pLenti-Tri-cistronic
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepLenti-Tri-cistronic
VectorTypeLentivirus
Antibiotic InformationPuromycin
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaaatgt agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag
541 caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg
601 tacgatcgtg ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact
661 gaattgccgc attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct
721 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt
781 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac
841 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc
901 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc
961 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa
1021 ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg
1081 ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata
1141 aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc
1201 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga
1261 caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc
1321 aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca
1381 aaagtaagac caccgcacag caagcccgct gatcttcaga cctggaggag gagatatgag
1441 ggacattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta
1501 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga
1561 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg
1621 ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg
1681 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc
1741 caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg
1801 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat
1861 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac
1921 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat
1981 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca
2041 aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga
2101 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg
2161 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa
2221 ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga
2281 aagcttggga ttcgaattta aaagaaaagg ggggattggg gggtacagtg caggggaaag
2341 aatagtagac ataatagcaa cagacataca aactaaagaa ctacaaaaac aaattacaaa
2401 aattcaaaat tttcgggttt ttcgaaccta gcagacgtcg gcagtgaaaa aaatgcttta
2461 tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag
2521 ttaacaacaa gaattgcatt cattttatgt ttcaggttca gggggaggtg tgggaggttt
2581 tttaaagcaa gtaaaacctc tacaaatgtg gtatggctga ttatgatctc acctaggctc
2641 gagggatccc ccgggcgatc tgacggttca ctaaacgagc tctgcttata taggcctccc
2701 accgtacacg ccacctcgac ataaattcta ccgggtaggg gaggcgcttt tcccaaggca
2761 gtctggagca tgcgctttag cagccccgct gggcacttgg cgctacacaa gtggcctctg
2821 gcctcgcaca cattccacat ccaccggtag gcgccaaccg gctccgttct ttggtggccc
2881 cttcgcgcca ccttctactc ctcccctagt caggaagttc ccccccgccc cgcagctcgc
2941 gtcgtgcagg acgtgacaaa tggaagtagc acgtctcact agtctcgtgc agatggacag
3001 caccgctgag caatggaagc gggtaggcct ttggggcagc ggccaatagc agctttgctc
3061 cttcgctttc tgggctcaga ggctgggaag gggtgggtcc gggggcgggc tcaggggcgg
3121 gctcaggggc ggggcgggcg cccgaaggtc ctccggaggc ccggcattct gcacgcttca
3181 aaagcgcacg tctgccgcgc tgttctcctc ttcctcatct ccgggccttt cgacctatcg
3241 atcaattgag tacttacgta ggtaccggtt ctggtgaggg cagaggaagt ctgctaacat
3301 gcggtgacgt cgaggagaat cctggcccag aattcgatat cgggcccgcg gccgcgtcta
3361 gatgagtcga gtacccatac gacgtcccag actacgcttg agtttaaaca cgcgtggtgt
3421 ggaaagtccc caggctcccc agcaggcaga agtatgcaaa gcatgcatct caattagtca
3481 gcaaccaggt gtggaaagtc cccaggctcc ccagcaggca gaagtatgca aagcatgcat
3541 ctcaattagt cagcaaccat agtcccgccc ctaactccgc ccatcccgcc cctaactccg
