pLenti-EF1a-GFP-2A-Puro
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepLenti-EF1a-GFP-2A-Puro
VectorTypePlasmid
Antibiotic InformationPuromycin
Sequencing PrimersEF1a sequencing primer
5'--TCA GAC AGT GGT TCA AAG--3'
SV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgtgggaacggggcgggtgacgt
agtagtgtggcggaagtgtgatgttgcaagtgtggcggaacacatgtaagcgacggatgtggcaaaagtgacgtttttgg
tgtgcgccggtgtacacaggaagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt
aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttgtgttactcatagcgcgtaat
acggcagacctcagcgctagattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtattt
agaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta
gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaaggaga
gaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattaggaaggcaacagacgggtctga
catggattggacgaaccactgaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct
ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgcc
ttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgt
ggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc
ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctag
aaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggcc
agggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc
tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttaga
tcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaa
gatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag
ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagag
aagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcacta
tgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg
agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgt
ggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgcctt
ggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac
aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaatt
agataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtag
gaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg
tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagaga
cagatccattcgattagtgaacggatctcgacggtatcgaaagcttgggattcgaatttaaaagaaaaggggggattggg
gggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa
aattcaaaattttcgggtttttcgaacctagggagtgggaattggctccggtgcccgtcagtgggcagagcgcacatcgc
ccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaa
agtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgt
tctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggtt
atggcccttgcgtgccttgaattacttccactggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggt
gggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgc
cgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacc
tgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttgggg
ccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatc
ggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggc
aaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatgga
ggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttca
tgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttg
gggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgt
aattctccttggaatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagttttttt
cttccatttcaggtgtcgtgaggaatttcgactgctagctggtacctgaattgagtacttacgtaggtaccccagtgtgg
tggcctgcaggtgaattcactagtaccggtaggcctgtcgacgatatcgggcccgcggccgctggatcctctagaggtgt
ggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtc
cccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgc
ccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggcc
gaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctgtcgaggccaccatggagagc
gacgagagcggcctgcccgccatggagatcgagtgccgcatcaccggcaccctgaacggcgtggagttcgagctggtggg
cggcggagagggcacccccaagcagggccgcatgaccaacaagatgaagagcaccaaaggcgccctgaccttcagcccct
acctgctgagccacgtgatgggctacggcttctaccacttcggcacctaccccagcggctacgagaaccccttcctgcac
gccatcaacaacggcggctacaccaacacccgcatcgagaagtacgaggacggcggcgtgctgcacgtgagcttcagcta
ccgctacgaggccggccgcgtgatcggcgacttcaaggtggtgggcaccggcttccccgaggacagcgtgatcttcaccg
acaagatcatccgcagcaacgccaccgtggagcacctgcaccccatgggcgataacgtgctggtgggcagcttcgcccgc
accttcagcctgcgcgacggcggctactacagcttcgtggtggacagccacatgcacttcaagagcgccatccaccccag
catcctgcagaacgggggccccatgttcgccttccgccgcgtggaggagctgcacagcaacaccgagctgggcatcgtgg
agtaccagcacgccttcaagacccccatcgccttcgccagatcccgcgctcagtcgtccaattctgccgtggacggcacc
gccggacccggctccaccggatctcgcgagggcagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccc
tatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgt
tcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttc
ctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccgga
gagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagc
aacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgac
caccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcct
ggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaag
gaccgcgcacctggtgcatgacccgcaagcccggtgcctgaacgcgttccggaaatcaacctctggattacaaaatttgt
gaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgc
tattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccg
ttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcag
ctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggac
aggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtg
ttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggc
ctgctgccggctctgcggcctcttccgcgtctcgccttcgccctcagacgagtcggatctccctttgggccgcctccccg
cctgtccggatggaagggctaattcactcccaacgaatacaagatctgctttttgcttgtactgggtctctctggttaga
ccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttc
aagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctct
agcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaactt
gtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcatt
ctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggcatctatgtcgggtgcggagaaagaggtaatga
aatggcattatgggtattatgggtctgcattaatgaatcggccaacgatcccggtgtgaaataccgcacagatgcgtaag
gagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcgg
tatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggc
cagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaa
aaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcg
tgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcat
agctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcc
cgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcca
ctggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacact
agaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaa
acaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatc
ctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaa
aggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccg
tcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccg
gctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccat
ccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgaaaaaggat
cttcacctagatccttttcacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggcta
tctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcg
gttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactg
gatggctttctcgccgccaaggatctgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgca
tgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacag
acaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtc
cggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgc
tcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcacctt
gctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcga
ccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaag
agcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacc
catggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgt
ggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcc
tcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattttg
ttaaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaacatcccttataaatcaaaagaataga
ccgcgatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcga
aaaaccgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaaagc
tctaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaaggga
agaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgctta
atgcgccgctacagggcgcgtccattcgccattcaggatcgaattaattcttaattaacatcatcaataatatacctt
                                    LOCUS       dna                      9517 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
Other Gene 715..895
/gene="HIV-1_5_LTR other"
Other Gene 1006..1050
/gene="HIV-1_psi_pack other"
Regulatory_Seq 1557..1790
/gene="RRE reg"
ORF 1600..2301
/sequence="ORF_1 rf(1)"
ORF 2381..3361
/sequence="ORF_4 rf(4)"
Promoter 2444..3621
/gene="EF1a prom"
misc_binding 3408..3413
/dbxref="REBASE:XhoI"
misc_binding 3693..3698
/dbxref="REBASE:EcoRI"
misc_binding 3723..3728
/dbxref="REBASE:EcoRV"
misc_binding 3735..3742
/dbxref="REBASE:NotI"
misc_binding 3744..3749
/dbxref="REBASE:BamHI"
misc_binding 3750..3755
/dbxref="REBASE:XbaI"
Promoter 3756..4024
/gene="SV40 prom"
Rep_Origin 3923..4000
/gene="SV40 origin"
ORF 3990..5480
/sequence="ORF_3 rf(3)"
Marker 4881..5480
/gene="puro marker"
Other Gene 6090..6142
/gene="delta_U3 other"
Other Gene 6143..6323
/gene="HIV-1_5_LTR other"
Rep_Origin 6829..7448
/gene="pBR322 origin"
Promoter 8101..8150
/gene="NEOKAN prom"
misc_binding 8208..8213
/dbxref="REBASE:BclI"
ORF 8239..9033
/sequence="ORF_2 rf(1)"
Marker 8242..9030
/gene="NTP_II marker"
Rep_Origin 9138..9443
/gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 540
CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541 caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 600
GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601 tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 660
ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

