pLenti-III-PGK
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepLenti-III-PGK
VectorTypeLentiviral vector
Antibiotic InformationKanamycin in Bacterial,
Puromycin in Mammalian
Sequencing PrimersPGK Sequencing Primer
5'---AAT TCT ACC GGG TAG GGG AGG CGC T---3'
SV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag
541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg
601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact
661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct
721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt
781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac
841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc
901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc
961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa
1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg
1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata
1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc
1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga
1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc
1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca
1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag
1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta
1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga
1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg
1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg
1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc
1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg
1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat
1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac
1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat
1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca
2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga
2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg
2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa
2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga
2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag
2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa
2401 aattcaaaat tttcgggttt ttcgaaccta gaaattctac cgggtagggg aggcgctttt
2461 cccaaggcag tctggagcat gcgctttagc agccccgctg ggcacttggc gctacacaag
2521 tggcctctgg cctcgcacac attccacatc caccggtagg cgccaaccgg ctccgttctt
2581 tggtggcccc ttcgcgccac cttctactcc tcccctagtc aggaagttcc cccccgcccc
2641 gcagctcgcg tcgtgcagga cgtgacaaat ggaagtagca cgtctcacta gtctcgtgca
2701 gatggacagc accgctgagc aatggaagcg ggtaggcctt tggggcagcg gccaatagca
2761 gctttgctcc ttcgctttct gggctcagag gctgggaagg ggtgggtccg ggggcgggct
2821 caggggcggg ctcaggggcg gggcgggcgc ccgaaggtcc tccggaggcc cggcattctg
2881 cacgcttcaa aagcgcacgt ctgccgcgct gttctcctct tcctcatctc cgggcctttc
2941 gacctcaatt gagtacttac gtaggtaccc cagtgtggtg gcctgcaggt gaattcacta
3001 gtaccggtag gcctgtcgac gatatcgggc ccgcggccgc tggatcctct agactgcagc
3061 tcgagtaccc atacgacgtc ccagactacg cttgagttta aacacgcgtg gtgtggaaag
3121 tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc
3181 aggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat
3241 tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt
3301 tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc
3361 gcctcggcct ctgagctatt ccagaagtag tgaggaggct tttttggagg ccatgaccga
3421 gtacaagccc acggtgcgcc tcgccacccg cgacgacgtc cctcgggccg tacgcaccct
3481 cgccgccgcg ttcgccgact accccgccac gcgccacacc gtggacccgg accgccacat
3541 cgagcgggtc accgagctgc aagaactctt cctcacgcgc gtcgggctcg acatcggcaa
3601 ggtgtgggtc gcggacgacg gcgccgcggt ggcggtctgg accacgccgg agagcgtcga
3661 agcgggggcg gtgttcgccg agatcggccc gcgcatggcc gagttgagcg gttcccggct
3721 ggccgcgcag caacagatgg aagggctcct ggcgccgcac cggcccaagg agcccgcgtg