3601 cccagttccg cccattctcc gccccatggc tgactaattt tttttattta tgcagaggcc
3661 gaggccgcct cggcctctga gctattccag aagtagtgag gaggcttttt tggaggccat
3721 gaccgagtac aagcccacgg tgcgcctcgc cacccgcgac gacgtccctc gggccgtacg
3781 caccctcgcc gccgcgttcg ccgactaccc cgccacgcgc cacaccgtgg acccggaccg
3841 ccacatcgag cgggtcaccg agctgcaaga actcttcctc acgcgcgtcg ggctcgacat
3901 cggcaaggtg tgggtcgcgg acgacggcgc cgcggtggcg gtctggacca cgccggagag
3961 cgtcgaagcg ggggcggtgt tcgccgagat cggcccgcgc atggccgagt tgagcggttc
4021 ccggctggcc gcgcagcaac agatggaagg gctcctggcg ccgcaccggc ccaaggagcc
4081 cgcgtggttc ctggccaccg tcggcgtctc gcccgaccac cagggcaagg gtctgggcag
4141 cgccgtcgtg ctccccggag tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga
4201 gacctccgcg ccccgcaacc tccccttcta cgagcggctc ggcttcaccg tcaccgccga
4261 cgtcgaggtg cccgaaggac cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaac
4321 gcgttccgga aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa
4381 ctatgttgct ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat
4441 tgcttcccgt atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta
4501 tgaggagttg tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc
4561 aacccccact ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt
4621 ccccctccct attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg
4681 ggctcggctg ttgggcactg acaattccgt ggtgttgtcg gggaagctga cgtcctttcc
4741 atggctgctc gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc
4801 ttcggccctc aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct
4861 tccgcgtctc gccttcgccc tcagacgagt cggatctccc tttgggccgc ctccccgcct
4921 gtccggatgg aagggctaat tcactcccaa cgaatacaag atctgctttt tgcttgtact
4981 gggtctctct ggttagacca gatctgagcc tgggagctct ctggctaact agggaaccca
5041 ctgcttaagc ctcaataaag cttgccttga gtgcttcaag tagtgtgtgc ccgtctgttg
5101 tgtgactctg gtaactagag atccctcaga cccttttagt cagtgtggaa aatctctagc
5161 agtagtagtt catgtcatct tattattcag tatttataac ttgcaaagaa atgaatatca
5221 gagagtgaga ggaacttgtt tattgcagct tataatggtt acaaataaag caatagcatc
5281 acaaatttca caaataaagc atttttttca ctgcattcta gttgtggttt gtccaaactc
5341 atcaatgtat cttatcatgt ctggcatcta tgtcgggtgc ggagaaagag gtaatgaaat
5401 ggcattatgg gtattatggg tctgcattaa tgaatcggcc aacgatcccg gtgtgaaata
5461 ccgcacagat gcgtaaggag aaaataccgc atcaggcgct cttccgcttc ctcgctcact
5521 gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta
5581 atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag
5641 caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc
5701 cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta
5761 taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg
5821 ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc
5881 tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac
5941 gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac
6001 ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg
6061 aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga
6121 aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt
6181 agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag
6241 cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct
6301 gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg
6361 atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat
6421 gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc
6481 tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg
6541 gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct
6601 ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca
6661 actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg
6721 ccagttaata gtttgcgcaa cgttgttgaa aaaggatctt cacctagatc cttttcacgt
6781 agaaagccag tccgcagaaa cggtgctgac cccggatgaa tgtcagctac tgggctatct
6841 ggacaaggga aaacgcaagc gcaaagagaa agcaggtagc ttgcagtggg cttacatggc
6901 gatagctaga ctgggcggtt ttatggacag caagcgaacc ggaattgcca gctggggcgc
6961 cctctggtaa ggttgggaag ccctgcaaag taaactggat ggctttctcg ccgccaagga
7021 tctgatggcg caggggatca agctctgatc aagagacagg atgaggatcg tttcgcatga
7081 ttgaacaaga tggattgcac gcaggttctc cggccgcttg ggtggagagg ctattcggct
7141 atgactgggc acaacagaca atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc
7201 aggggcgccc ggttcttttt gtcaagaccg acctgtccgg tgccctgaat gaactgcaag
7261 acgaggcagc gcggctatcg tggctggcca cgacgggcgt tccttgcgca gctgtgctcg
7321 acgttgtcac tgaagcggga agggactggc tgctattggg cgaagtgccg gggcaggatc
7381 tcctgtcatc tcaccttgct cctgccgaga aagtatccat catggctgat gcaatgcggc
7441 ggctgcatac gcttgatccg gctacctgcc cattcgacca ccaagcgaaa catcgcatcg
7501 agcgagcacg tactcggatg gaagccggtc ttgtcgatca ggatgatctg gacgaagagc
7561 atcaggggct cgcgccagcc gaactgttcg ccaggctcaa ggcgagcatg cccgacggcg
7621 aggatctcgt cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc
7681 gcttttctgg attcatcgac tgtggccggc tgggtgtggc ggaccgctat caggacatag
7741 cgttggctac ccgtgatatt gctgaagagc ttggcggcga atgggctgac cgcttcctcg
7801 tgctttacgg tatcgccgct cccgattcgc agcgcatcgc cttctatcgc cttcttgacg
7861 agttcttctg aattttgtta aaatttttgt taaatcagct cattttttaa ccaataggcc
7921 gaaatcggca acatccctta taaatcaaaa gaatagaccg cgatagggtt gagtgttgtt
7981 ccagtttgga acaagagtcc actattaaag aacgtggact ccaacgtcaa agggcgaaaa
8041 accgtctatc agggcgatgg cccactacgt gaaccatcac ccaaatcaag ttttttgcgg
8101 tcgaggtgcc gtaaagctct aaatcggaac cctaaaggga gcccccgatt tagagcttga
8161 cggggaaagc cggcgaacgt ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct
8221 agggcgctgg caagtgtagc ggtcacgctg cgcgtaacca ccacacccgc gcgcttaatg
8281 cgccgctaca gggcgcgtcc attcgccatt caggatcgaa ttaattctta attaacatca
8341 tcaataatat acctt
                                    LOCUS       dna                      8355 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
Other Gene 715..895
/gene="HIV-1_5_LTR other"
Other Gene 1006..1050
/gene="HIV-1_psi_pack other"
misc_binding 1092..1097
/dbxref="REBASE:NruI"
Regulatory_Seq 1557..1790
/gene="RRE reg"
ORF 1600..2301
/sequence="ORF_1 rf(1)"
misc_binding 2638..2643
/dbxref="REBASE:XhoI"
misc_binding 2644..2649
/dbxref="REBASE:BamHI"
misc_binding 2650..2655
/dbxref="REBASE:XmaI"
misc_binding 2650..2655
/dbxref="REBASE:SmaI"
promoter 2723..2656
/gene="mini CMV Prom."
promoter 2724..3236
/gene="PGK Prom."
misc_binding 3237..3242
/dbxref="REBASE:ClaI"
misc_binding 3261..3266
/dbxref="REBASE:KpnI"
other_gene 3266..3329
/gene="T2A Peptide"
misc_binding 3330..3335
/dbxref="REBASE:EcoRI"
misc_binding 3336..3341
/dbxref="REBASE:EcoRV"
misc_binding 3342..3347
/dbxref="REBASE:ApaI"
misc_binding 3348..3355
/dbxref="REBASE:NotI"
misc_binding 3357..3362
/dbxref="REBASE:XbaI"
Promoter 3416..3684
/gene="SV40 prom"
Rep_Origin 3583..3660
/gene="SV40 origin"
ORF 3650..4318
/sequence="ORF_2 rf(2)"
misc_binding 3663..3675
/dbxref="REBASE:SfiI"
Marker 3719..4318
/gene="puro marker"
Other Gene 4928..4980
/gene="delta_U3 other"
Other Gene 4981..5161
/gene="HIV-1_5_LTR other"
Rep_Origin 5667..6286
/gene="pBR322 origin"
Promoter 6939..6988
/gene="NEOKAN prom"
misc_binding 7046..7051
/dbxref="REBASE:BclI"
ORF 7077..7871
/sequence="ORF_3 rf(3)"
Marker 7080..7868
/gene="NTP_II marker"
Rep_Origin 7976..8281
/gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttag 540
CGCTTTTACATCAGAATACGTTATGAGAACATCAGAACGTTGTACCATTGCTACTCAATC