HIV-1_5_LTR other(715,895)>>>
|
661 gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 720
CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721 ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 780
GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781 aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 840
TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841 tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 900
AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901 gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 960
CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

HIV-1_psi_pack other(1006,1050)>>>
|
961 ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 1020
CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021 ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 1080
AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

1081 ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 1140
CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141 aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 1200
TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201 tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 1260
ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261 caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 1320
GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321 aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 1380
TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381 aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 1440
TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441 ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 1500
CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

RRE reg(1557,1790)>>>
|
1501 gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 1560
CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

ORF_1 rf(1)(1600,2301)>>>
|
1561 gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 1620
CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621 ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 1680
GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681 agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 1740
TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741 caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 1800
GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801 ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 1860
CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861 aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 1920
TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921 aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 1980
TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981 gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 2040
CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041 aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 2100
TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101 atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 2160
TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161 tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 2220
AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221 ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 2280
CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281 aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 2340
TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

ORF_4 rf(4)(2381,3361)<<<
|
2341 aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 2400
TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

EF1a prom(2444,3621)>>>
|
2401 aattcaaaattttcgggtttttcgaacctagggagtgggaattggctccggtgcccgtca 2460
TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCCCTCACCCTTAACCGAGGCCACGGGCAGT

2461 gtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattg 2520
CACCCGTCTCGCGTGTAGCGGGTGTCAGGGGCTCTTCAACCCCCCTCCCCAGCCGTTAAC

2521 aaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggct 2580
TTGGCCACGGATCTCTTCCACCGCGCCCCATTTGACCCTTTCACTACAGCACATGACCGA

2581 ccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgt 2640
GGCGGAAAAAGGGCTCCCACCCCCTCTTGGCATATATTCACGTCATCAGCGGCACTTGCA

2641 tctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgg 2700
AGAAAAAGCGTTGCCCAAACGGCGGTCTTGTGTCCATTCACGGCACACACCAAGGGCGCC

