pLenti-III-HA
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepLenti-III-HA
VectorTypeLentiviral vector
Antibiotic InformationKanamycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
SV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag
541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg
601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact
661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct
721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt
781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac
841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc
901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc
961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa
1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg
1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata
1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc
1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga
1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc
1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca
1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag
1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta
1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga
1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg
1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg
1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc
1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg
1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat
1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac
1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat
1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca
2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga
2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg
2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa
2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga
2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag
2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa
2401 aattcaaaat tttcgggttt ttcgaaccta gggttccgcg ttacataact tacggtaaat
2461 ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt
2521 cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa
2581 actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc
2641 aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct
2701 acttggcagt acatctacgt ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt
2761 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg
2821 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca
2881 actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca
2941 gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc
3001 atagaagaac cgagtttaaa ctccctatca gtgatagaga tctccctatc agtgatagag
3061 agctagcccc gggatcgatc aattgagtac ttacgtaggt accccagtgt ggtggcctgc
3121 aggtgaattc actagtaccg gtaggcctgt cgacgatatc gggcccgcgg ccgctggatc
3181 ctctagactg cagctcgagt acccatacga cgtcccagac tacgcttgag tttaaacacg
3241 cgtggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc atgcatctca
3301 attagtcagc aaccaggtgt ggaaagtccc caggctcccc agcaggcaga agtatgcaaa
3361 gcatgcatct caattagtca gcaaccatag tcccgcccct aactccgccc atcccgcccc
3421 taactccgcc cagttccgcc cattctccgc cccatggctg actaattttt tttatttatg
3481 cagaggccga ggccgcctcg gcctctgagc tattccagaa gtagtgagga ggcttttttg
3541 gaggccatga ccgagtacaa gcccacggtg cgcctcgcca cccgcgacga cgtccctcgg
3601 gccgtacgca ccctcgccgc cgcgttcgcc gactaccccg ccacgcgcca caccgtggac
3661 ccggaccgcc acatcgagcg ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg
3721 ctcgacatcg gcaaggtgtg ggtcgcggac gacggcgccg cggtggcggt ctggaccacg
3781 ccggagagcg tcgaagcggg ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg
3841 agcggttccc ggctggccgc gcagcaacag atggaagggc tcctggcgcc gcaccggccc
3901 aaggagcccg cgtggttcct ggccaccgtc ggcgtctcgc ccgaccacca gggcaagggt
3961 ctgggcagcg ccgtcgtgct ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc
4021 ttcctggaga cctccgcgcc ccgcaacctc cccttctacg agcggctcgg cttcaccgtc
4081 accgccgacg tcgaggtgcc cgaaggaccg cgcacctggt gcatgacccg caagcccggt
4141 gcctgaacgc gttccggaaa tcaacctctg gattacaaaa tttgtgaaag attgactggt
4201 attcttaact atgttgctcc ttttacgcta tgtggatacg ctgctttaat gcctttgtat
4261 catgctattg cttcccgtat ggctttcatt ttctcctcct tgtataaatc ctggttgctg
4321 tctctttatg aggagttgtg gcccgttgtc aggcaacgtg gcgtggtgtg cactgtgttt
4381 gctgacgcaa cccccactgg ttggggcatt gccaccacct gtcagctcct ttccgggact
4441 ttcgctttcc ccctccctat tgccacggcg gaactcatcg ccgcctgcct tgcccgctgc
4501 tggacagggg ctcggctgtt gggcactgac aattccgtgg tgttgtcggg gaagctgacg
4561 tcctttccat ggctgctcgc ctgtgttgcc acctggattc tgcgcgggac gtccttctgc
4621 tacgtccctt cggccctcaa tccagcggac cttccttccc gcggcctgct gccggctctg
4681 cggcctcttc cgcgtctcgc cttcgccctc agacgagtcg gatctccctt tgggccgcct
4741 ccccgcctgt ccggatggaa gggctaattc actcccaacg aatacaagat ctgctttttg
4801 cttgtactgg gtctctctgg ttagaccaga tctgagcctg ggagctctct ggctaactag
4861 ggaacccact gcttaagcct caataaagct tgccttgagt gcttcaagta gtgtgtgccc
4921 gtctgttgtg tgactctggt aactagagat ccctcagacc cttttagtca gtgtggaaaa
4981 tctctagcag tagtagttca tgtcatctta ttattcagta tttataactt gcaaagaaat
5041 gaatatcaga gagtgagagg aacttgttta ttgcagctta taatggttac aaataaagca
5101 atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt
5161 ccaaactcat caatgtatct tatcatgtct ggcatctatg tcgggtgcgg agaaagaggt
5221 aatgaaatgg cattatgggt attatgggtc tgcattaatg aatcggccaa cgatcccggt
5281 gtgaaatacc gcacagatgc gtaaggagaa aataccgcat caggcgctct tccgcttcct
5341 cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa
5401 aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa
5461 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc
5521 tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga
5581 caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc
5641 cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt
5701 ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct
5761 gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg
5821 agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta
5881 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct
5941 acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa
6001 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt
6061 gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta
6121 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat
6181 caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa
6241 gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct
6301 cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta
6361 cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct
6421 caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg
6481 gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa
6541 gtagttcgcc agttaatagt ttgcgcaacg ttgttgaaaa aggatcttca cctagatcct
6601 tttcacgtag aaagccagtc cgcagaaacg gtgctgaccc cggatgaatg tcagctactg
6661 ggctatctgg acaagggaaa acgcaagcgc aaagagaaag caggtagctt gcagtgggct
6721 tacatggcga tagctagact gggcggtttt atggacagca agcgaaccgg aattgccagc
6781 tggggcgccc tctggtaagg ttgggaagcc ctgcaaagta aactggatgg ctttctcgcc
6841 gccaaggatc tgatggcgca ggggatcaag ctctgatcaa gagacaggat gaggatcgtt
6901 tcgcatgatt gaacaagatg gattgcacgc aggttctccg gccgcttggg tggagaggct
6961 attcggctat gactgggcac aacagacaat cggctgctct gatgccgccg tgttccggct
7021 gtcagcgcag gggcgcccgg ttctttttgt caagaccgac ctgtccggtg ccctgaatga
7081 actgcaagac gaggcagcgc ggctatcgtg gctggccacg acgggcgttc cttgcgcagc
7141 tgtgctcgac gttgtcactg aagcgggaag ggactggctg ctattgggcg aagtgccggg
7201 gcaggatctc ctgtcatctc accttgctcc tgccgagaaa gtatccatca tggctgatgc
7261 aatgcggcgg ctgcatacgc ttgatccggc tacctgccca ttcgaccacc aagcgaaaca
7321 tcgcatcgag cgagcacgta ctcggatgga agccggtctt gtcgatcagg atgatctgga
7381 cgaagagcat caggggctcg cgccagccga actgttcgcc aggctcaagg cgagcatgcc
7441 cgacggcgag gatctcgtcg tgacccatgg cgatgcctgc ttgccgaata tcatggtgga
7501 aaatggccgc ttttctggat tcatcgactg tggccggctg ggtgtggcgg accgctatca
7561 ggacatagcg ttggctaccc gtgatattgc tgaagagctt ggcggcgaat gggctgaccg
7621 cttcctcgtg ctttacggta tcgccgctcc cgattcgcag cgcatcgcct tctatcgcct
7681 tcttgacgag ttcttctgaa ttttgttaaa atttttgtta aatcagctca ttttttaacc
7741 aataggccga aatcggcaac atcccttata aatcaaaaga atagaccgcg atagggttga
7801 gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag
7861 ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga accatcaccc aaatcaagtt
7921 ttttgcggtc gaggtgccgt aaagctctaa atcggaaccc taaagggagc ccccgattta
7981 gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag
8041 cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgcgc
8101 gcttaatgcg ccgctacagg gcgcgtccat tcgccattca ggatcgaatt aattcttaat
8161 taacatcatc aataatatac ctt
                                    LOCUS       dna                      8183 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
Other Gene 715..895
/gene="HIV-1_5_LTR other"
Other Gene 1006..1050
/gene="HIV-1_psi_pack other"
misc_binding 1092..1097
/dbxref="REBASE:NruI"
Regulatory_Seq 1557..1790
/gene="RRE reg"
ORF 1600..2301
/sequence="ORF_1 rf(1)"
misc_binding 2611..2616
/dbxref="REBASE:NdeI"
Promoter 2885..2966
/gene="CMV prom"
Regulatory_Seq 3022..3061
/gene="tetO reg"
misc_binding 3068..3073
/dbxref="REBASE:XmaI"
misc_binding 3068..3073
/dbxref="REBASE:SmaI"
misc_binding 3074..3079
/dbxref="REBASE:ClaI"
misc_binding 3098..3103
/dbxref="REBASE:KpnI"
misc_binding 3125..3130
/dbxref="REBASE:EcoRI"
misc_binding 3143..3148
/dbxref="REBASE:StuI"
misc_binding 3155..3160
/dbxref="REBASE:EcoRV"
misc_binding 3161..3166
/dbxref="REBASE:ApaI"
misc_binding 3167..3174
/dbxref="REBASE:NotI"
misc_binding 3176..3181
/dbxref="REBASE:BamHI"
misc_binding 3182..3187
/dbxref="REBASE:XbaI"
misc_binding 3194..3199
/dbxref="REBASE:XhoI"
Promoter 3244..3512
/gene="SV40 prom"
Rep_Origin 3411..3488
/gene="SV40 origin"
ORF 3478..4146
/sequence="ORF_2 rf(1)"
misc_binding 3491..3503
/dbxref="REBASE:SfiI"
Marker 3547..4146
/gene="puro marker"
Other Gene 4756..4808
/gene="delta_U3 other"
Other Gene 4809..4989
/gene="HIV-1_5_LTR other"
Rep_Origin 5495..6114
/gene="pBR322 origin"
Promoter 6767..6816
/gene="NEOKAN prom"
misc_binding 6874..6879
/dbxref="REBASE:BclI"
ORF 6905..7699
/sequence="ORF_3 rf(2)"
Marker 6908..7696
/gene="NTP_II marker"
Rep_Origin 7804..8109
/gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 540
CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541 caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 600
GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601 tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 660
ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

