pLenti-CMV-RFP-2A-Puro
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepLenti-CMV-RFP-2A-Puro
VectorTypeLentivector
Antibiotic InformationBacterial: Kanamycin Mammalian: Puromycin
Sequencing PrimersCMV-F: CGCAAATGGGCGGTAGGCGTG
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
      301 tgttactcat agcgcgtaat actctcatga gcggatacat atttgaatgt atttagaaaa
      361 ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctgac gtaactataa
      421 cggtcctaag gtagcgaaaa tgtagtctta tgcaatactc ttgtagtctt gcaacatggt
      481 aacgatgagt tagcaacatg ccttacaagg agagaaaaag caccgtgcat gccgattggt
      541 ggaagtaagg tggtacgatc gtgccttatt aggaaggcaa cagacgggtc tgacatggat
      601 tggacgaacc actgaattgc cgcattgcag agatattgta tttaagtgcc tagctcgata
      661 cataaacggg tctctctggt tagaccagat ctgagcctgg gagctctctg gctaactagg
      721 gaacccactg cttaagcctc aataaagctt gccttgagtg cttcaagtag tgtgtgcccg
      781 tctgttgtgt gactctggta actagagatc cctcagaccc ttttagtcag tgtggaaaat
      841 ctctagcagt ggcgcccgaa cagggacttg aaagcgaaag ggaaaccaga ggagctctct
      901 cgacgcagga ctcggcttgc tgaagcgcgc acggcaagag gcgaggggcg gcgactggtg
      961 agtacgccaa aaattttgac tagcggaggc tagaaggaga gagatgggtg cgagagcgtc
     1021 agtattaagc gggggagaat tagatcgcga tgggaaaaaa ttcggttaag gccaggggga
     1081 aagaaaaaat ataaattaaa acatatagta tgggcaagca gggagctaga acgattcgca
     1141 gttaatcctg gcctgttaga aacatcagaa ggctgtagac aaatactggg acagctacaa
     1201 ccatcccttc agacaggatc agaagaactt agatcattat ataatacagt agcaaccctc
     1261 tattgtgtgc atcaaaggat agagataaaa gacaccaagg aagctttaga caagatagag
     1321 gaagagcaaa acaaaagtaa gaccaccgca cagcaagccc gctgatcttc agacctggag
     1381 gaggagatat gagggacatt ggagaagtga attatataaa tataaagtag taaaaattga
     1441 accattagga gtagcaccca ccaaggcaaa gagaagagtg gtgcagagag aaaaaagagc
     1501 agtgggaata ggagctttgt tccttgggtt cttgggagca gcaggaagca ctatgggcgc
     1561 agcgtcaatg acgctgacgg tacaggccag acaattattg tctggtatag tgcagcagca
     1621 gaacaatttg ctgagggcta ttgaggcgca acagcatctg ttgcaactca cagtctgggg
     1681 catcaagcag ctccaggcaa gaatcctggc tgtggaaaga tacctaaagg atcaacagct
     1741 cctggggatt tggggttgct ctggaaaact catttgcacc actgctgtgc cttggaatgc
     1801 tagttggagt aataaatctc tggaacagat ttggaatcac acgacctgga tggagtggga
     1861 cagagaaatt aacaattaca caagcttaat acactcctta attgaagaat cgcaaaacca
     1921 gcaagaaaag aatgaacaag aattattgga attagataaa tgggcaagtt tgtggaattg
     1981 gtttaacata acaaattggc tgtggtatat aaaattattc ataatgatag taggaggctt
     2041 ggtaggttta agaatagttt ttgctgtact ttctatagtg aatagagtta ggcagggata
     2101 ttcaccatta tcgtttcaga cccacctccc aaccccgagg ggacccgaca ggcccgaagg
     2161 aatagaagaa gaaggtggag agagagacag agacagatcc attcgattag tgaacggatc
     2221 tcgacggtat cgaaagcttg ggattcgaat ttaaaagaaa aggggggatt ggggggtaca
     2281 gtgcagggga aagaatagta gacataatag caacagacat acaaactaaa gaactacaaa
     2341 aacaaattac aaaaattcaa aattttcggg tttttcgaac ctagggttcc gcgttacata
     2401 acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat
     2461 aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga
     2521 gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc
     2581 ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt
     2641 atgggacttt cctacttggc agtacatcta cgtttagtca tcgctattac catggtgatg
     2701 cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg atttccaagt
     2761 ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg ggactttcca
     2821 aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt acggtgggag
