pLenti-III-EF1alpha
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepLenti-III-EF1alpha
VectorTypeLentivirus
Antibiotic InformationPuromycin
Sequencing PrimersEF1a sequencing primer
5'--TCA GAC AGT GGT TCA AAG--3'
SV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgtgggaacggggcgggtgacgt
agtagtgtggcggaagtgtgatgttgcaagtgtggcggaacacatgtaagcgacggatgtggcaaaagtgacgtttttgg
tgtgcgccggtgtacacaggaagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt
aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttgtgttactcatagcgcgtaat
acggcagacctcagcgctagattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtattt
agaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta
gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaaggaga
gaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattaggaaggcaacagacgggtctga
catggattggacgaaccactgaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct
ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgcc
ttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgt
ggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc
ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctag
aaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggcc
agggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc
tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttaga
tcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaa
gatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag
ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagag
aagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcacta
tgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg
agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgt
ggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgcctt
ggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac
aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaatt
agataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtag
gaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg
tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagaga
cagatccattcgattagtgaacggatctcgacggtatcgaaagcttgggattcgaatttaaaagaaaaggggggattggg
gggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa
aattcaaaattttcgggtttttcgaacctagggagtgggaattggctccggtgcccgtcagtgggcagagcgcacatcgc
ccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaa
agtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgt
tctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggtt
atggcccttgcgtgccttgaattacttccactggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggt
gggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgc
cgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacc
tgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttgggg
ccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatc
ggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggc
aaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatgga
ggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttca
tgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttg
gggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgt
aattctccttggaatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagttttttt
cttccatttcaggtgtcgtgaggaatttcgactgctagctggtacctgaattgagtacttacgtaggtaccccagtgtgg
tggcctgcaggtgaattcactagtaccggtaggcctgtcgacgatatcgggcccgcggccgctggatcctctagactgca
gctcgagtacccatacgacgtcccagactacgcttgagtttaaacacgcgtggtgtggaaagtccccaggctccccagca
ggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaag
tatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgccca
gttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagcta
ttccagaagtagtgaggaggcttttttggaggccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacg
tccctcgggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtggacccggaccgccac
atcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacga
cggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatgg
ccgagttgagcggttcccggctggccgcgcagcaacagatggaagggctcctggcgccgcaccggcccaaggagcccgcg
tggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtgga
ggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggct
tcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaacgcgt
tccggaaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatg
tggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcct
ggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacc
cccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcgga
actcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcgggga
agctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcg
gccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtctcgccttcgccctcag
acgagtcggatctccctttgggccgcctccccgcctgtccggatggaagggctaattcactcccaacgaatacaagatct
gctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgc
ttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatcc
ctcagacccttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttataacttgc
aaagaaatgaatatcagagagtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaa
atttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgg
catctatgtcgggtgcggagaaagaggtaatgaaatggcattatgggtattatgggtctgcattaatgaatcggccaacg
atcccggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgact
cgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggg
gataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgttttt
ccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaa
gataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcc
tttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaa
gctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccgg
taagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagag
ttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcaga
ttacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactca
cgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatc
aatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtc
tatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagt
gctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcg
cagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccag
ttaatagtttgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgtagaaagccagtccgcagaaacggt
gctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgc
agtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctc
tggtaaggttgggaagccctgcaaagtaaactggatggctttctcgccgccaaggatctgatggcgcaggggatcaagct
ctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtg
gagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggg
gcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggc
tggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaa
gtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggct
gcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaag
ccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcg
agcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgctt
ttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctg
aagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttc
tatcgccttcttgacgagttcttctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggccgaaa
tcggcaacatcccttataaatcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaagagtccacta
ttaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcacccaa
atcaagttttttgcggtcgaggtgccgtaaagctctaaatcggaaccctaaagggagcccccgatttagagcttgacggg
gaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtc
acgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacagggcgcgtccattcgccattcaggatcgaattaa
ttcttaattaacatcatcaataatatacctt
                                    LOCUS       dna                      8751 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
Other Gene 715..895
/gene="HIV-1_5_LTR other"
Other Gene 1006..1050
/gene="HIV-1_psi_pack other"
misc_binding 1092..1097
/dbxref="REBASE:NruI"
Regulatory_Seq 1557..1790
/gene="RRE reg"
ORF 1600..2301
/sequence="ORF_1 rf(1)"
ORF 2381..3361
/sequence="ORF_4 rf(6)"
Promoter 2444..3621
/gene="EF1a prom"
misc_binding 3693..3698
/dbxref="REBASE:EcoRI"
misc_binding 3723..3728
/dbxref="REBASE:EcoRV"
misc_binding 3735..3742
/dbxref="REBASE:NotI"
misc_binding 3744..3749
/dbxref="REBASE:BamHI"
misc_binding 3750..3755
/dbxref="REBASE:XbaI"
Promoter 3812..4080
/gene="SV40 prom"
Rep_Origin 3979..4056
/gene="SV40 origin"
ORF 4046..4714
/sequence="ORF_2 rf(2)"
misc_binding 4059..4071
/dbxref="REBASE:SfiI"
Marker 4115..4714
/gene="puro marker"
Other Gene 5324..5376
/gene="delta_U3 other"
Other Gene 5377..5557
/gene="HIV-1_5_LTR other"
Rep_Origin 6063..6682
/gene="pBR322 origin"
Promoter 7335..7384
/gene="NEOKAN prom"
misc_binding 7442..7447
/dbxref="REBASE:BclI"
ORF 7473..8267
/sequence="ORF_3 rf(3)"
Marker 7476..8264
/gene="NTP_II marker"
Rep_Origin 8372..8677
/gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 540
CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541 caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 600
GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601 tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 660
ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