2701 gcctggcctctttacgggttatggcccttgcgtgccttgaattacttccactggctgcag 2760
CGGACCGGAGAAATGCCCAATACCGGGAACGCACGGAACTTAATGAAGGTGACCGACGTC

2761 tacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgc 2820
ATGCACTAAGAACTAGGGCTCGAAGCCCAACCTTCACCCACCCTCTCAAGCTCCGGAACG

2821 gcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgc 2880
CGAATTCCTCGGGGAAGCGGAGCACGAACTCAACTCCGGACCGGACCCGCGACCCCGGCG

2881 cgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagcc 2940
GCGCACGCTTAGACCACCGTGGAAGCGCGGACAGAGCGACGAAAGCTATTCAGAGATCGG

2941 atttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaat 3000
TAAATTTTAAAAACTACTGGACGACGCTGCGAAAAAAAGACCGTTCTATCAGAACATTTA

3001 gcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcc 3060
CGCCCGGTTCTAGACGTGTGACCATAAAGCCAAAAACCCCGGCGCCCGCCGCTGCCCCGG

3061 cgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatc 3120
GCACGCAGGGTCGCGTGTACAAGCCGCTCCGCCCCGGACGCTCGCGCCGGTGGCTCTTAG

3121 ggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgt 3180
CCTGCCCCCATCAGAGTTCGACCGGCCGGACGAGACCACGGACCGGAGCGCGGCGGCACA

3181 atcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaaga 3240
TAGCGGGGCGGGACCCGCCGTTCCGACCGGGCCAGCCGTGGTCAACGCACTCGCCTTTCT

3241 tggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagag 3300
ACCGGCGAAGGGCCGGGACGACGTCCCTCGAGTTTTACCTCCTGCGCCGCGAGCCCTCTC

3301 cgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttca 3360
GCCCGCCCACTCAGTGGGTGTGTTTCCTTTTCCCGGAAAGGCAGGAGTCGGCAGCGAAGT

XhoI
|
3361 tgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttgg 3420
ACACTGAGGTGCCTCATGGCCCGCGGCAGGTCCGTGGAGCTAATCAAGAGCTCGAAAACC

3421 agtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgag 3480
TCATGCAGCAGAAATCCAACCCCCCTCCCCAAAATACGCTACCTCAAAGGGGTGTGACTC

3481 tgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgcc 3540
ACCCACCTCTGACTTCAATCCGGTCGAACCGTGAACTACATTAAGAGGAACCTTAAACGG

3541 ctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagttttttt 3600
GAAAAACTCAAACCTAGAACCAAGTAAGAGTTCGGAGTCTGTCACCAAGTTTCAAAAAAA

3601 cttccatttcaggtgtcgtgaggaatttcgactgctagctggtacctcaattcagtactt 3660
GAAGGTAAAGTCCACAGCACTCCTTAAAGCTGACGATCGACCATGGAGTTAAGTCATGAA

EcoRI
|
3661 acgtaggtaccccagtgtggtggcctgcaggtgaattcactagtaccggtaggcctgtcg 3720
TGCATCCATGGGGTCACACCACCGGACGTCCACTTAAGTGATCATGGCCATCCGGACAGC

EcoRV NotI BamHI XbaI SV40 prom(3756,4024)>>>
| | | | |
3721 acgatatcgggcccgcggccgctggatcctctagaggtgtggaaagtccccaggctcccc 3780
TGCTATAGCCCGGGCGCCGGCGACCTAGGAGATCTCCACACCTTTCAGGGGTCCGAGGGG

3781 agcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtc 3840
TCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTGGTCCACACCTTTCAG

3841 cccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccat 3900
GGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTGGTA

SV40 origin(3923,4000)>>>
|
3901 agtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctcc 3960
TCAGGGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGCGGGTCAAGGCGGGTAAGAGG

ORF_3 rf(3)(3990,5480)>>>
|
3961 gccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctga 4020
CGGGGTACCGACTGATTAAAAAAAATAAATACGTCTCCGGCTCCGGCGGAGCCGGAGACT

4021 gctattccagaagtagtgaggaggcttttttggaggccgtcgaggccaccatggagagcg 4080
CGATAAGGTCTTCATCACTCCTCCGAAAAAACCTCCGGCAGCTCCGGTGGTACCTCTCGC