HIV-1_5_LTR other(715,895)>>>
|
661 gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 720
CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721 ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 780
GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781 aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 840
TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841 tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 900
AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901 gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 960
CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

HIV-1_psi_pack other(1006,1050)>>>
|
961 ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 1020
CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021 ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 1080
AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

NruI
|
1081 ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 1140
CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141 aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 1200
TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201 tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 1260
ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261 caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 1320
GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321 aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 1380
TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381 aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 1440
TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441 ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 1500
CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

RRE reg(1557,1790)>>>
|
1501 gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 1560
CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

ORF_1 rf(1)(1600,2301)>>>
|
1561 gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 1620
CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621 ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 1680
GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681 agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 1740
TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741 caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 1800
GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801 ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 1860
CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861 aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 1920
TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921 aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 1980
TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981 gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 2040
CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041 aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 2100
TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101 atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 2160
TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161 tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 2220
AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221 ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 2280
CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281 aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 2340
TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

2341 aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 2400
TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

2401 aattcaaaattttcgggtttttcgaacctagggttccgcgttacataacttacggtaaat 2460
TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCCCAAGGCGCAATGTATTGAATGCCATTTA

2461 ggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgtt 2520
CCGGGCGGACCGACTGGCGGGTTGCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAA

2521 cccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaa 2580
GGGTATCATTGCGGTTATCCCTGAAAGGTAACTGCAGTTACCCACCTCATAAATGCCATT

NdeI
|
2581 actgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtc 2640
TGACGGGTGAACCGTCATGTAGTTCACATAGTATACGGTTCATGCGGGGGATAACTGCAG

2641 aatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcct 2700
TTACTGCCATTTACCGGGCGGACCGTAATACGGGTCATGTACTGGAATACCCTGAAAGGA

2701 acttggcagtacatctacgtttagtcatcgctattaccatggtgatgcggttttggcagt 2760
TGAACCGTCATGTAGATGCAAATCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCA

2761 acatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattg 2820
TGTAGTTACCCGCACCTATCGCCAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAAC

2821 acgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaaca 2880
TGCAGTTACCCTCAAACAAAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGT

CMV prom(2885,2966)>>>
|
2881 actccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagca 2940
TGAGGCGGGGTAACTGCGTTTACCCGCCATCCGCACATGCCACCCTCCAGATATATTCGT

2941 gagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctcc 3000
CTCGAGCAAATCACTTGGCAGTCTAGCGGACCTCTGCGGTAGGTGCGACAAAACTGGAGG

tetO reg(3022,3061)>>>
|
3001 atagaagaaccgagtttaaactccctatcagtgatagagatctccctatcagtgatagag 3060
TATCTTCTTGGCTCAAATTTGAGGGATAGTCACTATCTCTAGAGGGATAGTCACTATCTC

SmaI
|
XmaI ClaI KpnI
| | | |
3061 agctagccccgggatcgatcaattgagtacttacgtaggtaccccagtgtggtggcctgc 3120
TCGATCGGGGCCCTAGCTAGTTAACTCATGAATGCATCCATGGGGTCACACCACCGGACG

NotI
|
EcoRI StuI EcoRV ApaI BamHI
| | | | | |
3121 aggtgaattcactagtaccggtaggcctgtcgacgatatcgggcccgcggccgctggatc 3180
TCCACTTAAGTGATCATGGCCATCCGGACAGCTGCTATAGCCCGGGCGCCGGCGACCTAG

XbaI XhoI
| |
3181 ctctagactgcagctcgagtacccatacgacgtcccagactacgcttgagtttaaacacg 3240
GAGATCTGACGTCGAGCTCATGGGTATGCTGCAGGGTCTGATGCGAACTCAAATTTGTGC

SV40 prom(3244,3512)>>>
|
3241 cgtggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctca 3300
GCACCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGT

3301 attagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaa 3360
TAATCAGTCGTTGGTCCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTT

SV40 origin(3411,3488)>>>
|
3361 gcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccc 3420
CGTACGTAGAGTTAATCAGTCGTTGGTATCAGGGCGGGGATTGAGGCGGGTAGGGCGGGG

ORF_2 rf(1)(3478,4146)>>>
|
3421 taactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatg 3480
ATTGAGGCGGGTCAAGGCGGGTAAGAGGCGGGGTACCGACTGATTAAAAAAAATAAATAC

SfiI
|
3481 cagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttg 3540
GTCTCCGGCTCCGGCGGAGCCGGAGACTCGATAAGGTCTTCATCACTCCTCCGAAAAAAC

puro marker(3547,4146)>>>
|
3541 gaggccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccctcgg 3600
CTCCGGTACTGGCTCATGTTCGGGTGCCACGCGGAGCGGTGGGCGCTGCTGCAGGGAGCC

3601 gccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtggac 3660
CGGCATGCGTGGGAGCGGCGGCGCAAGCGGCTGATGGGGCGGTGCGCGGTGTGGCACCTG

3661 ccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcggg 3720
GGCCTGGCGGTGTAGCTCGCCCAGTGGCTCGACGTTCTTGAGAAGGAGTGCGCGCAGCCC

3721 ctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacg 3780
GAGCTGTAGCCGTTCCACACCCAGCGCCTGCTGCCGCGGCGCCACCGCCAGACCTGGTGC

3781 ccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttg 3840
GGCCTCTCGCAGCTTCGCCCCCGCCACAAGCGGCTCTAGCCGGGCGCGTACCGGCTCAAC

3841 agcggttcccggctggccgcgcagcaacagatggaagggctcctggcgccgcaccggccc 3900
TCGCCAAGGGCCGACCGGCGCGTCGTTGTCTACCTTCCCGAGGACCGCGGCGTGGCCGGG

3901 aaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggt 3960
TTCCTCGGGCGCACCAAGGACCGGTGGCAGCCGCAGAGCGGGCTGGTGGTCCCGTTCCCA

3961 ctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgcc 4020
GACCCGTCGCGGCAGCACGAGGGGCCTCACCTCCGCCGGCTCGCGCGGCCCCACGGGCGG

4021 ttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtc 4080
AAGGACCTCTGGAGGCGCGGGGCGTTGGAGGGGAAGATGCTCGCCGAGCCGAAGTGGCAG

4081 accgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggt 4140
TGGCGGCTGCAGCTCCACGGGCTTCCTGGCGCGTGGACCACGTACTGGGCGTTCGGGCCA

4141 gcctgaacgcgttccggaaatcaacctctggattacaaaatttgtgaaagattgactggt 4200
CGGACTTGCGCAAGGCCTTTAGTTGGAGACCTAATGTTTTAAACACTTTCTAACTGACCA

4201 attcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtat 4260
TAAGAATTGATACAACGAGGAAAATGCGATACACCTATGCGACGAAATTACGGAAACATA

4261 catgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctg 4320
GTACGATAACGAAGGGCATACCGAAAGTAAAAGAGGAGGAACATATTTAGGACCAACGAC

4321 tctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgttt 4380
AGAGAAATACTCCTCAACACCGGGCAACAGTCCGTTGCACCGCACCACACGTGACACAAA

4381 gctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggact 4440
CGACTGCGTTGGGGGTGACCAACCCCGTAACGGTGGTGGACAGTCGAGGAAAGGCCCTGA

4441 ttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgc 4500
AAGCGAAAGGGGGAGGGATAACGGTGCCGCCTTGAGTAGCGGCGGACGGAACGGGCGACG

4501 tggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacg 4560
ACCTGTCCCCGAGCCGACAACCCGTGACTGTTAAGGCACCACAACAGCCCCTTCGACTGC

4561 tcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgc 4620
AGGAAAGGTACCGACGAGCGGACACAACGGTGGACCTAAGACGCGCCCTGCAGGAAGACG

4621 tacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctg 4680
ATGCAGGGAAGCCGGGAGTTAGGTCGCCTGGAAGGAAGGGCGCCGGACGACGGCCGAGAC

4681 cggcctcttccgcgtctcgccttcgccctcagacgagtcggatctccctttgggccgcct 4740
GCCGGAGAAGGCGCAGAGCGGAAGCGGGAGTCTGCTCAGCCTAGAGGGAAACCCGGCGGA

delta_U3 other(4756,4808)>>>
|
4741 ccccgcctgtccggatggaagggctaattcactcccaacgaatacaagatctgctttttg 4800
GGGGCGGACAGGCCTACCTTCCCGATTAAGTGAGGGTTGCTTATGTTCTAGACGAAAAAC

HIV-1_5_LTR other(4809,4989)>>>
|
4801 cttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactag 4860
GAACATGACCCAGAGAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATC

4861 ggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgccc 4920
CCTTGGGTGACGAATTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGG

4921 gtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaa 4980
CAGACAACACACTGAGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTT

4981 tctctagcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaat 5040
AGAGATCGTCATCATCAAGTACAGTAGAATAATAAGTCATAAATATTGAACGTTTCTTTA

5041 gaatatcagagagtgagaggaacttgtttattgcagcttataatggttacaaataaagca 5100
CTTATAGTCTCTCACTCTCCTTGAACAAATAACGTCGAATATTACCAATGTTTATTTCGT

5101 atagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgt 5160
TATCGTAGTGTTTAAAGTGTTTATTTCGTAAAAAAAGTGACGTAAGATCAACACCAAACA

5161 ccaaactcatcaatgtatcttatcatgtctggcatctatgtcgggtgcggagaaagaggt 5220
GGTTTGAGTAGTTACATAGAATAGTACAGACCGTAGATACAGCCCACGCCTCTTTCTCCA

5221 aatgaaatggcattatgggtattatgggtctgcattaatgaatcggccaacgatcccggt 5280
TTACTTTACCGTAATACCCATAATACCCAGACGTAATTACTTAGCCGGTTGCTAGGGCCA

5281 gtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcct 5340
CACTTTATGGCGTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGA

5341 cgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaa 5400
GCGAGTGACTGAGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTT

5401 aggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaa 5460
TCCGCCATTATGCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTT

pBR322 origin(5495,6114)<<<
|
5461 aaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggc 5520
TTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCG

5521 tccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccga 5580
AGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCT

5581 caggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttc 5640
GTCCTGATATTTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAG

5641 cgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgcttt 5700
GCTGGGACGGCGAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAA

5701 ctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggct 5760
GAGTATCGAGTGCGACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGA

5761 gtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttg 5820
CACACGTGCTTGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAAC

5821 agtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggatta 5880
TCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAAT

5881 gcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggct 5940
CGTCTCGCTCCATACATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGA

5941 acactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaa 6000
TGTGATCTTCCTGTCATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTT

6001 gagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgttt 6060
CTCAACCATCGAGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAA

6061 gcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttcta 6120
CGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGAT

6121 cggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattat 6180
GCCCCAGACTGCGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATA

6181 caaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaa 6240
GTTTTTCCTAGAAGTGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTT

6241 gtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatct 6300
CATATATACTCATTTGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGA

6301 cagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataacta 6360
GTCGCTAGACAGATAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGAT

6361 cgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgct 6420
GCTATGCCCTCCCGAATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGA

6421 caccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtg 6480
GTGGCCGAGGTCTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCAC

6481 gtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaa 6540
CAGGACGTTGAAATAGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATT

6541 gtagttcgccagttaatagtttgcgcaacgttgttgaaaaaggatcttcacctagatcct 6600
CATCAAGCGGTCAATTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGA

6601 tttcacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactg 6660
AAAGTGCATCTTTCGGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGAC

6661 ggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggct 6720
CCGATAGACCTGTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGA

NEOKAN prom(6767,6816)>>>
|
6721 tacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagc 6780
ATGTACCGCTATCGATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCG

6781 tggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttctcgcc 6840
ACCCCGCGGGAGACCATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGG

BclI
|
6841 gccaaggatctgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtt 6900
CGGTTCCTAGACTACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAA

NTP_II marker(6908,7696)>>>
|
ORF_3 rf(2)(6905,7699)>>>
| |
6901 tcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggct 6960
AGCGTACTAACTTGTTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGA

6961 attcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggct 7020
TAAGCCGATACTGACCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGA

7021 gtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatga 7080
CAGTCGCGTCCCCGCGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACT

7081 actgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagc 7140
TGACGTTCTGCTCCGTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCG

7141 tgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggg 7200
ACACGAGCTGCAACAGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCC

7201 gcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgc 7260
CGTCCTAGAGGACAGTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACG

7261 aatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaaca 7320
TTACGCCGCCGACGTATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGT

7321 tcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctgga 7380
AGCGTAGCTCGCTCGTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCT

7381 cgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcc 7440
GCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGG

7441 cgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtgga 7500
GCTGCCGCTCCTAGAGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCT

7501 aaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatca 7560
TTTACCGGCGAAAAGACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGT

7561 ggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccg 7620
CCTGTATCGCAACCGATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGC

7621 cttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgcct 7680
GAAGGAGCACGAAATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGA

7681 tcttgacgagttcttctgaattttgttaaaatttttgttaaatcagctcattttttaacc 7740
AGAACTGCTCAAGAAGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGG

7741 aataggccgaaatcggcaacatcccttataaatcaaaagaatagaccgcgatagggttga 7800
TTATCCGGCTTTAGCCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACT

f1 origin(7804,8109)<<<
|
7801 gtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaag 7860
CACAACAAGGTCAAACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTC

7861 ggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagtt 7920
CCGCTTTTTGGCAGATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAA

7921 ttttgcggtcgaggtgccgtaaagctctaaatcggaaccctaaagggagcccccgattta 7980
AAAACGCCAGCTCCACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAAT

7981 gagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggag 8040
CTCGAACTGCCCCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTC

8041 cgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgc 8100
GCCCGCGATCCCGCGACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCG

8101 gcttaatgcgccgctacagggcgcgtccattcgccattcaggatcgaattaattcttaat 8160
CGAATTACGCGGCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTA

8161 taacatcatcaataatatacctt 8183
ATTGTAGTAGTTATTATATGGAA
                                    		5'-LTR
Start: 486 End: 2177
Original Location Description:
486..2177
CMV Pro
Start: 2433 End: 3061
Original Location Description:
2433..3061
Psv40e
Start: 3244 End: 3546
Original Location Description:
3244..3546
Pur
Start: 3547 End: 4146
Original Location Description:
3547..4146
3'-LTR
Start: 4147 End: 5232 (Complementary)
Original Location Description:
complement(4147..5232)
Kan
Start: 6905 End: 7696
Original Location Description:
6905..7696