HIV-1_5_LTR other(715,895)>>>
|
661 gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 720
CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721 ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 780
GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781 aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 840
TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841 tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 900
AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901 gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 960
CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

HIV-1_psi_pack other(1006,1050)>>>
|
961 ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 1020
CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021 ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 1080
AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

NruI
|
1081 ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 1140
CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141 aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 1200
TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201 tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 1260
ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261 caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 1320
GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321 aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 1380
TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381 aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 1440
TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441 ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 1500
CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

RRE reg(1557,1790)>>>
|
1501 gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 1560
CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

ORF_1 rf(1)(1600,2301)>>>
|
1561 gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 1620
CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621 ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 1680
GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681 agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 1740
TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741 caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 1800
GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801 ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 1860
CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861 aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 1920
TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921 aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 1980
TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981 gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 2040
CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041 aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 2100
TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101 atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 2160
TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161 tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 2220
AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221 ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 2280
CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281 aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 2340
TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

ORF_4 rf(6)(2381,3361)<<<
|
2341 aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 2400
TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

EF1a prom(2444,3621)>>>
|
2401 aattcaaaattttcgggtttttcgaacctagggagtgggaattggctccggtgcccgtca 2460
TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCCCTCACCCTTAACCGAGGCCACGGGCAGT

2461 gtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattg 2520
CACCCGTCTCGCGTGTAGCGGGTGTCAGGGGCTCTTCAACCCCCCTCCCCAGCCGTTAAC

2521 aaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggct 2580
TTGGCCACGGATCTCTTCCACCGCGCCCCATTTGACCCTTTCACTACAGCACATGACCGA

2581 ccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgt 2640
GGCGGAAAAAGGGCTCCCACCCCCTCTTGGCATATATTCACGTCATCAGCGGCACTTGCA

2641 tctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgg 2700
AGAAAAAGCGTTGCCCAAACGGCGGTCTTGTGTCCATTCACGGCACACACCAAGGGCGCC

2701 gcctggcctctttacgggttatggcccttgcgtgccttgaattacttccactggctgcag 2760
CGGACCGGAGAAATGCCCAATACCGGGAACGCACGGAACTTAATGAAGGTGACCGACGTC

2761 tacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgc 2820
ATGCACTAAGAACTAGGGCTCGAAGCCCAACCTTCACCCACCCTCTCAAGCTCCGGAACG

2821 gcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgc 2880
CGAATTCCTCGGGGAAGCGGAGCACGAACTCAACTCCGGACCGGACCCGCGACCCCGGCG

2881 cgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagcc 2940
GCGCACGCTTAGACCACCGTGGAAGCGCGGACAGAGCGACGAAAGCTATTCAGAGATCGG