     2881 gtctatataa gcagagctcg tttagtgaac cgtcagatcg cctggagacg ccatccacgc
     2941 tgttttgacc tccatagaag aaccgagttt aaactcccta tcagtgatag agatctccct
     3001 atcagtgata gagagctagc cccgggatcg atcaattgag tacttacgta ggtaccgata
     3061 tcagcggccg ctctagactc gagtgaatga atgaggtgtg gaaagtcccc aggctcccca
     3121 gcaggcagaa gtatgcaaag catgcatctc aattagtcag caaccaggtg tggaaagtcc
     3181 ccaggctccc cagcaggcag aagtatgcaa agcatgcatc tcaattagtc agcaaccata
     3241 gtcccgcccc taactccgcc catcccgccc ctaactccgc ccagttccgc ccattctccg
     3301 ccccatggct gactaatttt ttttatttat gcagaggccg aggccgcctc ggcctctgag
     3361 ctattccaga agtagtgagg aggctttttt ggaggccACT AGTGTCGAGA AAactagtcg
     3421 ccaccatggt gagcgagctg attaaggaga acatgcacat gaagctgtac atggagggca
     3481 ccgtgaacaa ccaccacttc aagtgcacat ccgagggcga aggcaagccc tacgagggca
     3541 cccagaccat gagaatcaag gcggtcgagg gcggccctct ccccttcgcc ttcgacatcc
     3601 tggctaccag cttcatgtac ggcagcaaaa ccttcatcaa ccacacccag ggcatccccg
     3661 acttctttaa gcagtccttc cccgagggct tcacatggga gagagtcacc acatacgaag
     3721 acgggggcgt gctgaccgct acccaggaca ccagcctccg ggacggctgc ctcatctaca
     3781 acgtcaagat cagaggggtg aacttcccat ccaacggccc tgtgatgcag aagaaaacac
     3841 tcggctggga ggcctccacc gagaccctgt accccgctga cggcggcctg gaaggcagag
     3901 ccgacatggc cctgaagctc gtgggcgggg gccacctgat ctgcaacttg aagaccacat
     3961 acagatccaa gaaacccgct aagaacctca agatgcccgg cgtctactat gtggacagaa
     4021 gactggaaag aatcaaggag gccgacaaag agacctacgt cgagcagcac gaggtggctg
     4081 tggccagata ctgcgacctc cctagcaaac tggggcacag agaattcgga agcgggcagt
     4141 gcaccaacta cgccctgctg aagctggccg gcgacgtgga gagcaacccc ggccccggat
     4201 ccatggccac cgagtacaag cccacggtgc gcctcgccac ccgcgacgac gtcccccggg
     4261 ccgtacgcac cctcgccgcc gcgttcgccg actaccccgc cacgcgccac accgtcgacc
     4321 cggaccgcca catcgagcgg gtcaccgagc tgcaagaact cttcctcacg cgcgtcgggc
     4381 tcgacatcgg caaggtgtgg gtcgcggacg acggcgccgc ggtggcggtc tggaccacgc
     4441 cggagagcgt cgaagcgggg gcggtgttcg ccgagatcgg ctcgcgcatg gccgagttga
     4501 gcggttcccg gctggccgcg cagcaacaga tggaaggcct cctggcgccg caccggccca
     4561 aggagcccgc gtggttcctg gccaccgtcg gcgtctcgcc cgaccaccag ggcaagggtc
     4621 tgggcagcgc cgtcgtgctc cccggagtgg aggcggccga gcgcgctggg gtgcccgcct
     4681 tcctggagac ctccgcgccc cgcaacctcc ccttctacga gcggctcggc ttcaccgtca
     4741 ccgccgacgt cgaggtgccc gaaggaccgc gcacctggtg catgacccgc aagcccggtg
     4801 cctgaacgcg ttccggaaat caacctctgg attacaaaat ttgtgaaaga ttgactggta
     4861 ttcttaacta tgttgctcct tttacgctat gtggatacgc tgctttaatg cctttgtatc
     4921 atgctattgc ttcccgtatg gctttcattt tctcctcctt gtataaatcc tggttgctgt
     4981 ctctttatga ggagttgtgg cccgttgtca ggcaacgtgg cgtggtgtgc actgtgtttg
     5041 ctgacgcaac ccccactggt tggggcattg ccaccacctg tcagctcctt tccgggactt
     5101 tcgctttccc cctccctatt gccacggcgg aactcatcgc cgcctgcctt gcccgctgct
     5161 ggacaggggc tcggctgttg ggcactgaca attccgtggt gttgtcgggg aagctgacgt
     5221 cctttccatg gctgctcgcc tgtgttgcca cctggattct gcgcgggacg tccttctgct
     5281 acgtcccttc ggccctcaat ccagcggacc ttccttcccg cggcctgctg ccggctctgc
     5341 ggcctcttcc gcgtctcgcc ttcgccctca gacgagtcgg atctcccttt gggccgcctc
     5401 cccgcctgtc cggatggaag ggctaattca ctcccaacga atacaagatc tgctttttgc
     5461 ttgtactggg tctctctggt tagaccagat ctgagcctgg gagctctctg gctaactagg
     5521 gaacccactg cttaagcctc aataaagctt gccttgagtg cttcaagtag tgtgtgcccg
     5581 tctgttgtgt gactctggta actagagatc cctcagaccc ttttagtcag tgtggaaaat