3781 gttcctggcc accgtcggcg tctcgcccga ccaccagggc aagggtctgg gcagcgccgt
3841 cgtgctcccc ggagtggagg cggccgagcg cgccggggtg cccgccttcc tggagacctc
3901 cgcgccccgc aacctcccct tctacgagcg gctcggcttc accgtcaccg ccgacgtcga
3961 ggtgcccgaa ggaccgcgca cctggtgcat gacccgcaag cccggtgcct gaacgcgttc
4021 cggaaatcaa cctctggatt acaaaatttg tgaaagattg actggtattc ttaactatgt
4081 tgctcctttt acgctatgtg gatacgctgc tttaatgcct ttgtatcatg ctattgcttc
4141 ccgtatggct ttcattttct cctccttgta taaatcctgg ttgctgtctc tttatgagga
4201 gttgtggccc gttgtcaggc aacgtggcgt ggtgtgcact gtgtttgctg acgcaacccc
4261 cactggttgg ggcattgcca ccacctgtca gctcctttcc gggactttcg ctttccccct
4321 ccctattgcc acggcggaac tcatcgccgc ctgccttgcc cgctgctgga caggggctcg
4381 gctgttgggc actgacaatt ccgtggtgtt gtcggggaag ctgacgtcct ttccatggct
4441 gctcgcctgt gttgccacct ggattctgcg cgggacgtcc ttctgctacg tcccttcggc
4501 cctcaatcca gcggaccttc cttcccgcgg cctgctgccg gctctgcggc ctcttccgcg
4561 tctcgccttc gccctcagac gagtcggatc tccctttggg ccgcctcccc gcctgtccgg
4621 atggaagggc taattcactc ccaacgaata caagatctgc tttttgcttg tactgggtct
4681 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt
4741 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac
4801 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtagt
4861 agttcatgtc atcttattat tcagtattta taacttgcaa agaaatgaat atcagagagt
4921 gagaggaact tgtttattgc agcttataat ggttacaaat aaagcaatag catcacaaat
4981 ttcacaaata aagcattttt ttcactgcat tctagttgtg gtttgtccaa actcatcaat
5041 gtatcttatc atgtctggca tctatgtcgg gtgcggagaa agaggtaatg aaatggcatt
5101 atgggtatta tgggtctgca ttaatgaatc ggccaacgat cccggtgtga aataccgcac
5161 agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg cttcctcgct cactgactcg
5221 ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg
5281 ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag
5341 gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac
5401 gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga
5461 taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt
5521 accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc
5581 tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc
5641 cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta
5701 agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat
5761 gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca
5821 gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct
5881 tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt
5941 acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct
6001 cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc
6061 acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa
6121 acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta
6181 tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc
6241 ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat
6301 ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta
6361 tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt
6421 aatagtttgc gcaacgttgt tgaaaaagga tcttcaccta gatccttttc acgtagaaag
6481 ccagtccgca gaaacggtgc tgaccccgga tgaatgtcag ctactgggct atctggacaa
6541 gggaaaacgc aagcgcaaag agaaagcagg tagcttgcag tgggcttaca tggcgatagc
6601 tagactgggc ggttttatgg acagcaagcg aaccggaatt gccagctggg gcgccctctg
6661 gtaaggttgg gaagccctgc aaagtaaact ggatggcttt ctcgccgcca aggatctgat
6721 ggcgcagggg atcaagctct gatcaagaga caggatgagg atcgtttcgc atgattgaac
6781 aagatggatt gcacgcaggt tctccggccg cttgggtgga gaggctattc ggctatgact
6841 gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca gcgcaggggc
6901 gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactg caagacgagg
6961 cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg ctcgacgttg
7021 tcactgaagc gggaagggac tggctgctat tgggcgaagt gccggggcag gatctcctgt