4081 acgagagcggcctgcccgccatggagatcgagtgccgcatcaccggcaccctgaacggcg 4140
TGCTCTCGCCGGACGGGCGGTACCTCTAGCTCACGGCGTAGTGGCCGTGGGACTTGCCGC

4141 tggagttcgagctggtgggcggcggagagggcacccccaagcagggccgcatgaccaaca 4200
ACCTCAAGCTCGACCACCCGCCGCCTCTCCCGTGGGGGTTCGTCCCGGCGTACTGGTTGT

4201 agatgaagagcaccaaaggcgccctgaccttcagcccctacctgctgagccacgtgatgg 4260
TCTACTTCTCGTGGTTTCCGCGGGACTGGAAGTCGGGGATGGACGACTCGGTGCACTACC

4261 gctacggcttctaccacttcggcacctaccccagcggctacgagaaccccttcctgcacg 4320
CGATGCCGAAGATGGTGAAGCCGTGGATGGGGTCGCCGATGCTCTTGGGGAAGGACGTGC

4321 ccatcaacaacggcggctacaccaacacccgcatcgagaagtacgaggacggcggcgtgc 4380
GGTAGTTGTTGCCGCCGATGTGGTTGTGGGCGTAGCTCTTCATGCTCCTGCCGCCGCACG

4381 tgcacgtgagcttcagctaccgctacgaggccggccgcgtgatcggcgacttcaaggtgg 4440
ACGTGCACTCGAAGTCGATGGCGATGCTCCGGCCGGCGCACTAGCCGCTGAAGTTCCACC

4441 tgggcaccggcttccccgaggacagcgtgatcttcaccgacaagatcatccgcagcaacg 4500
ACCCGTGGCCGAAGGGGCTCCTGTCGCACTAGAAGTGGCTGTTCTAGTAGGCGTCGTTGC

4501 ccaccgtggagcacctgcaccccatgggcgataacgtgctggtgggcagcttcgcccgca 4560
GGTGGCACCTCGTGGACGTGGGGTACCCGCTATTGCACGACCACCCGTCGAAGCGGGCGT

4561 ccttcagcctgcgcgacggcggctactacagcttcgtggtggacagccacatgcacttca 4620
GGAAGTCGGACGCGCTGCCGCCGATGATGTCGAAGCACCACCTGTCGGTGTACGTGAAGT

4621 agagcgccatccaccccagcatcctgcagaacgggggccccatgttcgccttccgccgcg 4680
TCTCGCGGTAGGTGGGGTCGTAGGACGTCTTGCCCCCGGGGTACAAGCGGAAGGCGGCGC

4681 tggaggagctgcacagcaacaccgagctgggcatcgtggagtaccagcacgccttcaaga 4740
ACCTCCTCGACGTGTCGTTGTGGCTCGACCCGTAGCACCTCATGGTCGTGCGGAAGTTCT

4741 cccccatcgccttcgccagatcccgcgctcagtcgtccaattctgccgtggacggcaccg 4800
GGGGGTAGCGGAAGCGGTCTAGGGCGCGAGTCAGCAGGTTAAGACGGCACCTGCCGTGGC

4801 ccggacccggctccaccggatctcgcgagggcagaggaagtcttctaacatgcggtgacg 4860
GGCCTGGGCCGAGGTGGCCTAGAGCGCTCCCGTCTCCTTCAGAAGATTGTACGCCACTGC

puro marker(4881,5480)>>>
|
4861 tggaggagaatcccggccctatgaccgagtacaagcccacggtgcgcctcgccacccgcg 4920
ACCTCCTCTTAGGGCCGGGATACTGGCTCATGTTCGGGTGCCACGCGGAGCGGTGGGCGC

4921 acgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgc 4980
TGCTGCAGGGGTCCCGGCATGCGTGGGAGCGGCGGCGCAAGCGGCTGATGGGGCGGTGCG

4981 gccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcc 5040
CGGTGTGGCAGCTAGGCCTGGCGGTGTAGCTCGCCCAGTGGCTCGACGTTCTTGAGAAGG

5041 tcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtgg 5100
AGTGCGCGCAGCCCGAGCTGTAGCCGTTCCACACCCAGCGCCTGCTGCCGCGGCGCCACC

5101 cggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgc 5160
GCCAGACCTGGTGCGGCCTCTCGCAGCTTCGCCCCCGCCACAAGCGGCTCTAGCCGGGCG