541 caacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg 600
GTTGTACGGAATGTTCCTCTCTTTTTCGTGGCACGTACGGCTAACCACCTTCATTCCACC

601 tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccact 660
ATGCTAGCACGGAATAATCCTTCCGTTGTCTGCCCAGACTGTACCTAACCTGCTTGGTGA

HIV-1_5_LTR other(715,895)>>>
|
661 gaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtct 720
CTTAACGGCGTAACGTCTCTATAACATAAATTCACGGATCGAGCTATGTATTTGCCCAGA

721 ctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctt 780
GAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGTGACGAA

781 aagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac 840
TTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAACACACTG

841 tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc 900
AGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCGTCACCG

901 gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactc 960
CGGGCTTGTCCCTGAACTTTCGCTTTCCCTTTGGTCTCCTCGAGAGAGCTGCGTCCTGAG

HIV-1_psi_pack other(1006,1050)>>>
|
961 ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa 1020
CCGAACGACTTCGCGCGTGCCGTTCTCCGCTCCCCGCCGCTGACCACTCATGCGGTTTTT

1021 ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcggg 1080
AAAACTGATCGCCTCCGATCTTCCTCTCTCTACCCACGCTCTCGCAGTCATAATTCGCCC

NruI
|
1081 ggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata 1140
CCTCTTAATCTAGCGCTACCCTTTTTTAAGCCAATTCCGGTCCCCCTTTCTTTTTTATAT

1141 aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc 1200
TTAATTTTGTATATCATACCCGTTCGTCCCTCGATCTTGCTAAGCGTCAATTAGGACCGG

1201 tgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcaga 1260
ACAATCTTTGTAGTCTTCCGACATCTGTTTATGACCCTGTCGATGTTGGTAGGGAAGTCT

1261 caggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatc 1320
GTCCTAGTCTTCTTGAATCTAGTAATATATTATGTCATCGTTGGGAGATAACACACGTAG

1321 aaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaaca 1380
TTTCCTATCTCTATTTTCTGTGGTTCCTTCGAAATCTGTTCTATCTCCTTCTCGTTTTGT

1381 aaagtaagaccaccgcacagcaagcccgctgatcttcagacctggaggaggagatatgag 1440
TTTCATTCTGGTGGCGTGTCGTTCGGGCGACTAGAAGTCTGGACCTCCTCCTCTATACTC

1441 ggacattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagta 1500
CCTGTAACCTCTTCACTTAATATATTTATATTTCATCATTTTTAACTTGGTAATCCTCAT

RRE reg(1557,1790)>>>
|
1501 gcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaatagga 1560
CGTGGGTGGTTCCGTTTCTCTTCTCACCACGTCTCTCTTTTTTCTCGTCACCCTTATCCT

ORF_1 rf(1)(1600,2301)>>>
|
1561 gctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacg 1620
CGAAACAAGGAACCCAAGAACCCTCGTCGTCCTTCGTGATACCCGCGTCGCAGTTACTGC

1621 ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 1680
GACTGCCATGTCCGGTCTGTTAATAACAGACCATATCACGTCGTCGTCTTGTTAAACGAC

1681 agggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctc 1740
TCCCGATAACTCCGCGTTGTCGTAGACAACGTTGAGTGTCAGACCCCGTAGTTCGTCGAG

1741 caggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttgg 1800
GTCCGTTCTTAGGACCGACACCTTTCTATGGATTTCCTAGTTGTCGAGGACCCCTAAACC

1801 ggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaat 1860
CCAACGAGACCTTTTGAGTAAACGTGGTGACGACACGGAACCTTACGATCAACCTCATTA

1861 aaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac 1920
TTTAGAGACCTTGTCTAAACCTTAGTGTGCTGGACCTACCTCACCCTGTCTCTTTAATTG

1921 aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat 1980
TTAATGTGTTCGAATTATGTGAGGAATTAACTTCTTAGCGTTTTGGTCGTTCTTTTCTTA

1981 gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataaca 2040
CTTGTTCTTAATAACCTTAATCTATTTACCCGTTCAAACACCTTAACCAAATTGTATTGT

2041 aattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaaga 2100
TTAACCGACACCATATATTTTAATAAGTATTACTATCATCCTCCGAACCATCCAAATTCT

2101 atagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg 2160
TATCAAAAACGACATGAAAGATATCACTTATCTCAATCCGTCCCTATAAGTGGTAATAGC

2161 tttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaa 2220
AAAGTCTGGGTGGAGGGTTGGGGCTCCCCTGGGCTGTCCGGGCTTCCTTATCTTCTTCTT

2221 ggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcga 2280
CCACCTCTCTCTCTGTCTCTGTCTAGGTAAGCTAATCACTTGCCTAGAGCTGCCATAGCT

2281 aagcttgggattcgaatttaaaagaaaaggggggattggggggtacagtgcaggggaaag 2340
TTCGAACCCTAAGCTTAAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTC

2341 aatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattacaaa 2400
TTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTGATGTTTTTGTTTAATGTTT

2401 aattcaaaattttcgggtttttcgaacctagcagacgtcggcagtgaaaaaaatgcttta 2460
TTAAGTTTTAAAAGCCCAAAAAGCTTGGATCGTCTGCAGCCGTCACTTTTTTTACGAAAT

2461 tttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaag 2520
AAACACTTTAAACACTACGATAACGAAATAAACATTGGTAATATTCGACGTTATTTGTTC

2521 ttaacaacaagaattgcattcattttatgtttcaggttcagggggaggtgtgggaggttt 2580
AATTGTTGTTCTTAACGTAAGTAAAATACAAAGTCCAAGTCCCCCTCCACACCCTCCAAA

XhoI
|
2581 tttaaagcaagtaaaacctctacaaatgtggtatggctgattatgatctcacctaggctc 2640
AAATTTCGTTCATTTTGGAGATGTTTACACCATACCGACTAATACTAGAGTGGATCCGAG

SmaI
|
BamHI XmaI
| | |
2641 gagggatcccccgggcgatctgacggttcactaaacgagctctgcttatataggcctccc 2700
CTCCCTAGGGGGCCCGCTAGACTGCCAAGTGATTTGCTCGAGACGAATATATCCGGAGGG

PGK Prom.(2723,3236)>>>
|
miniCMV Prom.(2722,2656)<<<
||
2701 accgtacacgccacctcgacataaattctaccgggtaggggaggcgcttttcccaaggca 2760
TGGCATGTGCGGTGGAGCTGTATTTAAGATGGCCCATCCCCTCCGCGAAAAGGGTTCCGT

2761 gtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctg 2820
CAGACCTCGTACGCGAAATCGTCGGGGCGACCCGTGAACCGCGATGTGTTCACCGGAGAC

2821 gcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggtggccc 2880
CGGAGCGTGTGTAAGGTGTAGGTGGCCATCCGCGGTTGGCCGAGGCAAGAAACCACCGGG

2881 cttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgc 2940
GAAGCGCGGTGGAAGATGAGGAGGGGATCAGTCCTTCAAGGGGGGGCGGGGCGTCGAGCG

2941 gtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacag 3000
CAGCACGTCCTGCACTGTTTACCTTCATCGTGCAGAGTGATCAGAGCACGTCTACCTGTC

3001 caccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctc 3060
GTGGCGACTCGTTACCTTCGCCCATCCGGAAACCCCGTCGCCGGTTATCGTCGAAACGAG

3061 cttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgg 3120
GAAGCGAAAGACCCGAGTCTCCGACCCTTCCCCACCCAGGCCCCCGCCCGAGTCCCCGCC

3121 gctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttca 3180
CGAGTCCCCGCCCCGCCCGCGGGCTTCCAGGAGGCCTCCGGGCCGTAAGACGTGCGAAGT

ClaI
|
3181 aaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacctatcg 3240
TTTCGCGTGCAGACGGCGCGACAAGAGGAGAAGGAGTAGAGGCCCGGAAAGCTGGATAGC

T2A Peptide(3266,3329)>>>
|
KpnI
|
3241 atcaattgagtacttacgtaggtaccggttctggtgagggcagaggaagtctgctaacat 3300
TAGTTAACTCATGAATGCATCCATGGCCAAGACCACTCCCGTCTCCTTCAGACGATTGTA

NotI
|
EcoRI EcoRV ApaI XbaI
| | | | |
3301 gcggtgacgtcgaggagaatcctggcccagaattcgatatcgggcccgcggccgcgtcta 3360
CGCCACTGCAGCTCCTCTTAGGACCGGGTCTTAAGCTATAGCCCGGGCGCCGGCGCAGAT

SV40 prom(3416,3684)>>>
|
3361 gatgagtcgagtacccatacgacgtcccagactacgcttgagtttaaacacgcgtggtgt 3420
CTACTCAGCTCATGGGTATGCTGCAGGGTCTGATGCGAACTCAAATTTGTGCGCACCACA

3421 ggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtca 3480
CCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTAGAGTTAATCAGT

3481 gcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcat 3540
CGTTGGTCCACACCTTTCAGGGGTCCGAGGGGTCGTCCGTCTTCATACGTTTCGTACGTA

SV40 origin(3583,3660)>>>
|
3541 ctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccg 3600
GAGTTAATCAGTCGTTGGTATCAGGGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGC

ORF_2 rf(2)(3650,4318)>>>
|
3601 cccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggcc 3660
GGGTCAAGGCGGGTAAGAGGCGGGGTACCGACTGATTAAAAAAAATAAATACGTCTCCGG

SfiI puro marker(3719,4318)>>>
| |
3661 gaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggccat 3720
CTCCGGCGGAGCCGGAGACTCGATAAGGTCTTCATCACTCCTCCGAAAAAACCTCCGGTA

3721 gaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccctcgggccgtacg 3780
CTGGCTCATGTTCGGGTGCCACGCGGAGCGGTGGGCGCTGCTGCAGGGAGCCCGGCATGC

3781 caccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtggacccggaccg 3840
GTGGGAGCGGCGGCGCAAGCGGCTGATGGGGCGGTGCGCGGTGTGGCACCTGGGCCTGGC

3841 ccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacat 3900
GGTGTAGCTCGCCCAGTGGCTCGACGTTCTTGAGAAGGAGTGCGCGCAGCCCGAGCTGTA

3901 cggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagag 3960
GCCGTTCCACACCCAGCGCCTGCTGCCGCGGCGCCACCGCCAGACCTGGTGCGGCCTCTC

3961 cgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttc 4020
GCAGCTTCGCCCCCGCCACAAGCGGCTCTAGCCGGGCGCGTACCGGCTCAACTCGCCAAG

4021 ccggctggccgcgcagcaacagatggaagggctcctggcgccgcaccggcccaaggagcc 4080
GGCCGACCGGCGCGTCGTTGTCTACCTTCCCGAGGACCGCGGCGTGGCCGGGTTCCTCGG

4081 cgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcag 4140
GCGCACCAAGGACCGGTGGCAGCCGCAGAGCGGGCTGGTGGTCCCGTTCCCAGACCCGTC

4141 cgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctgga 4200
GCGGCAGCACGAGGGGCCTCACCTCCGCCGGCTCGCGCGGCCCCACGGGCGGAAGGACCT

4201 gacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccga 4260
CTGGAGGCGCGGGGCGTTGGAGGGGAAGATGCTCGCCGAGCCGAAGTGGCAGTGGCGGCT

4261 cgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaac 4320
GCAGCTCCACGGGCTTCCTGGCGCGTGGACCACGTACTGGGCGTTCGGGCCACGGACTTG

4321 gcgttccggaaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaa 4380
CGCAAGGCCTTTAGTTGGAGACCTAATGTTTTAAACACTTTCTAACTGACCATAAGAATT

4381 ctatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctat 4440
GATACAACGAGGAAAATGCGATACACCTATGCGACGAAATTACGGAAACATAGTACGATA

4441 tgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctcttta 4500
ACGAAGGGCATACCGAAAGTAAAAGAGGAGGAACATATTTAGGACCAACGACAGAGAAAT

4501 tgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgc 4560
ACTCCTCAACACCGGGCAACAGTCCGTTGCACCGCACCACACGTGACACAAACGACTGCG

4561 aacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgcttt 4620
TTGGGGGTGACCAACCCCGTAACGGTGGTGGACAGTCGAGGAAAGGCCCTGAAAGCGAAA

4621 ccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacagg 4680
GGGGGAGGGATAACGGTGCCGCCTTGAGTAGCGGCGGACGGAACGGGCGACGACCTGTCC

4681 ggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttcc 4740
CCGAGCCGACAACCCGTGACTGTTAAGGCACCACAACAGCCCCTTCGACTGCAGGAAAGG

4741 atggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtccc 4800
TACCGACGAGCGGACACAACGGTGGACCTAAGACGCGCCCTGCAGGAAGACGATGCAGGG

4801 ttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctct 4860
AAGCCGGGAGTTAGGTCGCCTGGAAGGAAGGGCGCCGGACGACGGCCGAGACGCCGGAGA

4861 tccgcgtctcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcct 4920
AGGCGCAGAGCGGAAGCGGGAGTCTGCTCAGCCTAGAGGGAAACCCGGCGGAGGGGCGGA

delta_U3 other(4928,4980)>>>
|
4921 gtccggatggaagggctaattcactcccaacgaatacaagatctgctttttgcttgtact 4980
CAGGCCTACCTTCCCGATTAAGTGAGGGTTGCTTATGTTCTAGACGAAAAACGAACATGA

HIV-1_5_LTR other(4981,5161)>>>
|
4981 gggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaaccca 5040
CCCAGAGAGACCAATCTGGTCTAGACTCGGACCCTCGAGAGACCGATTGATCCCTTGGGT

5041 ctgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttg 5100
GACGAATTCGGAGTTATTTCGAACGGAACTCACGAAGTTCATCACACACGGGCAGACAAC

5101 tgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagc 5160
ACACTGAGACCATTGATCTCTAGGGAGTCTGGGAAAATCAGTCACACCTTTTAGAGATCG

5161 agtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatca 5220
TCATCATCAAGTACAGTAGAATAATAAGTCATAAATATTGAACGTTTCTTTACTTATAGT

5221 gagagtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatc 5280
CTCTCACTCTCCTTGAACAAATAACGTCGAATATTACCAATGTTTATTTCGTTATCGTAG

5281 acaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactc 5340
TGTTTAAAGTGTTTATTTCGTAAAAAAAGTGACGTAAGATCAACACCAAACAGGTTTGAG

5341 atcaatgtatcttatcatgtctggcatctatgtcgggtgcggagaaagaggtaatgaaat 5400
TAGTTACATAGAATAGTACAGACCGTAGATACAGCCCACGCCTCTTTCTCCATTACTTTA

5401 ggcattatgggtattatgggtctgcattaatgaatcggccaacgatcccggtgtgaaata 5460
CCGTAATACCCATAATACCCAGACGTAATTACTTAGCCGGTTGCTAGGGCCACACTTTAT

5461 ccgcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcact 5520
GGCGTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGA

5521 gactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggta 5580
CTGAGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCAT

5581 atacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccag 5640
TATGCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTC

pBR322 origin(5667,6286)<<<
|
5641 caaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccc 5700
GTTTTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGG

5701 cctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggacta 5760
GGACTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGAT

5761 taaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctg 5820
ATTTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGAC

5821 ccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagc 5880
GGCGAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCG

5881 tcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcac 5940
AGTGCGACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTG

5941 gaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaac 6000
CTTGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTG

6001 ccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcg 6060
GGCCATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGC

6061 aggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactaga 6120
TCCATACATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCT

6121 aggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggt 6180
TCCTGTCATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCA

6181 agctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcag 6240
TCGAGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTC

6241 cagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtct 6300
GTCTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGA

6301 gacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaagg 6360
CTGCGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCC

6361 atcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatat 6420
TAGAAGTGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATA

6421 gagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatc 6480
CTCATTTGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAG

6481 tgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgg 6540
ACAGATAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCC

6541 gagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggct 6600
CTCCCGAATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGA

6601 ccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgca 6660
GGTCTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGT

6661 actttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcg 6720
TGAAATAGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGC

6721 ccagttaatagtttgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgt 6780
GGTCAATTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCA

6781 agaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatct 6840
TCTTTCGGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGA

6841 ggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggc 6900
CCTGTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCG

NEOKAN prom(6939,6988)>>>
|
6901 gatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgc 6960
CTATCGATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCG

6961 cctctggtaaggttgggaagccctgcaaagtaaactggatggctttctcgccgccaagga 7020
GGAGACCATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCT

BclI ORF_3 rf(3)(7077,7871)>>>
| |
7021 tctgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatga 7080
AGACTACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACT

NTP_II marker(7080,7868)>>>
|
7081 ttgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggct 7140
AACTTGTTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGA

7141 atgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgc 7200
TACTGACCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCG

7201 aggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaag 7260
TCCCCGCGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTC

7261 acgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcg 7320
TGCTCCGTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGC

7321 acgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatc 7380
TGCAACAGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAG

7381 tcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggc 7440
AGGACAGTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCG

7441 ggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcg 7500
CCGACGTATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGC

7501 agcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagc 7560
TCGCTCGTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCG

7561 atcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcg 7620
TAGTCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGC

7621 aggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggcc 7680
TCCTAGAGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGG

7681 gcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatag 7740
CGAAAAGACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATC

7741 cgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcg 7800
GCAACCGATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGC

7801 tgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacg 7860
ACGAAATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGC

7861 agttcttctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggcc 7920
TCAAGAAGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGG

f1 origin(7976,8281)<<<
|
7921 gaaatcggcaacatcccttataaatcaaaagaatagaccgcgatagggttgagtgttgtt 7980
CTTTAGCCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAA

7981 ccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaa 8040
GGTCAAACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTT

8041 accgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcgg 8100
TGGCAGATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCC

8101 tcgaggtgccgtaaagctctaaatcggaaccctaaagggagcccccgatttagagcttga 8160
AGCTCCACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACT

8161 cggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgct 8220
GCCCCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGA

8221 agggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatg 8280
TCCCGCGACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTAC

8281 cgccgctacagggcgcgtccattcgccattcaggatcgaattaattcttaattaacatca 8340
GCGGCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGT

8341 tcaataatatacctt 8355
AGTTATTATATGGAA
                                    5'-LTR
Start: 486 End: 2177

PolyA tail
Start: 2628 End: 2434 (Complementary)

miniCMV promoter
Start: 2723 End: 2656 (Complementary)

PGK promoter
Start: 2724 End: 3236

T2A Peptide
Start: 3267 End: 3329

SV40
Start: 3416 End: 3718

Puro
Start: 3719 End: 4318

3'-LTR
Start: 5404 End: 4319 (Complementary)

Kanamycin/Neomycin
Start: 7077 End: 7868