2941 atttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaat 3000
TAAATTTTAAAAACTACTGGACGACGCTGCGAAAAAAAGACCGTTCTATCAGAACATTTA

3001 gcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcc 3060
CGCCCGGTTCTAGACGTGTGACCATAAAGCCAAAAACCCCGGCGCCCGCCGCTGCCCCGG

3061 cgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatc 3120
GCACGCAGGGTCGCGTGTACAAGCCGCTCCGCCCCGGACGCTCGCGCCGGTGGCTCTTAG

3121 ggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgt 3180
CCTGCCCCCATCAGAGTTCGACCGGCCGGACGAGACCACGGACCGGAGCGCGGCGGCACA

3181 atcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaaga 3240
TAGCGGGGCGGGACCCGCCGTTCCGACCGGGCCAGCCGTGGTCAACGCACTCGCCTTTCT

3241 tggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagag 3300
ACCGGCGAAGGGCCGGGACGACGTCCCTCGAGTTTTACCTCCTGCGCCGCGAGCCCTCTC

3301 cgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttca 3360
GCCCGCCCACTCAGTGGGTGTGTTTCCTTTTCCCGGAAAGGCAGGAGTCGGCAGCGAAGT

3361 tgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttgg 3420
ACACTGAGGTGCCTCATGGCCCGCGGCAGGTCCGTGGAGCTAATCAAGAGCTCGAAAACC

3421 agtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgag 3480
TCATGCAGCAGAAATCCAACCCCCCTCCCCAAAATACGCTACCTCAAAGGGGTGTGACTC

3481 tgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgcc 3540
ACCCACCTCTGACTTCAATCCGGTCGAACCGTGAACTACATTAAGAGGAACCTTAAACGG

3541 ctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagttttttt 3600
GAAAAACTCAAACCTAGAACCAAGTAAGAGTTCGGAGTCTGTCACCAAGTTTCAAAAAAA

3601 cttccatttcaggtgtcgtgaggaatttcgactgctagctggtacctcaattcagtactt 3660
GAAGGTAAAGTCCACAGCACTCCTTAAAGCTGACGATCGACCATGGAGTTAAGTCATGAA

EcoRI
|
3661 acgtaggtaccccagtgtggtggcctgcaggtgaattcactagtaccggtaggcctgtcg 3720
TGCATCCATGGGGTCACACCACCGGACGTCCACTTAAGTGATCATGGCCATCCGGACAGC

EcoRV NotI BamHI XbaI
| | | |
3721 acgatatcgggcccgcggccgctggatcctctagactgcagctcgagtacccatacgacg 3780
TGCTATAGCCCGGGCGCCGGCGACCTAGGAGATCTGACGTCGAGCTCATGGGTATGCTGC

SV40 prom(3812,4080)>>>
|
3781 tcccagactacgcttgagtttaaacacgcgtggtgtggaaagtccccaggctccccagca 3840
AGGGTCTGATGCGAACTCAAATTTGTGCGCACCACACCTTTCAGGGGTCCGAGGGGTCGT

3841 ggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtcccca 3900
CCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTGGTCCACACCTTTCAGGGGT

3901 ggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtc 3960
CCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTGGTATCAG

SV40 origin(3979,4056)>>>
|
3961 ccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccc 4020
GGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGCGGGTCAAGGCGGGTAAGAGGCGGG

SfiI
|
ORF_2 rf(2)(4046,4714)>>>
| |
4021 catggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagcta 4080
GTACCGACTGATTAAAAAAAATAAATACGTCTCCGGCTCCGGCGGAGCCGGAGACTCGAT

puro marker(4115,4714)>>>
|
4081 ttccagaagtagtgaggaggcttttttggaggccatgaccgagtacaagcccacggtgcg 4140
AAGGTCTTCATCACTCCTCCGAAAAAACCTCCGGTACTGGCTCATGTTCGGGTGCCACGC

4141 cctcgccacccgcgacgacgtccctcgggccgtacgcaccctcgccgccgcgttcgccga 4200
GGAGCGGTGGGCGCTGCTGCAGGGAGCCCGGCATGCGTGGGAGCGGCGGCGCAAGCGGCT