5161 gcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctgg 5220
CGTACCGGCTCAACTCGCCAAGGGCCGACCGGCGCGTCGTTGTCTACCTTCCGGAGGACC

5221 cgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgacc 5280
GCGGCGTGGCCGGGTTCCTCGGGCGCACCAAGGACCGGTGGCAGCCGCAGAGCGGGCTGG

5281 accagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcg 5340
TGGTCCCGTTCCCAGACCCGTCGCGGCAGCACGAGGGGCCTCACCTCCGCCGGCTCGCGC

5341 ccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggc 5400
GGCCCCACGGGCGGAAGGACCTCTGGAGGCGCGGGGCGTTGGAGGGGAAGATGCTCGCCG

5401 tcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatga 5460
AGCCGAAGTGGCAGTGGCGGCTGCAGCTCCACGGGCTTCCTGGCGCGTGGACCACGTACT

5461 cccgcaagcccggtgcctgaacgcgttccggaaatcaacctctggattacaaaatttgtg 5520
GGGCGTTCGGGCCACGGACTTGCGCAAGGCCTTTAGTTGGAGACCTAATGTTTTAAACAC

5521 aaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctt 5580
TTTCTAACTGACCATAAGAATTGATACAACGAGGAAAATGCGATACACCTATGCGACGAA

5581 taatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtata 5640
ATTACGGAAACATAGTACGATAACGAAGGGCATACCGAAAGTAAAAGAGGAGGAACATAT

5641 aatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtgg 5700
TTAGGACCAACGACAGAGAAATACTCCTCAACACCGGGCAACAGTCCGTTGCACCGCACC

5701 tgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagc 5760
ACACGTGACACAAACGACTGCGTTGGGGGTGACCAACCCCGTAACGGTGGTGGACAGTCG

5761 tcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcct 5820
AGGAAAGGCCCTGAAAGCGAAAGGGGGAGGGATAACGGTGCCGCCTTGAGTAGCGGCGGA

5821 gccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgt 5880
CGGAACGGGCGACGACCTGTCCCCGAGCCGACAACCCGTGACTGTTAAGGCACCACAACA

5881 cggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcg 5940
GCCCCTTCGACTGCAGGAAAGGTACCGACGAGCGGACACAACGGTGGACCTAAGACGCGC

5941 ggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcc 6000
CCTGCAGGAAGACGATGCAGGGAAGCCGGGAGTTAGGTCGCCTGGAAGGAAGGGCGCCGG

6001 tgctgccggctctgcggcctcttccgcgtctcgccttcgccctcagacgagtcggatctc 6060
ACGACGGCCGAGACGCCGGAGAAGGCGCAGAGCGGAAGCGGGAGTCTGCTCAGCCTAGAG

delta_U3 other(6090,6142)>>>
|
6061 cctttgggccgcctccccgcctgtccggatggaagggctaattcactcccaacgaataca 6120
GGAAACCCGGCGGAGGGGCGGACAGGCCTACCTTCCCGATTAAGTGAGGGTTGCTTATGT

HIV-1_5_LTR other(6143,6323)>>>
|
6121 agatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagct 6180
TCTAGACGAAAAACGAACATGACCCAGAGAGACCAATCTGGTCTAGACTCGGACCCTCGA

6181 ctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttca 6240
GAGACCGATTGATCCCTTGGGTGACGAATTCGGAGTTATTTCGAACGGAACTCACGAAGT

6241 agtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagaccctttta 6300
TCATCACACACGGGCAGACAACACACTGAGACCATTGATCTCTAGGGAGTCTGGGAAAAT

6301 gtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttata 6360
CAGTCACACCTTTTAGAGATCGTCATCATCAAGTACAGTAGAATAATAAGTCATAAATAT

6361 acttgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagcttataatgg 6420
TGAACGTTTCTTTACTTATAGTCTCTCACTCTCCTTGAACAAATAACGTCGAATATTACC

6421 ttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattc 6480
AATGTTTATTTCGTTATCGTAGTGTTTAAAGTGTTTATTTCGTAAAAAAAGTGACGTAAG

6481 tagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggcatctatgtcgggt 6540
ATCAACACCAAACAGGTTTGAGTAGTTACATAGAATAGTACAGACCGTAGATACAGCCCA