     5641 ctctagcagt agtagttcat gtcatcttat tattcagtat ttataacttg caaagaaatg
     5701 aatatcagag agtgagagga acttgtttat tgcagcttat aatggttaca aataaagcaa
     5761 tagcatcaca aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc
     5821 caaactcatc aatgtatctt atcatgtctg gcatctatgt cgggtgcgga gaaagaggta
     5881 atgaaatggc attatgggta ttatgggtct gcattaatga atcggccaac ggatgtcggt
     5941 gtgaaatacc gcacagatgc gtaaggagaa aataccgcat caggcgctct tccgcttcct
     6001 cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa
     6061 aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa
     6121 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc
     6181 tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga
     6241 caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc
     6301 cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt
     6361 ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct
     6421 gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg
     6481 agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta
     6541 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct
     6601 acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa
     6661 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt
     6721 gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta
     6781 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggcc atgagattat
     6841 caaaaaggat cttcacctag atccttttca cgtagaaagc cagtccgcag aaacggtgct
     6901 gaccccggat gaatgtcagc tactgggcta tctggacaag ggaaaacgca agcgcaaaga
     6961 gaaagcaggt agcttgcagt gggcttacat ggcgatagct agactgggcg gttttatgga
     7021 cagcaagcga accggaattg ccagctgggg cgccctctgg taaggttggg aagccctgca
     7081 aagtaaactg gatggctttc ttgccgccaa ggatctgatg gcgcagggga tcaagctctg
     7141 atcaagagac aggatgagga tcgtttcgca tgattgaaca agatggattg cacgcaggtt
     7201 ctccggccgc ttgggtggag aggctattcg gctatgactg ggcacaacag acaatcggct
     7261 gctctgatgc cgccgtgttc cggctgtcag cgcaggggcg cccggttctt tttgtcaaga
     7321 ccgacctgtc cggtgccctg aatgaactgc aagacgaggc agcgcggcta tcgtggctgg
     7381 ccacgacggg cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg ggaagggact
     7441 ggctgctatt gggcgaagtg ccggggcagg atctcctgtc atctcacctt gctcctgccg
     7501 agaaagtatc catcatggct gatgcaatgc ggcggctgca tacgcttgat ccggctacct
     7561 gcccattcga ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg atggaagccg
     7621 gtcttgtcga tcaggatgat ctggacgaag agcatcaggg gctcgcgcca gccgaactgt
     7681 tcgccaggct caaggcgagc atgcccgacg gcgaggatct cgtcgtgacc catggcgatg
     7741 cctgcttgcc gaatatcatg gtggaaaatg gccgcttttc tggattcatc gactgtggcc
     7801 ggctgggtgt ggcggaccgc tatcaggaca tagcgttggc tacccgtgat attgctgaag
     7861 agcttggcgg cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt
     7921 cgcagcgcat cgccttctat cgccttcttg acgagttctt ctgaattttg ttaaaatttt
     7981 tgttaaatca gctcattttt taaccaatag gccgaaatcg gcaaaatccc ttataaatca
     8041 aaagaataga ccgagatagg gttgagtgtt gttccagttt ggaacaagag tccactatta
     8101 aagaacgtgg actccaacgt caaagggcga aaaaccgtct atcagggcga tggcccacta
     8161 cgtgaaccat caccctaatc aagttttttg gggtcgaggt gccgtaaagc actaaatcgg
     8221 aaccctaaag ggagcccccg atttagagct tgacggggaa agccggcgaa cgtggcgaga
     8281 aaggaaggga agaaagcgaa aggagcgggc gctagggcgc tggcaagtgt agcggtcacg
     8341 ctgcgcgtaa ccaccacacc cgccgcgctt aatgcgccgc tacagggcgc gtccattcgc
     8401 cattcaggat cgaattaatt cttaattaac atcatcaata atatacctt
                                       
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.