4201 ctaccccgccacgcgccacaccgtggacccggaccgccacatcgagcgggtcaccgagct 4260
GATGGGGCGGTGCGCGGTGTGGCACCTGGGCCTGGCGGTGTAGCTCGCCCAGTGGCTCGA

4261 gcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacga 4320
CGTTCTTGAGAAGGAGTGCGCGCAGCCCGAGCTGTAGCCGTTCCACACCCAGCGCCTGCT

4321 cggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgc 4380
GCCGCGGCGCCACCGCCAGACCTGGTGCGGCCTCTCGCAGCTTCGCCCCCGCCACAAGCG

4381 cgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagat 4440
GCTCTAGCCGGGCGCGTACCGGCTCAACTCGCCAAGGGCCGACCGGCGCGTCGTTGTCTA

4441 ggaagggctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcgg 4500
CCTTCCCGAGGACCGCGGCGTGGCCGGGTTCCTCGGGCGCACCAAGGACCGGTGGCAGCC

4501 cgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtgga 4560
GCAGAGCGGGCTGGTGGTCCCGTTCCCAGACCCGTCGCGGCAGCACGAGGGGCCTCACCT

4561 ggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccc 4620
CCGCCGGCTCGCGCGGCCCCACGGGCGGAAGGACCTCTGGAGGCGCGGGGCGTTGGAGGG

4621 cttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcg 4680
GAAGATGCTCGCCGAGCCGAAGTGGCAGTGGCGGCTGCAGCTCCACGGGCTTCCTGGCGC

4681 cacctggtgcatgacccgcaagcccggtgcctgaacgcgttccggaaatcaacctctgga 4740
GTGGACCACGTACTGGGCGTTCGGGCCACGGACTTGCGCAAGGCCTTTAGTTGGAGACCT

4741 ttacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatg 4800
AATGTTTTAAACACTTTCTAACTGACCATAAGAATTGATACAACGAGGAAAATGCGATAC

4801 tggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcatttt 4860
ACCTATGCGACGAAATTACGGAAACATAGTACGATAACGAAGGGCATACCGAAAGTAAAA

4861 ctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcag 4920
GAGGAGGAACATATTTAGGACCAACGACAGAGAAATACTCCTCAACACCGGGCAACAGTC

4921 gcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgc 4980
CGTTGCACCGCACCACACGTGACACAAACGACTGCGTTGGGGGTGACCAACCCCGTAACG

4981 caccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcgga 5040
GTGGTGGACAGTCGAGGAAAGGCCCTGAAAGCGAAAGGGGGAGGGATAACGGTGCCGCCT

5041 actcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaa 5100
TGAGTAGCGGCGGACGGAACGGGCGACGACCTGTCCCCGAGCCGACAACCCGTGACTGTT

5101 ttccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccac 5160
AAGGCACCACAACAGCCCCTTCGACTGCAGGAAAGGTACCGACGAGCGGACACAACGGTG

5161 ctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggacct 5220
GACCTAAGACGCGCCCTGCAGGAAGACGATGCAGGGAAGCCGGGAGTTAGGTCGCCTGGA

5221 tccttcccgcggcctgctgccggctctgcggcctcttccgcgtctcgccttcgccctcag 5280
AGGAAGGGCGCCGGACGACGGCCGAGACGCCGGAGAAGGCGCAGAGCGGAAGCGGGAGTC

delta_U3 other(5324,5376)>>>
|
5281 acgagtcggatctccctttgggccgcctccccgcctgtccggatggaagggctaattcac 5340
TGCTCAGCCTAGAGGGAAACCCGGCGGAGGGGCGGACAGGCCTACCTTCCCGATTAAGTG

HIV-1_5_LTR other(5377,5557)>>>
|
5341 tcccaacgaatacaagatctgctttttgcttgtactgggtctctctggttagaccagatc 5400
AGGGTTGCTTATGTTCTAGACGAAAAACGAACATGACCCAGAGAGACCAATCTGGTCTAG

5401 tgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttg 5460
ACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAATTCGGAGTTATTTCGAAC

5461 ccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatcc 5520
GGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTGAGACCATTGATCTCTAGG

5521 ctcagacccttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttatt 5580
GAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCATCATCAAGTACAGTAGAATAA

5581 attcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttatt 5640
TAAGTCATAAATATTGAACGTTTCTTTACTTATAGTCTCTCACTCTCCTTGAACAAATAA