7081 catctcacct tgctcctgcc gagaaagtat ccatcatggc tgatgcaatg cggcggctgc
7141 atacgcttga tccggctacc tgcccattcg accaccaagc gaaacatcgc atcgagcgag
7201 cacgtactcg gatggaagcc ggtcttgtcg atcaggatga tctggacgaa gagcatcagg
7261 ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgag catgcccgac ggcgaggatc
7321 tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat ggtggaaaat ggccgctttt
7381 ctggattcat cgactgtggc cggctgggtg tggcggaccg ctatcaggac atagcgttgg
7441 ctacccgtga tattgctgaa gagcttggcg gcgaatgggc tgaccgcttc ctcgtgcttt
7501 acggtatcgc cgctcccgat tcgcagcgca tcgccttcta tcgccttctt gacgagttct
7561 tctgaatttt gttaaaattt ttgttaaatc agctcatttt ttaaccaata ggccgaaatc
7621 ggcaacatcc cttataaatc aaaagaatag accgcgatag ggttgagtgt tgttccagtt
7681 tggaacaaga gtccactatt aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc
7741 tatcagggcg atggcccact acgtgaacca tcacccaaat caagtttttt gcggtcgagg
7801 tgccgtaaag ctctaaatcg gaaccctaaa gggagccccc gatttagagc ttgacgggga
7861 aagccggcga acgtggcgag aaaggaaggg aagaaagcga aaggagcggg cgctagggcg
7921 ctggcaagtg tagcggtcac gctgcgcgta accaccacac ccgcgcgctt aatgcgccgc
7981 tacagggcgc gtccattcgc cattcaggat cgaattaatt cttaattaac atcatcaata
8041 atatacctt
                                    LOCUS       dna                      8049 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
regulatory_sequence..2177
/gene="5' LTR"
Other Gene 715..895
/gene="HIV-1_5_LTR other"
Other Gene 1006..1050
/gene="HIV-1_psi_pack other"
misc_binding 1092..1097
/dbxref="REBASE:NruI"
Regulatory_Seq 1557..1790
/gene="RRE reg"
ORF 1600..2301
/sequence="ORF_1 rf(1)"
misc_binding 2964..2969
/dbxref="REBASE:KpnI"
misc_binding 2991..2996
/dbxref="REBASE:EcoRI"
misc_binding 3021..3026
/dbxref="REBASE:EcoRV"
misc_binding 3027..3032
/dbxref="REBASE:ApaI"
misc_binding 3033..3040
/dbxref="REBASE:NotI"
misc_binding 3042..3047
/dbxref="REBASE:BamHI"
misc_binding 3048..3053
/dbxref="REBASE:XbaI"
misc_binding 3060..3065
/dbxref="REBASE:XhoI"
Promoter 3110..3378
/gene="SV40 prom"
Rep_Origin 3277..3354
/gene="SV40 origin"
ORF 3344..4012
/sequence="ORF_2 rf(2)"
misc_binding 3357..3369
/dbxref="REBASE:SfiI"
Marker 3413..4012
/gene="puro marker"
regulatory_sequence2..5098
/gene="3' LTR"
Other Gene 4622..4674
/gene="delta_U3 other"
Other Gene 4675..4855
/gene="HIV-1_5_LTR other"
Rep_Origin 5361..5980
/gene="pBR322 origin"
Promoter 6633..6682
/gene="NEOKAN prom"
misc_binding 6740..6745
/dbxref="REBASE:BclI"
selectable_marker770..7562
/gene="Kanamycin/Neomycin"
ORF 6771..7565
/sequence="ORF_3 rf(3)"
Marker 6774..7562
/gene="NTP_II marker"
Rep_Origin 7670..7975
/gene="f1 origin"
BASE COUNT 1976 a 2017 c 2217 g 1839 t 0 others
ORIGIN
1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag
541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg
601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact
661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct
721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt
781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac
841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc
901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc
961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa
1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg
1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata
1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc
1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga
1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc
1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca
1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag
1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta
1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga
1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg
1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg
1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc
1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg
1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat
1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac
1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat
1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca
2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga
2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg
2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa
2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga
2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag
2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa
2401 aattcaaaat tttcgggttt ttcgaaccta gaaattctac cgggtagggg aggcgctttt
2461 cccaaggcag tctggagcat gcgctttagc agccccgctg ggcacttggc gctacacaag
2521 tggcctctgg cctcgcacac attccacatc caccggtagg cgccaaccgg ctccgttctt
2581 tggtggcccc ttcgcgccac cttctactcc tcccctagtc aggaagttcc cccccgcccc
2641 gcagctcgcg tcgtgcagga cgtgacaaat ggaagtagca cgtctcacta gtctcgtgca
2701 gatggacagc accgctgagc aatggaagcg ggtaggcctt tggggcagcg gccaatagca
2761 gctttgctcc ttcgctttct gggctcagag gctgggaagg ggtgggtccg ggggcgggct
2821 caggggcggg ctcaggggcg gggcgggcgc ccgaaggtcc tccggaggcc cggcattctg
2881 cacgcttcaa aagcgcacgt ctgccgcgct gttctcctct tcctcatctc cgggcctttc
2941 gacctcaatt gagtacttac gtaggtaccc cagtgtggtg gcctgcaggt gaattcacta
3001 gtaccggtag gcctgtcgac gatatcgggc ccgcggccgc tggatcctct agactgcagc
3061 tcgagtaccc atacgacgtc ccagactacg cttgagttta aacacgcgtg gtgtggaaag
3121 tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc
3181 aggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat
3241 tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt
3301 tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc
3361 gcctcggcct ctgagctatt ccagaagtag tgaggaggct tttttggagg ccatgaccga
3421 gtacaagccc acggtgcgcc tcgccacccg cgacgacgtc cctcgggccg tacgcaccct
3481 cgccgccgcg ttcgccgact accccgccac gcgccacacc gtggacccgg accgccacat
3541 cgagcgggtc accgagctgc aagaactctt cctcacgcgc gtcgggctcg acatcggcaa
3601 ggtgtgggtc gcggacgacg gcgccgcggt ggcggtctgg accacgccgg agagcgtcga
3661 agcgggggcg gtgttcgccg agatcggccc gcgcatggcc gagttgagcg gttcccggct
3721 ggccgcgcag caacagatgg aagggctcct ggcgccgcac cggcccaagg agcccgcgtg
3781 gttcctggcc accgtcggcg tctcgcccga ccaccagggc aagggtctgg gcagcgccgt
3841 cgtgctcccc ggagtggagg cggccgagcg cgccggggtg cccgccttcc tggagacctc
3901 cgcgccccgc aacctcccct tctacgagcg gctcggcttc accgtcaccg ccgacgtcga
3961 ggtgcccgaa ggaccgcgca cctggtgcat gacccgcaag cccggtgcct gaacgcgttc
4021 cggaaatcaa cctctggatt acaaaatttg tgaaagattg actggtattc ttaactatgt
4081 tgctcctttt acgctatgtg gatacgctgc tttaatgcct ttgtatcatg ctattgcttc
4141 ccgtatggct ttcattttct cctccttgta taaatcctgg ttgctgtctc tttatgagga
4201 gttgtggccc gttgtcaggc aacgtggcgt ggtgtgcact gtgtttgctg acgcaacccc
4261 cactggttgg ggcattgcca ccacctgtca gctcctttcc gggactttcg ctttccccct
4321 ccctattgcc acggcggaac tcatcgccgc ctgccttgcc cgctgctgga caggggctcg
4381 gctgttgggc actgacaatt ccgtggtgtt gtcggggaag ctgacgtcct ttccatggct
4441 gctcgcctgt gttgccacct ggattctgcg cgggacgtcc ttctgctacg tcccttcggc
4501 cctcaatcca gcggaccttc cttcccgcgg cctgctgccg gctctgcggc ctcttccgcg
4561 tctcgccttc gccctcagac gagtcggatc tccctttggg ccgcctcccc gcctgtccgg
4621 atggaagggc taattcactc ccaacgaata caagatctgc tttttgcttg tactgggtct
4681 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt
4741 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac
4801 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtagt
4861 agttcatgtc atcttattat tcagtattta taacttgcaa agaaatgaat atcagagagt
4921 gagaggaact tgtttattgc agcttataat ggttacaaat aaagcaatag catcacaaat
4981 ttcacaaata aagcattttt ttcactgcat tctagttgtg gtttgtccaa actcatcaat
5041 gtatcttatc atgtctggca tctatgtcgg gtgcggagaa agaggtaatg aaatggcatt
5101 atgggtatta tgggtctgca ttaatgaatc ggccaacgat cccggtgtga aataccgcac
5161 agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg cttcctcgct cactgactcg
5221 ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg
5281 ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag
5341 gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac
5401 gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga
5461 taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt
5521 accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc
5581 tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc
5641 cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta
5701 agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat
5761 gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca
5821 gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct
5881 tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt
5941 acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct
6001 cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc
6061 acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa
6121 acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta
6181 tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc
6241 ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat
6301 ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta
6361 tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt
6421 aatagtttgc gcaacgttgt tgaaaaagga tcttcaccta gatccttttc acgtagaaag
6481 ccagtccgca gaaacggtgc tgaccccgga tgaatgtcag ctactgggct atctggacaa
6541 gggaaaacgc aagcgcaaag agaaagcagg tagcttgcag tgggcttaca tggcgatagc
6601 tagactgggc ggttttatgg acagcaagcg aaccggaatt gccagctggg gcgccctctg
6661 gtaaggttgg gaagccctgc aaagtaaact ggatggcttt ctcgccgcca aggatctgat
6721 ggcgcagggg atcaagctct gatcaagaga caggatgagg atcgtttcgc atgattgaac
6781 aagatggatt gcacgcaggt tctccggccg cttgggtgga gaggctattc ggctatgact
6841 gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca gcgcaggggc
6901 gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactg caagacgagg
6961 cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg ctcgacgttg
7021 tcactgaagc gggaagggac tggctgctat tgggcgaagt gccggggcag gatctcctgt
7081 catctcacct tgctcctgcc gagaaagtat ccatcatggc tgatgcaatg cggcggctgc
7141 atacgcttga tccggctacc tgcccattcg accaccaagc gaaacatcgc atcgagcgag
7201 cacgtactcg gatggaagcc ggtcttgtcg atcaggatga tctggacgaa gagcatcagg
7261 ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgag catgcccgac ggcgaggatc
7321 tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat ggtggaaaat ggccgctttt
7381 ctggattcat cgactgtggc cggctgggtg tggcggaccg ctatcaggac atagcgttgg
7441 ctacccgtga tattgctgaa gagcttggcg gcgaatgggc tgaccgcttc ctcgtgcttt
7501 acggtatcgc cgctcccgat tcgcagcgca tcgccttcta tcgccttctt gacgagttct
7561 tctgaatttt gttaaaattt ttgttaaatc agctcatttt ttaaccaata ggccgaaatc
7621 ggcaacatcc cttataaatc aaaagaatag accgcgatag ggttgagtgt tgttccagtt
7681 tggaacaaga gtccactatt aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc
7741 tatcagggcg atggcccact acgtgaacca tcacccaaat caagtttttt gcggtcgagg
7801 tgccgtaaag ctctaaatcg gaaccctaaa gggagccccc gatttagagc ttgacgggga
7861 aagccggcga acgtggcgag aaaggaaggg aagaaagcga aaggagcggg cgctagggcg
7921 ctggcaagtg tagcggtcac gctgcgcgta accaccacac ccgcgcgctt aatgcgccgc
7981 tacagggcgc gtccattcgc cattcaggat cgaattaatt cttaattaac atcatcaata
8041 atatacctt
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

5' LTR(485,2177)>>>
|
481 gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 540
CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541 caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 600
GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601 tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 660
ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

HIV-1_5_LTR other(715,895)>>>
|
661 gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 720
CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721 ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 780
GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781 aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 840
TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841 tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 900
AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901 gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 960
CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

HIV-1_psi_pack other(1006,1050)>>>
|
961 ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 1020
CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021 ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 1080
AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

NruI
|
1081 ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 1140
CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141 aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 1200
TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201 tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 1260
ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261 caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 1320
GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321 aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 1380
TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381 aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 1440
TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441 ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 1500
CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

RRE reg(1557,1790)>>>
|
1501 gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 1560
CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

ORF_1 rf(1)(1600,2301)>>>
|
1561 gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 1620
CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621 ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 1680
GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681 agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 1740
TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741 caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 1800
GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801 ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 1860
CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861 aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 1920
TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921 aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 1980
TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981 gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 2040
CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041 aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 2100
TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101 atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 2160
TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161 tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 2220
AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221 ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 2280
CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281 aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 2340
TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

2341 aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 2400
TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

2401 aattcaaaattttcgggtttttcgaacctagaaattctaccgggtaggggaggcgctttt 2460
TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCTTTAAGATGGCCCATCCCCTCCGCGAAAA

2461 cccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaag 2520
GGGTTCCGTCAGACCTCGTACGCGAAATCGTCGGGGCGACCCGTGAACCGCGATGTGTTC

2521 tggcctctggcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctt 2580
ACCGGAGACCGGAGCGTGTGTAAGGTGTAGGTGGCCATCCGCGGTTGGCCGAGGCAAGAA

2581 tggtggccccttcgcgccaccttctactcctcccctagtcaggaagttcccccccgcccc 2640
ACCACCGGGGAAGCGCGGTGGAAGATGAGGAGGGGATCAGTCCTTCAAGGGGGGGCGGGG

2641 gcagctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgca 2700
CGTCGAGCGCAGCACGTCCTGCACTGTTTACCTTCATCGTGCAGAGTGATCAGAGCACGT

2701 gatggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagca 2760
CTACCTGTCGTGGCGACTCGTTACCTTCGCCCATCCGGAAACCCCGTCGCCGGTTATCGT

2761 gctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggct 2820
CGAAACGAGGAAGCGAAAGACCCGAGTCTCCGACCCTTCCCCACCCAGGCCCCCGCCCGA

2821 caggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctg 2880
GTCCCCGCCCGAGTCCCCGCCCCGCCCGCGGGCTTCCAGGAGGCCTCCGGGCCGTAAGAC

2881 cacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttc 2940
GTGCGAAGTTTTCGCGTGCAGACGGCGCGACAAGAGGAGAAGGAGTAGAGGCCCGGAAAG

KpnI EcoRI
| |
2941 gacctcaattgagtacttacgtaggtaccccagtgtggtggcctgcaggtgaattcacta 3000
CTGGAGTTAACTCATGAATGCATCCATGGGGTCACACCACCGGACGTCCACTTAAGTGAT

NotI
|
EcoRV ApaI BamHI XbaI
| | | | |
3001 gtaccggtaggcctgtcgacgatatcgggcccgcggccgctggatcctctagactgcagc 3060
CATGGCCATCCGGACAGCTGCTATAGCCCGGGCGCCGGCGACCTAGGAGATCTGACGTCG

XhoI SV40 prom(3110,3378)>>>
| |
3061 tcgagtacccatacgacgtcccagactacgcttgagtttaaacacgcgtggtgtggaaag 3120
AGCTCATGGGTATGCTGCAGGGTCTGATGCGAACTCAAATTTGTGCGCACCACACCTTTC

3121 tccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacc 3180
AGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGTCGTTGG

3181 aggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaat 3240
TCCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTA

SV40 origin(3277,3354)>>>
|
3241 tagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagt 3300
ATCAGTCGTTGGTATCAGGGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGCGGGTCA

ORF_2 rf(2)(3344,4012)>>>
|
3301 tccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggcc 3360
AGGCGGGTAAGAGGCGGGGTACCGACTGATTAAAAAAAATAAATACGTCTCCGGCTCCGG

SfiI puro marker(3413,4012)>>>
| |
3361 gcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggccatgaccga 3420
CGGAGCCGGAGACTCGATAAGGTCTTCATCACTCCTCCGAAAAAACCTCCGGTACTGGCT

3421 gtacaagcccacggtgcgcctcgccacccgcgacgacgtccctcgggccgtacgcaccct 3480
CATGTTCGGGTGCCACGCGGAGCGGTGGGCGCTGCTGCAGGGAGCCCGGCATGCGTGGGA

3481 cgccgccgcgttcgccgactaccccgccacgcgccacaccgtggacccggaccgccacat 3540
GCGGCGGCGCAAGCGGCTGATGGGGCGGTGCGCGGTGTGGCACCTGGGCCTGGCGGTGTA

3541 cgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaa 3600
GCTCGCCCAGTGGCTCGACGTTCTTGAGAAGGAGTGCGCGCAGCCCGAGCTGTAGCCGTT

3601 ggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcga 3660
CCACACCCAGCGCCTGCTGCCGCGGCGCCACCGCCAGACCTGGTGCGGCCTCTCGCAGCT

3661 agcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggct 3720
TCGCCCCCGCCACAAGCGGCTCTAGCCGGGCGCGTACCGGCTCAACTCGCCAAGGGCCGA

3721 ggccgcgcagcaacagatggaagggctcctggcgccgcaccggcccaaggagcccgcgtg 3780
CCGGCGCGTCGTTGTCTACCTTCCCGAGGACCGCGGCGTGGCCGGGTTCCTCGGGCGCAC

3781 gttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgt 3840
CAAGGACCGGTGGCAGCCGCAGAGCGGGCTGGTGGTCCCGTTCCCAGACCCGTCGCGGCA

3841 cgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctc 3900
GCACGAGGGGCCTCACCTCCGCCGGCTCGCGCGGCCCCACGGGCGGAAGGACCTCTGGAG

3901 cgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcga 3960
GCGCGGGGCGTTGGAGGGGAAGATGCTCGCCGAGCCGAAGTGGCAGTGGCGGCTGCAGCT

3' LTR(4012,5098)>>>
|
3961 ggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaacgcgttc 4020
CCACGGGCTTCCTGGCGCGTGGACCACGTACTGGGCGTTCGGGCCACGGACTTGCGCAAG

4021 cggaaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgt 4080
GCCTTTAGTTGGAGACCTAATGTTTTAAACACTTTCTAACTGACCATAAGAATTGATACA

4081 tgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttc 4140
ACGAGGAAAATGCGATACACCTATGCGACGAAATTACGGAAACATAGTACGATAACGAAG

4141 ccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgagga 4200
GGCATACCGAAAGTAAAAGAGGAGGAACATATTTAGGACCAACGACAGAGAAATACTCCT

4201 gttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccc 4260
CAACACCGGGCAACAGTCCGTTGCACCGCACCACACGTGACACAAACGACTGCGTTGGGG

4261 cactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccct 4320
GTGACCAACCCCGTAACGGTGGTGGACAGTCGAGGAAAGGCCCTGAAAGCGAAAGGGGGA

4321 ccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcg 4380
GGGATAACGGTGCCGCCTTGAGTAGCGGCGGACGGAACGGGCGACGACCTGTCCCCGAGC

4381 gctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggct 4440
CGACAACCCGTGACTGTTAAGGCACCACAACAGCCCCTTCGACTGCAGGAAAGGTACCGA

4441 gctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggc 4500
CGAGCGGACACAACGGTGGACCTAAGACGCGCCCTGCAGGAAGACGATGCAGGGAAGCCG

4501 cctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcg 4560
GGAGTTAGGTCGCCTGGAAGGAAGGGCGCCGGACGACGGCCGAGACGCCGGAGAAGGCGC

4561 tctcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcctgtccgg 4620
AGAGCGGAAGCGGGAGTCTGCTCAGCCTAGAGGGAAACCCGGCGGAGGGGCGGACAGGCC

delta_U3 other(4622,4674)>>> HIV-1_5_LTR other(4675,4855)>>>
| |
4621 atggaagggctaattcactcccaacgaatacaagatctgctttttgcttgtactgggtct 4680
TACCTTCCCGATTAAGTGAGGGTTGCTTATGTTCTAGACGAAAAACGAACATGACCCAGA

4681 ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 4740
GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

4741 aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 4800
TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

4801 tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtagt 4860
AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCATCA

4861 agttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagt 4920
TCAAGTACAGTAGAATAATAAGTCATAAATATTGAACGTTTCTTTACTTATAGTCTCTCA

4921 gagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaat 4980
CTCTCCTTGAACAAATAACGTCGAATATTACCAATGTTTATTTCGTTATCGTAGTGTTTA

4981 ttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaat 5040
AAGTGTTTATTTCGTAAAAAAAGTGACGTAAGATCAACACCAAACAGGTTTGAGTAGTTA

5041 gtatcttatcatgtctggcatctatgtcgggtgcggagaaagaggtaatgaaatggcatt 5100
CATAGAATAGTACAGACCGTAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGTAA

5101 atgggtattatgggtctgcattaatgaatcggccaacgatcccggtgtgaaataccgcac 5160
TACCCATAATACCCAGACGTAATTACTTAGCCGGTTGCTAGGGCCACACTTTATGGCGTG

5161 agatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcg 5220
TCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGC

5221 ctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacgg 5280
GACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCC

5281 ttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaag 5340
AATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTC

pBR322 origin(5361,5980)<<<
|
5341 gccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgac 5400
CGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTG

5401 gagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaaga 5460
CTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCT

5461 taccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgctt 5520
ATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAA

5521 accggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgc 5580
TGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCG

5581 tgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccc 5640
ACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGG

5641 cccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggta 5700
GGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCAT

5701 agacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtat 5760
TCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATA

5761 gtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggaca 5820
CATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGT

5821 gtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctct 5880
CATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGA

5881 tgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagatt 5940
ACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAA

5941 acgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgct 6000
TGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGA

6001 cagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttc 6060
GTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAG

6061 acctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaa 6120
TGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATT

6121 acttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtcta 6180
TGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGAT

6181 tttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggc 6240
AAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCG

6241 ttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagat 6300
AATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTA

6301 ttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaacttta 6360
AATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAAT

6361 tccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagtt 6420
AGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAA

6421 aatagtttgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgtagaaag 6480
TTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTC

6481 ccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaa 6540
GGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTT

6541 gggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagc 6600
CCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCG

NEOKAN prom(6633,6682)>>>
|
6601 tagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctg 6660
ATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGAC

6661 gtaaggttgggaagccctgcaaagtaaactggatggctttctcgccgccaaggatctgat 6720
CATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTA

NTP_II marker(6774,7562)>>>
|
ORF_3 rf(3)(6771,7565)>>>
| |
BclI Kanamycin/Neomycin(6770,7562)>>>
| || |
6721 ggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaac 6780
CCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTG

6781 aagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgact 6840
TTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGA

6841 gggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggc 6900
CCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCG

6901 gcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgagg 6960
CGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCC

6961 cagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttg 7020
GTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAAC

7021 tcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgt 7080
AGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACA

7081 catctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgc 7140
GTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACG

7141 atacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgag 7200
TATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTC

7201 cacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcagg 7260
GTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCC

7261 ggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatc 7320
CCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAG

7321 tcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgctttt 7380
AGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAA

7381 ctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttgg 7440
GACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACC

7441 ctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgcttt 7500
GATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAA

7501 acggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttct 7560
TGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGA

7561 tctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggccgaaatc 7620
AGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAG

f1 origin(7670,7975)<<<
|
7621 ggcaacatcccttataaatcaaaagaatagaccgcgatagggttgagtgttgttccagtt 7680
CCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAA

7681 tggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtc 7740
ACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAG

7741 tatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcggtcgagg 7800
ATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCC

7801 tgccgtaaagctctaaatcggaaccctaaagggagcccccgatttagagcttgacgggga 7860
ACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCT

7861 aagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcg 7920
TTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGC

7921 ctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgc 7980
GACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCG

7981 tacagggcgcgtccattcgccattcaggatcgaattaattcttaattaacatcatcaata 8040
ATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTAT

8041 atatacctt 8049
TATATGGAA

                                        5'-LTR
Start: 486 End: 2177

PGK
Start: 2433 End: 2945

Psv40e
Start: 3110 End: 3412

Pur
Start: 3413 End: 4012

3'-LTR
Start: 4013 End: 5098 (Complementary)

Kan
Start: 6771 End: 7562