)>>>
|
961 ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 1020
CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021 ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 1080
AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

NruI
|
1081 ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 1140
CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141 aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 1200
TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201 tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 1260
ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261 caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 1320
GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321 aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 1380
TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381 aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 1440
TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441 ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 1500
CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

RRE reg(1557,1790)>>>
|
1501 gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 1560
CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

ORF_1 rf(1)(1600,2301)>>>
|
1561 gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 1620
CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621 ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 1680
GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681 agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 1740
TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741 caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 1800
GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801 ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 1860
CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861 aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 1920
TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921 aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 1980
TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981 gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 2040
CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041 aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 2100
TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101 atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 2160
TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161 tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 2220
AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221 ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 2280
CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281 aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 2340
TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

2341 aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 2400
TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

2401 aattcaaaattttcgggtttttcgaacctagcagacgtcggcagtgaaaaaaatgcttta 2460
TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCGTCTGCAGCCGTCACTTTTTTTACGAAAT

2461 tttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaag 2520
AAACACTTTAAACACTACGATAACGAAATAAACATTGGTAATATTCGACGTTATTTGTTC

2521 ttaacaacaagaattgcattcattttatgtttcaggttcagggggaggtgtgggaggttt 2580
AATTGTTGTTCTTAACGTAAGTAAAATACAAAGTCCAAGTCCCCCTCCACACCCTCCAAA

XhoI
|
2581 tttaaagcaagtaaaacctctacaaatgtggtatggctgattatgatctcacctaggctc 2640
AAATTTCGTTCATTTTGGAGATGTTTACACCATACCGACTAATACTAGAGTGGATCCGAG

SmaI
|
BamHI XmaI
| | |
2641 gagggatcccccgggcgatctgacggttcactaaacgagctctgcttatataggcctccc 2700
CTCCCTAGGGGGCCCGCTAGACTGCCAAGTGATTTGCTCGAGACGAATATATCCGGAGGG

PGK prom.(2723,3236)>>>
|
Mini CMV prom.(2722,2656)<<<
||
2701 accgtacacgccacctcgacataaattctaccgggtaggggaggcgcttttcccaaggca 2760
TGGCATGTGCGGTGGAGCTGTATTTAAGATGGCCCATCCCCTCCGCGAAAAGGGTTCCGT

2761 gtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctg 2820
CAGACCTCGTACGCGAAATCGTCGGGGCGACCCGTGAACCGCGATGTGTTCACCGGAGAC

2821 gcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggtggccc 2880
CGGAGCGTGTGTAAGGTGTAGGTGGCCATCCGCGGTTGGCCGAGGCAAGAAACCACCGGG

2881 cttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgc 2940
GAAGCGCGGTGGAAGATGAGGAGGGGATCAGTCCTTCAAGGGGGGGCGGGGCGTCGAGCG

2941 gtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacag 3000
CAGCACGTCCTGCACTGTTTACCTTCATCGTGCAGAGTGATCAGAGCACGTCTACCTGTC

3001 caccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctc 3060
GTGGCGACTCGTTACCTTCGCCCATCCGGAAACCCCGTCGCCGGTTATCGTCGAAACGAG

3061 cttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgg 3120
GAAGCGAAAGACCCGAGTCTCCGACCCTTCCCCACCCAGGCCCCCGCCCGAGTCCCCGCC

3121 gctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttca 3180
CGAGTCCCCGCCCCGCCCGCGGGCTTCCAGGAGGCCTCCGGGCCGTAAGACGTGCGAAGT

ClaI
|
3181 aaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacctatcg 3240
TTTCGCGTGCAGACGGCGCGACAAGAGGAGAAGGAGTAGAGGCCCGGAAAGCTGGATAGC

EcoRI NotI
| |
KpnI EcoRV ApaI XbaI
| | | | | |
3241 atcaattgagtacttacgtaggtaccgaattcgatatcgggcccgcggccgcgtctagat 3300
TAGTTAACTCATGAATGCATCCATGGCTTAAGCTATAGCCCGGGCGCCGGCGCAGATCTA

SV40 prom(3353,3621)>>>
|
3301 gagtcgagtacccatacgacgtcccagactacgcttgagtttaaacacgcgtggtgtgga 3360
CTCAGCTCATGGGTATGCTGCAGGGTCTGATGCGAACTCAAATTTGTGCGCACCACACCT

3361 aagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagca 3420
TTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGT

3421 accaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctc 3480
TGGTCCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAG

SV40 origin(3520,3597)>>>
|
3481 aattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgccc 3540
TTAATCAGTCGTTGGTATCAGGGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGCGGG

ORF_2 rf(2)(3587,4255)>>>
|
3541 agttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgag 3600
TCAAGGCGGGTAAGAGGCGGGGTACCGACTGATTAAAAAAAATAAATACGTCTCCGGCTC

SfiI puro marker(3656,4255)>>>
| |
3601 gccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggccatgac 3660
CGGCGGAGCCGGAGACTCGATAAGGTCTTCATCACTCCTCCGAAAAAACCTCCGGTACTG

3661 cgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccctcgggccgtacgcac 3720
GCTCATGTTCGGGTGCCACGCGGAGCGGTGGGCGCTGCTGCAGGGAGCCCGGCATGCGTG

3721 cctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtggacccggaccgcca 3780
GGAGCGGCGGCGCAAGCGGCTGATGGGGCGGTGCGCGGTGTGGCACCTGGGCCTGGCGGT

3781 catcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcgg 3840
GTAGCTCGCCCAGTGGCTCGACGTTCTTGAGAAGGAGTGCGCGCAGCCCGAGCTGTAGCC

3841 caaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgt 3900
GTTCCACACCCAGCGCCTGCTGCCGCGGCGCCACCGCCAGACCTGGTGCGGCCTCTCGCA

3901 cgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccg 3960
GCTTCGCCCCCGCCACAAGCGGCTCTAGCCGGGCGCGTACCGGCTCAACTCGCCAAGGGC

3961 gctggccgcgcagcaacagatggaagggctcctggcgccgcaccggcccaaggagcccgc 4020
CGACCGGCGCGTCGTTGTCTACCTTCCCGAGGACCGCGGCGTGGCCGGGTTCCTCGGGCG

4021 gtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgc 4080
CACCAAGGACCGGTGGCAGCCGCAGAGCGGGCTGGTGGTCCCGTTCCCAGACCCGTCGCG

4081 cgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagac 4140
GCAGCACGAGGGGCCTCACCTCCGCCGGCTCGCGCGGCCCCACGGGCGGAAGGACCTCTG

4141 ctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgt 4200
GAGGCGCGGGGCGTTGGAGGGGAAGATGCTCGCCGAGCCGAAGTGGCAGTGGCGGCTGCA

4201 cgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaacgcg 4260
GCTCCACGGGCTTCCTGGCGCGTGGACCACGTACTGGGCGTTCGGGCCACGGACTTGCGC

4261 ttccggaaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaacta 4320
AAGGCCTTTAGTTGGAGACCTAATGTTTTAAACACTTTCTAACTGACCATAAGAATTGAT

4321 tgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgc 4380
ACAACGAGGAAAATGCGATACACCTATGCGACGAAATTACGGAAACATAGTACGATAACG

4381 ttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatga 4440
AAGGGCATACCGAAAGTAAAAGAGGAGGAACATATTTAGGACCAACGACAGAGAAATACT

4441 ggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaac 4500
CCTCAACACCGGGCAACAGTCCGTTGCACCGCACCACACGTGACACAAACGACTGCGTTG

4501 ccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccc 4560
GGGGTGACCAACCCCGTAACGGTGGTGGACAGTCGAGGAAAGGCCCTGAAAGCGAAAGGG

4561 cctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggc 4620
GGAGGGATAACGGTGCCGCCTTGAGTAGCGGCGGACGGAACGGGCGACGACCTGTCCCCG

4621 tcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatg 4680
AGCCGACAACCCGTGACTGTTAAGGCACCACAACAGCCCCTTCGACTGCAGGAAAGGTAC

4681 gctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttc 4740
CGACGAGCGGACACAACGGTGGACCTAAGACGCGCCCTGCAGGAAGACGATGCAGGGAAG

4741 ggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttcc 4800
CCGGGAGTTAGGTCGCCTGGAAGGAAGGGCGCCGGACGACGGCCGAGACGCCGGAGAAGG

4801 gcgtctcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcctgtc 4860
CGCAGAGCGGAAGCGGGAGTCTGCTCAGCCTAGAGGGAAACCCGGCGGAGGGGCGGACAG

delta_U3 other(4865,4917)>>> HIV-1_5_LTR other(4918,5098)>>>
| |
4861 cggatggaagggctaattcactcccaacgaatacaagatctgctttttgcttgtactggg 4920
GCCTACCTTCCCGATTAAGTGAGGGTTGCTTATGTTCTAGACGAAAAACGAACATGACCC

4921 tctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactg 4980
AGAGAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGAC

4981 cttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgt 5040
GAATTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACA

5041 gactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagt 5100
CTGAGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCA

5101 agtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagag 5160
TCATCAAGTACAGTAGAATAATAAGTCATAAATATTGAACGTTTCTTTACTTATAGTCTC

5161 agtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcaca 5220
TCACTCTCCTTGAACAAATAACGTCGAATATTACCAATGTTTATTTCGTTATCGTAGTGT

5221 aatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatc 5280
TTAAAGTGTTTATTTCGTAAAAAAAGTGACGTAAGATCAACACCAAACAGGTTTGAGTAG

5281 aatgtatcttatcatgtctggcatctatgtcgggtgcggagaaagaggtaatgaaatggc 5340
TTACATAGAATAGTACAGACCGTAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCG

5341 attatgggtattatgggtctgcattaatgaatcggccaacgatcccggtgtgaaataccg 5400
TAATACCCATAATACCCAGACGTAATTACTTAGCCGGTTGCTAGGGCCACACTTTATGGC

5401 cacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgac 5460
GTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTG

5461 tcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaata 5520
AGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTAT

5521 cggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaa 5580
GCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTT

pBR322 origin(5604,6223)<<<
|
5581 aaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccct 5640
TTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGA

5641 gacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataa 5700
CTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATT

5701 agataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccg 5760
TCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGC

5761 cttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctca 5820
GAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGT

5821 cgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaa 5880
GCGACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTT

5881 ccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccg 5940
GGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGC

5941 gtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgagg 6000
CATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCC

6001 tatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagg 6060
ATACATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCC

6061 acagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagc 6120
TGTCATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCG

6121 tcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcag 6180
AGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTC

6181 attacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgac 6240
TAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTG

6241 gctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatc 6300
CGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAG

6301 ttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgag 6360
AAGTGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTC

6361 taaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgt 6420
ATTTGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACA

6421 ctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggag 6480
GATAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTC

6481 ggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctcca 6540
CCGAATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGT

6541 gatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaact 6600
CTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGA

6601 ttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgcca 6660
AATAGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGT

6661 gttaatagtttgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgtaga 6720
CAATTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCT

6721 aagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctgga 6780
TTCGGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCT

6781 caagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgat 6840
GTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTA

NEOKAN prom(6876,6925)>>>
|
6841 agctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccct 6900
TCGATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGA

6901 ctggtaaggttgggaagccctgcaaagtaaactggatggctttctcgccgccaaggatct 6960
GACCATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGA

NTP_II marker(7017,7805)>>>
|
BclI ORF_3 rf(3)(7014,7808)>>>
| | |
6961 gatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattg 7020
CTACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAAC

7021 aacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatg 7080
TTGTTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATAC

7081 actgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcagg 7140
TGACCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCC

7141 ggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacg 7200
CCGCGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGC

7201 aggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacg 7260
TCCGTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGC

7261 ttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcc 7320
AACAGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGG

7321 tgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggc 7380
ACAGTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCG

7381 tgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagc 7440
ACGTATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCG

7441 gagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatc 7500
CTCGTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAG

7501 aggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgagg 7560
TCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCC

7561 atctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgct 7620
TAGAGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGA

7621 tttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgt 7680
AAAGACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCA

7681 tggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgc 7740
ACCGATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACG

7741 tttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagt 7800
AAATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCA

7801 tcttctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggccgaa 7860
AGAAGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTT

f1 origin(7913,8218)<<<
|
7861 atcggcaacatcccttataaatcaaaagaatagaccgcgatagggttgagtgttgttcca 7920
TAGCCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGT

7921 gtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaacc 7980
CAAACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGG

7981 gtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcggtcg 8040
CAGATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGC

8041 aggtgccgtaaagctctaaatcggaaccctaaagggagcccccgatttagagcttgacgg 8100
TCCACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCC

8101 ggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagg 8160
CCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCC

8161 gcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgc 8220
CGCGACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCG

8221 cgctacagggcgcgtccattcgccattcaggatcgaattaattcttaattaacatcatca 8280
GCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGT

8281 ataatatacctt 8292
TATTATATGGAA

                                    5'-LTR
Start: 486 End: 2177

PolyA tail
Start: 2628 End: 2434 (Complementary)

miniCMV promoter
Start: 2723 End: 2656 (Complementary)

PGK promoter
Start: 2724 End: 3236

SV40
Start: 3353 End: 3655

Puro
Start: 3656 End: 4255

3'-LTR
Start: 5341 End: 4256 (Complementary)

Kanamycin/Neomycin
Start: 7014 End: 7805