5641 gcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcattt 5700
CGTCGAATATTACCAATGTTTATTTCGTTATCGTAGTGTTTAAAGTGTTTATTTCGTAAA

5701 ttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgg 5760
AAAAGTGACGTAAGATCAACACCAAACAGGTTTGAGTAGTTACATAGAATAGTACAGACC

5761 catctatgtcgggtgcggagaaagaggtaatgaaatggcattatgggtattatgggtctg 5820
GTAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGTAATACCCATAATACCCAGAC

5821 cattaatgaatcggccaacgatcccggtgtgaaataccgcacagatgcgtaaggagaaaa 5880
GTAATTACTTAGCCGGTTGCTAGGGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTT

5881 taccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcgg 5940
ATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCC

5941 ctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggg 6000
GACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCC

6001 gataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaag 6060
CTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTC

pBR322 origin(6063,6682)<<<
|
6061 gccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcga 6120
CGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCT

6121 cgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccct 6180
GCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGA

6181 ggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcc 6240
CCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGG

6241 tttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcg 6300
AAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGC

6301 gtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgc 6360
CACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCG

6361 tgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcca 6420
ACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGT

6421 ctggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagag 6480
GACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTC

6481 ttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgct 6540
AAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCGA

6541 ctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaacc 6600
GACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGG

6601 accgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagga 6660
TGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCT

6661 tctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactca 6720
AGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGT

6721 cgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaat 6780
GCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTA

6781 taaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttac 6840
ATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAATG

6841 caatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagtt 6900
GTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAA

6901 gcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagt 6960
CGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCA

6961 gctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccag 7020
CGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTC

7021 ccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtct 7080
GGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGA

7081 attaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgtt 7140
TAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAA

7141 gttgaaaaaggatcttcacctagatccttttcacgtagaaagccagtccgcagaaacggt 7200
CAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCA

7201 gctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaa 7260
CGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTT

7261 agagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttat 7320
TCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAAATA

NEOKAN prom(7335,7384)>>>
|
7321 ggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccct 7380
CCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGA

7381 gcaaagtaaactggatggctttctcgccgccaaggatctgatggcgcaggggatcaagct 7440
CGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGA

NTP_II marker(7476,8264)>>>
|
BclI ORF_3 rf(3)(7473,8267)>>>
| | |
7441 ctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcag 7500
GACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTC

7501 gttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcg 7560
CAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGC

7561 gctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtca 7620
CGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGT

7621 agaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggc 7680
TCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCG

7681 tggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaaggg 7740
ACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCC

7741 actggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctg 7800
TGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGAC

7801 ccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggcta 7860
GGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCCGAT

7861 cctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaag 7920
GGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTC

7921 ccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaac 7980
GGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTG

7981 tgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcg 8040
ACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGC

8041 atgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtg 8100
TACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACAC

8101 gccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctg 8160
CGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAACGAC

8161 aagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccg 8220
TTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGC

8221 attcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattttgttaaaat 8280
TAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTA

8281 ttttgttaaatcagctcattttttaaccaataggccgaaatcggcaacatcccttataaa 8340
AAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTT

f1 origin(8372,8677)<<<
|
8341 tcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaagagtccacta 8400
AGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGAT

8401 ttaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggccca 8460
AATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGT

8461 ctacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaaagctctaaat 8520
GATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTA

8521 cggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcg 8580
GCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGC

8581 agaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtc 8640
TCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAG

8641 acgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacagggcgcgtccattc 8700
TGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAG

8701 gccattcaggatcgaattaattcttaattaacatcatcaataatatacctt 8751
CGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA

                                    5'-LTR
Start: 486 End: 2177
Original Location Description:
486..2177
EF1alpha Promoter
Start: 2427 End: 3653
Original Location Description:
2427..3653
SV40 Promoter
Start: 3812 End: 4114
Original Location Description:
3812..4114
Puromycin
Start: 4115 End: 4714
Original Location Description:
4115..4714
3'-LTR
Start: 5800 End: 4715 (Complementary)
Original Location Description:
complement(5800..4715)
Kanamycin
Start: 7473 End: 8264
Original Location Description:
7473..8264