6541 gcggagaaagaggtaatgaaatggcattatgggtattatgggtctgcattaatgaatcgg 6600
CGCCTCTTTCTCCATTACTTTACCGTAATACCCATAATACCCAGACGTAATTACTTAGCC

6601 ccaacgatcccggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcg 6660
GGTTGCTAGGGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGC

6661 ctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggt 6720
GAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCA

6721 atcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa 6780
TAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTT

pBR322 origin(6829,7448)<<<
|
6781 gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggc 6840
CTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCG

6841 gtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagag 6900
CAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTC

6901 gtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgt 6960
CACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCA

6961 gcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcggg 7020
CGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCC

7021 aagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcg 7080
TTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGCCACATCCAGCAAGC

7081 ctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccgg 7140
GAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCC

7141 taactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccac 7200
ATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTG

7201 tggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtg 7260
ACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTCAAGAACTTCACCAC

7261 gcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagt 7320
CGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCGAGACGACTTCGGTCA

7321 taccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcgg 7380
ATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCC

7381 tggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcc 7440
ACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGG

7441 tttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggatttt 7500
AAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAA

7501 ggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttt 7560
CCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTAATTTTTACTTCAAA

7561 taaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcag 7620
ATTTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAATGGTTACGAATTAGTC

7621 tgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgt 7680
ACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAACGGACTGAGGGGCA

7681 cgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgatacc 7740
GCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCACGACGTTACTATGG

7741 gcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggc 7800
CGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCG

7801 cgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccg 7860
GCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGATAATTAACAACGGC

7861 ggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgaaaaaggatc 7920
CCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAACAACTTTTTCCTAG

7921 ttcacctagatccttttcacgtagaaagccagtccgcagaaacggtgctgaccccggatg 7980
AAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCACGACTGGGGCCTAC

7981 aatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggta 8040
TTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCAT

8041 gcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaa 8100
CGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAAATACCTGTCGTTCGCTT

NEOKAN prom(8101,8150)>>>
|
8101 ccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactgg 8160
GGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGACGTTTCATTTGACC

BclI
|
8161 atggctttctcgccgccaaggatctgatggcgcaggggatcaagctctgatcaagagaca 8220
TACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGT

NTP_II marker(8242,9030)>>>
|
ORF_2 rf(1)(8239,9033)>>>
| |
8221 ggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgct 8280
CCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTCCAAGAGGCCGGCGA

8281 tgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgcc 8340
ACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGCCGACGAGACTACGG

8341 gccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtcc 8400
CGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGTTCTGGCTGGACAGG

8401 ggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggc 8460
CCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCGACCGGTGCTGCCCG

8461 gttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattg 8520
CAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCCTGACCGACGATAAC

8521 ggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatcc 8580
CCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGACGGCTCTTTCATAGG

8581 atcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgac 8640
TAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCCGATGGACGGGTAAGCTG

8641 caccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgat 8700
GTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTCGGCCAGAACAGCTA

8701 caggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctc 8760
GTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAG

8761 aaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccg 8820
TTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGCTACGGACGAACGGC

8821 aatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtg 8880
TTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACACCGGCCGACCCACAC

8881 gcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggc 8940
CGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAACGACTTCTCGAACCGCCG

8941 gaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatc 9000
CTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAG

9001 gccttctatcgccttcttgacgagttcttctgaattttgttaaaatttttgttaaatcag 9060
CGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTAAAAACAATTTAGTC

9061 ctcattttttaaccaataggccgaaatcggcaacatcccttataaatcaaaagaatagac 9120
GAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTTAGTTTTCTTATCTG

f1 origin(9138,9443)<<<
|
9121 cgcgatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtgga 9180
GCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGATAATTTCTTGCACCT

9181 ctccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatc 9240
GAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGTGATGCACTTGGTAG

9241 acccaaatcaagttttttgcggtcgaggtgccgtaaagctctaaatcggaaccctaaagg 9300
TGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTAGCCTTGGGATTTCC

9301 gagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaa 9360
CTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTT

9361 gaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaac 9420
CTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAGTGCGACGCGCATTG

9421 caccacacccgcgcgcttaatgcgccgctacagggcgcgtccattcgccattcaggatcg 9480
GTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGC

9481 aattaattcttaattaacatcatcaataatatacctt 9517
TTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA