pLenti-III-Promoterless
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepLenti-III-Promoterless
VectorTypeLentiviral vector
Antibiotic InformationBacterial: Kanamycin
Mammalian: Puromycin
Sequencing PrimersSV40 reverse sequencing primer
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
Additional InformationInsulator sequence located upstream of MCS to suppress any 5'LTR promoter activity
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgtgggaacggggcgggtgacgt
agtagtgtggcggaagtgtgatgttgcaagtgtggcggaacacatgtaagcgacggatgtggcaaaagtgacgtttttgg
tgtgcgccggtgtacacaggaagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt
aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttgtgttactcatagcgcgtaat
acggcagacctcagcgctagattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtattt
agaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta
gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaaggaga
gaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattaggaaggcaacagacgggtctga
catggattggacgaaccactgaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct
ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgcc
ttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgt
ggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc
ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctag
aaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggcc
agggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc
tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttaga
tcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaa
gatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag
ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagag
aagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcacta
tgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg
agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgt
ggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgcctt
ggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac
aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaatt
agataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtag
gaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg
tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagaga
cagatccattcgattagtgaacggatctcgacggtatcgaaagcttgggattcgaatttaaaagaaaaggggggattggg
gggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa
aattcaaaattttcgggtttttcgaacctagccccgggatcgatcaattgggggagctcacggggacagcccccccccaa
agcccccagggatgtaattacgtccctcccccgctagggggcagcagcgaccgcccggggctccgctccggtccggcgct
ccccccgcatcccgagccggcagcgtgcggggacagcccgggcacggggaaggtggcacgggatcgctttcctctgaacg
cttctcgctgctctttgagcctgcagacacctgggggatacggggaaaaggtaccggggagctcacggggacagcccccc
cccaaagcccccagggatgtaattacgtccctcCCCCGCTAGGGGGCAGCAGCGACCGCCCGGGGCTCCGCTCCGGTCCG
GCGCTCCCCCCGCATCCCGAGCCGGCAGCGTGCGGGGACAGCCCGGGCACGGGGAAGGTGGCACGGGATCGCTTTCCTCT
GAACGCTTCTCGCTGCTCTTTGAGCCTGCAGACACCTGGGGGATACGGGGAAAAGAATTGGGGGAGCTCACGGGGACAGC
CCCCCCCCAAAGCCCCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGGGCAGCAGCGACCGCCCGGGGCTCCGCTCCG
GTCCGGCGCTCCCCCCCATCCCGAGCCGGCAGCGTGCGGGGACAGCCCGGGCACGGGGAAGGTGGCACGGGATCGCTTCC
TCTGAACGCTTCTCGCTGCTCTTTGAGCCTGCAGACACCTGGGGGATACGGGGAAAAACACTGGGGTACCTACGTAAGGG
AGCTCACGGGGACAGCCCCCCCCCAAAGCCCCCAGGGATGTAATTACGTCCCTCCCCGCTAGGGGGCAGCAGCGACCGCC
CGGGGCTCCGCTCCGGTCCGGCGCTCCCCCCGCATCCCGAGCCGGCAGCGTGCGGGGACAGCCCGGGCACGGGGAAGGTG
GCACGGGATCGCTTTCCTCTGAACGCTTCTCGCTGCTCTTTGAGCCTGCAGACACCTGGGGGATACGGGGAAAAGAATTC
ACTAGTACCGGTAGGCCTGTCGACGATATCGGGCCCGCGGCCGCTGGATCCTCTAGACTGCAGCTCGAGTACCCATACGA
CGTCCCAGACTACGCTTGAGTTTAAACACGCGTGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGC
ATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCT
CAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAactccgcccagttccgcccattctccgc
cccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgagga
ggcttttttggaggccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccctcgggccgtacgca
ccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtggacccggaccgccacatcgagcgggtcaccgag
ctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggt
ctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttccc
ggctggccgcgcagcaacagatggaagggctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtc
ggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccgg
ggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacg
tcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaacgcgttccggaaatcaacctctg
gattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaat
gcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatg
aggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcatt
gccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgcct
tgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccat
ggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggac
cttccttcccgcggcctgctgccggctctgcggcctcttccgcgtctcgccttcgccctcagacgagtcggatctccctt
tgggccgcctccccgcctgtccggatggaagggctaattcactcccaacgaatacaagatctgctttttgcttgtactgg
gtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagct
tgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtca
gtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcaga
gagtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcat
ttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggcatctatgtcgggtgcgg
agaaagaggtaatgaaatggcattatgggtattatgggtctgcattaatgaatcggccaacgatcccggtgtgaaatacc
gcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttc
ggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaac
atgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccc
tgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttcccc
ctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagc
gtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacga
accccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgc
cactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcct
aactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtag
ctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaag
gatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtc
atgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatga
gtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatag
ttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcga
gacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaac
tttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacg
ttgttgaaaaaggatcttcacctagatccttttcacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatg
tcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcga
tagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagcc
ctgcaaagtaaactggatggctttctcgccgccaaggatctgatggcgcaggggatcaagctctgatcaagagacaggat
gaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctat
gactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgt
caagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttc
cttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctc
ctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggc
tacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcagg
atgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgag
gatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactg
tggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaat
gggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgag
ttcttctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaacatcccttata
aatcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactcc
aacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcggtc
gaggtgccgtaaagctctaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtgg
cgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccacc
acacccgcgcgcttaatgcgccgctacagggcgcgtccattcgccattcaggatcgaattaattcttaattaacatcatc
aataatatacctt
                                    LOCUS       dna                      8483 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
Other Gene 715..895
/gene="HIV-1_5_LTR other"
Other Gene 1006..1050
/gene="HIV-1_psi_pack other"
misc_binding 1092..1097
/dbxref="REBASE:NruI"
Regulatory_Seq 1557..1790
/gene="RRE reg"
ORF 1600..2301
/sequence="ORF_1 rf(1)"
misc_binding 2439..2444
/dbxref="REBASE:ClaI"
misc_binding 3425..3430
/dbxref="REBASE:EcoRI"
misc_binding 3443..3448
/dbxref="REBASE:StuI"
misc_binding 3455..3460
/dbxref="REBASE:EcoRV"
misc_binding 3461..3466
/dbxref="REBASE:ApaI"
misc_binding 3467..3474
/dbxref="REBASE:NotI"
misc_binding 3476..3481
/dbxref="REBASE:BamHI"
misc_binding 3482..3487
/dbxref="REBASE:XbaI"
misc_binding 3494..3499
/dbxref="REBASE:XhoI"
Promoter 3544..3812
/gene="SV40 prom"
Rep_Origin 3711..3788
/gene="SV40 origin"
ORF 3778..4446
/sequence="ORF_2 rf(1)"
misc_binding 3791..3803
/dbxref="REBASE:SfiI"
Marker 3847..4446
/gene="puro marker"
Other Gene 5056..5108
/gene="delta_U3 other"
Other Gene 5109..5289
/gene="HIV-1_5_LTR other"
Rep_Origin 5795..6414
/gene="pBR322 origin"
Promoter 7067..7116
/gene="NEOKAN prom"
misc_binding 7174..7179
/dbxref="REBASE:BclI"
ORF 7205..7999
/sequence="ORF_3 rf(2)"
Marker 7208..7996
/gene="NTP_II marker"
Rep_Origin 8104..8409
/gene="f1 origin"
BASE COUNT 2047 a 2201 c 2375 g 1860 t 0 others
ORIGIN
1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag
541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg
601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact
661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct
721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt
781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac
841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc
901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc
961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa
1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg
1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata
1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc
1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga
1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc
1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca
1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag
1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta
1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga
1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg
1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg
1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc
1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg
1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat
1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac
1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat
1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca
2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga
2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg
2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa
2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga
2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag
2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa
2401 aattcaaaat tttcgggttt ttcgaaccta gccccgggat cgatcaattg ggggagctca
2461 cggggacagc ccccccccaa agcccccagg gatgtaatta cgtccctccc ccgctagggg
2521 gcagcagcga ccgcccgggg ctccgctccg gtccggcgct ccccccgcat cccgagccgg
2581 cagcgtgcgg ggacagcccg ggcacgggga aggtggcacg ggatcgcttt cctctgaacg
2641 cttctcgctg ctctttgagc ctgcagacac ctgggggata cggggaaaag gtaccgggga
2701 gctcacgggg acagcccccc cccaaagccc ccagggatgt aattacgtcc ctcccccgct
2761 agggggcagc agcgaccgcc cggggctccg ctccggtccg gcgctccccc cgcatcccga
2821 gccggcagcg tgcggggaca gcccgggcac ggggaaggtg gcacgggatc gctttcctct
2881 gaacgcttct cgctgctctt tgagcctgca gacacctggg ggatacgggg aaaacaattc
2941 ggggagctca cggggacagc ccccccccaa agcccccagg gatgtaatta cgtccctccc
3001 ccgctagggg gcagcagcga ccgcccgggg ctccgctccg gtccggcgct ccccccgcat
3061 cccgagccgg cagcgtgcgg ggacagcccg ggcacgggga aggtggcacg ggatcgcttt
3121 cctctgaacg cttctcgctg ctctttgagc ctgcagacac ctgggggata cggggaaaag
3181 gtaccgggga gctcacgggg acagcccccc cccaaagccc ccagggatgt aattacgtcc
3241 ctcccccgct agggggcagc agcgaccgcc cggggctccg ctccggtccg gcgctccccc
3301 cgcatcccga gccggcagcg tgcggggaca gcccgggcac ggggaaggtg gcacgggatc
3361 gctttcctct gaacgcttct cgctgctctt tgagcctgca gacacctggg ggatacgggg
3421 aaaagaattc actagtaccg gtaggcctgt cgacgatatc gggcccgcgg ccgctggatc
3481 ctctagactg cagctcgagt acccatacga cgtcccagac tacgcttgag tttaaacacg
3541 cgtggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc atgcatctca
3601 attagtcagc aaccaggtgt ggaaagtccc caggctcccc agcaggcaga agtatgcaaa
3661 gcatgcatct caattagtca gcaaccatag tcccgcccct aactccgccc atcccgcccc
3721 taactccgcc cagttccgcc cattctccgc cccatggctg actaattttt tttatttatg
3781 cagaggccga ggccgcctcg gcctctgagc tattccagaa gtagtgagga ggcttttttg
3841 gaggccatga ccgagtacaa gcccacggtg cgcctcgcca cccgcgacga cgtccctcgg
3901 gccgtacgca ccctcgccgc cgcgttcgcc gactaccccg ccacgcgcca caccgtggac
3961 ccggaccgcc acatcgagcg ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg
4021 ctcgacatcg gcaaggtgtg ggtcgcggac gacggcgccg cggtggcggt ctggaccacg
4081 ccggagagcg tcgaagcggg ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg
4141 agcggttccc ggctggccgc gcagcaacag atggaagggc tcctggcgcc gcaccggccc
4201 aaggagcccg cgtggttcct ggccaccgtc ggcgtctcgc ccgaccacca gggcaagggt
4261 ctgggcagcg ccgtcgtgct ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc
4321 ttcctggaga cctccgcgcc ccgcaacctc cccttctacg agcggctcgg cttcaccgtc
4381 accgccgacg tcgaggtgcc cgaaggaccg cgcacctggt gcatgacccg caagcccggt
4441 gcctgaacgc gttccggaaa tcaacctctg gattacaaaa tttgtgaaag attgactggt
4501 attcttaact atgttgctcc ttttacgcta tgtggatacg ctgctttaat gcctttgtat
4561 catgctattg cttcccgtat ggctttcatt ttctcctcct tgtataaatc ctggttgctg
4621 tctctttatg aggagttgtg gcccgttgtc aggcaacgtg gcgtggtgtg cactgtgttt
4681 gctgacgcaa cccccactgg ttggggcatt gccaccacct gtcagctcct ttccgggact
4741 ttcgctttcc ccctccctat tgccacggcg gaactcatcg ccgcctgcct tgcccgctgc
4801 tggacagggg ctcggctgtt gggcactgac aattccgtgg tgttgtcggg gaagctgacg
4861 tcctttccat ggctgctcgc ctgtgttgcc acctggattc tgcgcgggac gtccttctgc
4921 tacgtccctt cggccctcaa tccagcggac cttccttccc gcggcctgct gccggctctg
4981 cggcctcttc cgcgtctcgc cttcgccctc agacgagtcg gatctccctt tgggccgcct
5041 ccccgcctgt ccggatggaa gggctaattc actcccaacg aatacaagat ctgctttttg
5101 cttgtactgg gtctctctgg ttagaccaga tctgagcctg ggagctctct ggctaactag
5161 ggaacccact gcttaagcct caataaagct tgccttgagt gcttcaagta gtgtgtgccc
5221 gtctgttgtg tgactctggt aactagagat ccctcagacc cttttagtca gtgtggaaaa
5281 tctctagcag tagtagttca tgtcatctta ttattcagta tttataactt gcaaagaaat
5341 gaatatcaga gagtgagagg aacttgttta ttgcagctta taatggttac aaataaagca
5401 atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt
5461 ccaaactcat caatgtatct tatcatgtct ggcatctatg tcgggtgcgg agaaagaggt
5521 aatgaaatgg cattatgggt attatgggtc tgcattaatg aatcggccaa cgatcccggt
5581 gtgaaatacc gcacagatgc gtaaggagaa aataccgcat caggcgctct tccgcttcct
5641 cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa
5701 aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa
5761 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc
5821 tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga
5881 caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc
5941 cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt
6001 ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct
6061 gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg
6121 agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta
6181 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct
6241 acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa
6301 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt
6361 gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta
6421 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat
6481 caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa
6541 gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct
6601 cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta
6661 cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct
6721 caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg
6781 gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa
6841 gtagttcgcc agttaatagt ttgcgcaacg ttgttgaaaa aggatcttca cctagatcct
6901 tttcacgtag aaagccagtc cgcagaaacg gtgctgaccc cggatgaatg tcagctactg
6961 ggctatctgg acaagggaaa acgcaagcgc aaagagaaag caggtagctt gcagtgggct
7021 tacatggcga tagctagact gggcggtttt atggacagca agcgaaccgg aattgccagc
7081 tggggcgccc tctggtaagg ttgggaagcc ctgcaaagta aactggatgg ctttctcgcc
7141 gccaaggatc tgatggcgca ggggatcaag ctctgatcaa gagacaggat gaggatcgtt
7201 tcgcatgatt gaacaagatg gattgcacgc aggttctccg gccgcttggg tggagaggct
7261 attcggctat gactgggcac aacagacaat cggctgctct gatgccgccg tgttccggct
7321 gtcagcgcag gggcgcccgg ttctttttgt caagaccgac ctgtccggtg ccctgaatga
7381 actgcaagac gaggcagcgc ggctatcgtg gctggccacg acgggcgttc cttgcgcagc
7441 tgtgctcgac gttgtcactg aagcgggaag ggactggctg ctattgggcg aagtgccggg
7501 gcaggatctc ctgtcatctc accttgctcc tgccgagaaa gtatccatca tggctgatgc
7561 aatgcggcgg ctgcatacgc ttgatccggc tacctgccca ttcgaccacc aagcgaaaca
7621 tcgcatcgag cgagcacgta ctcggatgga agccggtctt gtcgatcagg atgatctgga
7681 cgaagagcat caggggctcg cgccagccga actgttcgcc aggctcaagg cgagcatgcc
7741 cgacggcgag gatctcgtcg tgacccatgg cgatgcctgc ttgccgaata tcatggtgga
7801 aaatggccgc ttttctggat tcatcgactg tggccggctg ggtgtggcgg accgctatca
7861 ggacatagcg ttggctaccc gtgatattgc tgaagagctt ggcggcgaat gggctgaccg
7921 cttcctcgtg ctttacggta tcgccgctcc cgattcgcag cgcatcgcct tctatcgcct
7981 tcttgacgag ttcttctgaa ttttgttaaa atttttgtta aatcagctca ttttttaacc
8041 aataggccga aatcggcaac atcccttata aatcaaaaga atagaccgcg atagggttga
8101 gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag
8161 ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga accatcaccc aaatcaagtt
8221 ttttgcggtc gaggtgccgt aaagctctaa atcggaaccc taaagggagc ccccgattta
8281 gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag
8341 cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgcgc
8401 gcttaatgcg ccgctacagg gcgcgtccat tcgccattca ggatcgaatt aattcttaat
8461 taacatcatc aataatatac ctt
//
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 540
CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541 caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 600
GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601 tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 660
ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

HIV-1_5_LTR other(715,895)>>>
|
661 gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 720
CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721 ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 780
GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781 aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 840
TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841 tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 900
AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901 gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 960
CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

HIV-1_psi_pack other(1006,1050)>>>
|
961 ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 1020
CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021 ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 1080
AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

NruI
|
1081 ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 1140
CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141 aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 1200
TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201 tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 1260
ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261 caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 1320
GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321 aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 1380
TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381 aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 1440
TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441 ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 1500
CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

RRE reg(1557,1790)>>>
|
1501 gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 1560
CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

ORF_1 rf(1)(1600,2301)>>>
|
1561 gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 1620
CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621 ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 1680
GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681 agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 1740
TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741 caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 1800
GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801 ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 1860
CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861 aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 1920
TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921 aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 1980
TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981 gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 2040
CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041 aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 2100
TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101 atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 2160
TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161 tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 2220
AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221 ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 2280
CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281 aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 2340
TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

2341 aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 2400
TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

ClaI
|
2401 aattcaaaattttcgggtttttcgaacctagccccgggatcgatcaattgggggagctca 2460
TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCGGGGCCCTAGCTAGTTAACCCCCTCGAGT

2461 cggggacagcccccccccaaagcccccagggatgtaattacgtccctcccccgctagggg 2520
GCCCCTGTCGGGGGGGGGTTTCGGGGGTCCCTACATTAATGCAGGGAGGGGGCGATCCCC

2521 gcagcagcgaccgcccggggctccgctccggtccggcgctccccccgcatcccgagccgg 2580
CGTCGTCGCTGGCGGGCCCCGAGGCGAGGCCAGGCCGCGAGGGGGGCGTAGGGCTCGGCC

2581 cagcgtgcggggacagcccgggcacggggaaggtggcacgggatcgctttcctctgaacg 2640
GTCGCACGCCCCTGTCGGGCCCGTGCCCCTTCCACCGTGCCCTAGCGAAAGGAGACTTGC

2641 cttctcgctgctctttgagcctgcagacacctgggggatacggggaaaaggtaccgggga 2700
GAAGAGCGACGAGAAACTCGGACGTCTGTGGACCCCCTATGCCCCTTTTCCATGGCCCCT

2701 gctcacggggacagcccccccccaaagcccccagggatgtaattacgtccctcccccgct 2760
CGAGTGCCCCTGTCGGGGGGGGGTTTCGGGGGTCCCTACATTAATGCAGGGAGGGGGCGA

2761 agggggcagcagcgaccgcccggggctccgctccggtccggcgctccccccgcatcccga 2820
TCCCCCGTCGTCGCTGGCGGGCCCCGAGGCGAGGCCAGGCCGCGAGGGGGGCGTAGGGCT

2821 gccggcagcgtgcggggacagcccgggcacggggaaggtggcacgggatcgctttcctct 2880
CGGCCGTCGCACGCCCCTGTCGGGCCCGTGCCCCTTCCACCGTGCCCTAGCGAAAGGAGA

2881 gaacgcttctcgctgctctttgagcctgcagacacctgggggatacggggaaaacaattc 2940
CTTGCGAAGAGCGACGAGAAACTCGGACGTCTGTGGACCCCCTATGCCCCTTTTGTTAAG

2941 ggggagctcacggggacagcccccccccaaagcccccagggatgtaattacgtccctccc 3000
CCCCTCGAGTGCCCCTGTCGGGGGGGGGTTTCGGGGGTCCCTACATTAATGCAGGGAGGG

3001 ccgctagggggcagcagcgaccgcccggggctccgctccggtccggcgctccccccgcat 3060
GGCGATCCCCCGTCGTCGCTGGCGGGCCCCGAGGCGAGGCCAGGCCGCGAGGGGGGCGTA

3061 cccgagccggcagcgtgcggggacagcccgggcacggggaaggtggcacgggatcgcttt 3120
GGGCTCGGCCGTCGCACGCCCCTGTCGGGCCCGTGCCCCTTCCACCGTGCCCTAGCGAAA

3121 cctctgaacgcttctcgctgctctttgagcctgcagacacctgggggatacggggaaaag 3180
GGAGACTTGCGAAGAGCGACGAGAAACTCGGACGTCTGTGGACCCCCTATGCCCCTTTTC

3181 gtaccggggagctcacggggacagcccccccccaaagcccccagggatgtaattacgtcc 3240
CATGGCCCCTCGAGTGCCCCTGTCGGGGGGGGGTTTCGGGGGTCCCTACATTAATGCAGG

3241 ctcccccgctagggggcagcagcgaccgcccggggctccgctccggtccggcgctccccc 3300
GAGGGGGCGATCCCCCGTCGTCGCTGGCGGGCCCCGAGGCGAGGCCAGGCCGCGAGGGGG

3301 cgcatcccgagccggcagcgtgcggggacagcccgggcacggggaaggtggcacgggatc 3360
GCGTAGGGCTCGGCCGTCGCACGCCCCTGTCGGGCCCGTGCCCCTTCCACCGTGCCCTAG

3361 gctttcctctgaacgcttctcgctgctctttgagcctgcagacacctgggggatacgggg 3420
CGAAAGGAGACTTGCGAAGAGCGACGAGAAACTCGGACGTCTGTGGACCCCCTATGCCCC

NotI
|
EcoRI StuI EcoRV ApaI BamHI
| | | | | |
3421 aaaagaattcactagtaccggtaggcctgtcgacgatatcgggcccgcggccgctggatc 3480
TTTTCTTAAGTGATCATGGCCATCCGGACAGCTGCTATAGCCCGGGCGCCGGCGACCTAG

XbaI XhoI
| |
3481 ctctagactgcagctcgagtacccatacgacgtcccagactacgcttgagtttaaacacg 3540
GAGATCTGACGTCGAGCTCATGGGTATGCTGCAGGGTCTGATGCGAACTCAAATTTGTGC

SV40 prom(3544,3812)>>>
|
3541 cgtggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctca 3600
GCACCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGT

3601 attagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaa 3660
TAATCAGTCGTTGGTCCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTT

SV40 origin(3711,3788)>>>
|
3661 gcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccc 3720
CGTACGTAGAGTTAATCAGTCGTTGGTATCAGGGCGGGGATTGAGGCGGGTAGGGCGGGG

ORF_2 rf(1)(3778,4446)>>>
|
3721 taactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatg 3780
ATTGAGGCGGGTCAAGGCGGGTAAGAGGCGGGGTACCGACTGATTAAAAAAAATAAATAC

SfiI
|
3781 cagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttg 3840
GTCTCCGGCTCCGGCGGAGCCGGAGACTCGATAAGGTCTTCATCACTCCTCCGAAAAAAC

puro marker(3847,4446)>>>
|
3841 gaggccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccctcgg 3900
CTCCGGTACTGGCTCATGTTCGGGTGCCACGCGGAGCGGTGGGCGCTGCTGCAGGGAGCC

3901 gccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtggac 3960
CGGCATGCGTGGGAGCGGCGGCGCAAGCGGCTGATGGGGCGGTGCGCGGTGTGGCACCTG

3961 ccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcggg 4020
GGCCTGGCGGTGTAGCTCGCCCAGTGGCTCGACGTTCTTGAGAAGGAGTGCGCGCAGCCC

4021 ctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacg 4080
GAGCTGTAGCCGTTCCACACCCAGCGCCTGCTGCCGCGGCGCCACCGCCAGACCTGGTGC

4081 ccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttg 4140
GGCCTCTCGCAGCTTCGCCCCCGCCACAAGCGGCTCTAGCCGGGCGCGTACCGGCTCAAC

4141 agcggttcccggctggccgcgcagcaacagatggaagggctcctggcgccgcaccggccc 4200
TCGCCAAGGGCCGACCGGCGCGTCGTTGTCTACCTTCCCGAGGACCGCGGCGTGGCCGGG

4201 aaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggt 4260
TTCCTCGGGCGCACCAAGGACCGGTGGCAGCCGCAGAGCGGGCTGGTGGTCCCGTTCCCA

4261 ctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgcc 4320
GACCCGTCGCGGCAGCACGAGGGGCCTCACCTCCGCCGGCTCGCGCGGCCCCACGGGCGG

4321 ttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtc 4380
AAGGACCTCTGGAGGCGCGGGGCGTTGGAGGGGAAGATGCTCGCCGAGCCGAAGTGGCAG

4381 accgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggt 4440
TGGCGGCTGCAGCTCCACGGGCTTCCTGGCGCGTGGACCACGTACTGGGCGTTCGGGCCA

4441 gcctgaacgcgttccggaaatcaacctctggattacaaaatttgtgaaagattgactggt 4500
CGGACTTGCGCAAGGCCTTTAGTTGGAGACCTAATGTTTTAAACACTTTCTAACTGACCA

4501 attcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtat 4560
TAAGAATTGATACAACGAGGAAAATGCGATACACCTATGCGACGAAATTACGGAAACATA

4561 catgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctg 4620
GTACGATAACGAAGGGCATACCGAAAGTAAAAGAGGAGGAACATATTTAGGACCAACGAC

4621 tctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgttt 4680
AGAGAAATACTCCTCAACACCGGGCAACAGTCCGTTGCACCGCACCACACGTGACACAAA

4681 gctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggact 4740
CGACTGCGTTGGGGGTGACCAACCCCGTAACGGTGGTGGACAGTCGAGGAAAGGCCCTGA

4741 ttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgc 4800
AAGCGAAAGGGGGAGGGATAACGGTGCCGCCTTGAGTAGCGGCGGACGGAACGGGCGACG

4801 tggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacg 4860
ACCTGTCCCCGAGCCGACAACCCGTGACTGTTAAGGCACCACAACAGCCCCTTCGACTGC

4861 tcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgc 4920
AGGAAAGGTACCGACGAGCGGACACAACGGTGGACCTAAGACGCGCCCTGCAGGAAGACG

4921 tacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctg 4980
ATGCAGGGAAGCCGGGAGTTAGGTCGCCTGGAAGGAAGGGCGCCGGACGACGGCCGAGAC

4981 cggcctcttccgcgtctcgccttcgccctcagacgagtcggatctccctttgggccgcct 5040
GCCGGAGAAGGCGCAGAGCGGAAGCGGGAGTCTGCTCAGCCTAGAGGGAAACCCGGCGGA

delta_U3 other(5056,5108)>>>
|
5041 ccccgcctgtccggatggaagggctaattcactcccaacgaatacaagatctgctttttg 5100
GGGGCGGACAGGCCTACCTTCCCGATTAAGTGAGGGTTGCTTATGTTCTAGACGAAAAAC

HIV-1_5_LTR other(5109,5289)>>>
|
5101 cttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactag 5160
GAACATGACCCAGAGAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATC

5161 ggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgccc 5220
CCTTGGGTGACGAATTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGG

5221 gtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaa 5280
CAGACAACACACTGAGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTT

5281 tctctagcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaat 5340
AGAGATCGTCATCATCAAGTACAGTAGAATAATAAGTCATAAATATTGAACGTTTCTTTA

5341 gaatatcagagagtgagaggaacttgtttattgcagcttataatggttacaaataaagca 5400
CTTATAGTCTCTCACTCTCCTTGAACAAATAACGTCGAATATTACCAATGTTTATTTCGT

5401 atagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgt 5460
TATCGTAGTGTTTAAAGTGTTTATTTCGTAAAAAAAGTGACGTAAGATCAACACCAAACA

5461 ccaaactcatcaatgtatcttatcatgtctggcatctatgtcgggtgcggagaaagaggt 5520
GGTTTGAGTAGTTACATAGAATAGTACAGACCGTAGATACAGCCCACGCCTCTTTCTCCA

5521 aatgaaatggcattatgggtattatgggtctgcattaatgaatcggccaacgatcccggt 5580
TTACTTTACCGTAATACCCATAATACCCAGACGTAATTACTTAGCCGGTTGCTAGGGCCA

5581 gtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcct 5640
CACTTTATGGCGTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGA

5641 cgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaa 5700
GCGAGTGACTGAGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTT

5701 aggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaa 5760
TCCGCCATTATGCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTT

pBR322 origin(5795,6414)<<<
|
5761 aaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggc 5820
TTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCG

5821 tccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccga 5880
AGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCT

5881 caggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttc 5940
GTCCTGATATTTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAG

5941 cgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgcttt 6000
GCTGGGACGGCGAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAA

6001 ctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggct 6060
GAGTATCGAGTGCGACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGA

6061 gtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttg 6120
CACACGTGCTTGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAAC

6121 agtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggatta 6180
TCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAAT

6181 gcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggct 6240
CGTCTCGCTCCATACATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGA

6241 acactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaa 6300
TGTGATCTTCCTGTCATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTT

6301 gagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgttt 6360
CTCAACCATCGAGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAA

6361 gcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttcta 6420
CGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGAT

6421 cggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattat 6480
GCCCCAGACTGCGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATA

6481 caaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaa 6540
GTTTTTCCTAGAAGTGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTT

6541 gtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatct 6600
CATATATACTCATTTGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGA

6601 cagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataacta 6660
GTCGCTAGACAGATAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGAT

6661 cgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgct 6720
GCTATGCCCTCCCGAATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGA

6721 caccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtg 6780
GTGGCCGAGGTCTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCAC

6781 gtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaa 6840
CAGGACGTTGAAATAGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATT

6841 gtagttcgccagttaatagtttgcgcaacgttgttgaaaaaggatcttcacctagatcct 6900
CATCAAGCGGTCAATTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGA

6901 tttcacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactg 6960
AAAGTGCATCTTTCGGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGAC

6961 ggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggct 7020
CCGATAGACCTGTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGA

NEOKAN prom(7067,7116)>>>
|
7021 tacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagc 7080
ATGTACCGCTATCGATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCG

7081 tggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttctcgcc 7140
ACCCCGCGGGAGACCATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGG

BclI
|
7141 gccaaggatctgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtt 7200
CGGTTCCTAGACTACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAA

NTP_II marker(7208,7996)>>>
|
ORF_3 rf(2)(7205,7999)>>>
| |
7201 tcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggct 7260
AGCGTACTAACTTGTTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGA

7261 attcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggct 7320
TAAGCCGATACTGACCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGA

7321 gtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatga 7380
CAGTCGCGTCCCCGCGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACT

7381 actgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagc 7440
TGACGTTCTGCTCCGTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCG

7441 tgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggg 7500
ACACGAGCTGCAACAGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCC

7501 gcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgc 7560
CGTCCTAGAGGACAGTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACG

7561 aatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaaca 7620
TTACGCCGCCGACGTATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGT

7621 tcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctgga 7680
AGCGTAGCTCGCTCGTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCT

7681 cgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcc 7740
GCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGG

7741 cgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtgga 7800
GCTGCCGCTCCTAGAGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCT

7801 aaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatca 7860
TTTACCGGCGAAAAGACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGT

7861 ggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccg 7920
CCTGTATCGCAACCGATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGC

7921 cttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgcct 7980
GAAGGAGCACGAAATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGA

7981 tcttgacgagttcttctgaattttgttaaaatttttgttaaatcagctcattttttaacc 8040
AGAACTGCTCAAGAAGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGG

8041 aataggccgaaatcggcaacatcccttataaatcaaaagaatagaccgcgatagggttga 8100
TTATCCGGCTTTAGCCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACT

f1 origin(8104,8409)<<<
|
8101 gtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaag 8160
CACAACAAGGTCAAACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTC

8161 ggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagtt 8220
CCGCTTTTTGGCAGATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAA

8221 ttttgcggtcgaggtgccgtaaagctctaaatcggaaccctaaagggagcccccgattta 8280
AAAACGCCAGCTCCACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAAT

8281 gagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggag 8340
CTCGAACTGCCCCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTC

8341 cgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgc 8400
GCCCGCGATCCCGCGACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCG

8401 gcttaatgcgccgctacagggcgcgtccattcgccattcaggatcgaattaattcttaat 8460
CGAATTACGCGGCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTA

8461 taacatcatcaataatatacctt 8483
ATTGTAGTAGTTATTATATGGAA
                                    LOCUS       dna                      8483 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
Other Gene 715..895
/gene="HIV-1_5_LTR other"
Other Gene 1006..1050
/gene="HIV-1_psi_pack other"
misc_binding 1092..1097
/dbxref="REBASE:NruI"
Regulatory_Seq 1557..1790
/gene="RRE reg"
ORF 1600..2301
/sequence="ORF_1 rf(1)"
misc_binding 2439..2444
/dbxref="REBASE:ClaI"
misc_binding 3425..3430
/dbxref="REBASE:EcoRI"
misc_binding 3443..3448
/dbxref="REBASE:StuI"
misc_binding 3455..3460
/dbxref="REBASE:EcoRV"
misc_binding 3461..3466
/dbxref="REBASE:ApaI"
misc_binding 3467..3474
/dbxref="REBASE:NotI"
misc_binding 3476..3481
/dbxref="REBASE:BamHI"
misc_binding 3482..3487
/dbxref="REBASE:XbaI"
misc_binding 3494..3499
/dbxref="REBASE:XhoI"
Promoter 3544..3812
/gene="SV40 prom"
Rep_Origin 3711..3788
/gene="SV40 origin"
ORF 3778..4446
/sequence="ORF_2 rf(1)"
misc_binding 3791..3803
/dbxref="REBASE:SfiI"
Marker 3847..4446
/gene="puro marker"
Other Gene 5056..5108
/gene="delta_U3 other"
Other Gene 5109..5289
/gene="HIV-1_5_LTR other"
Rep_Origin 5795..6414
/gene="pBR322 origin"
Promoter 7067..7116
/gene="NEOKAN prom"
misc_binding 7174..7179
/dbxref="REBASE:BclI"
ORF 7205..7999
/sequence="ORF_3 rf(2)"
Marker 7208..7996
/gene="NTP_II marker"
Rep_Origin 8104..8409
/gene="f1 origin"