pPB-His-GST
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepPB-His-GST
VectorTypeProtein Vector
Antibiotic InformationBacterial: Kanamycin.
Sequencing PrimersGST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'

T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


ORIGIN

1 TGGCGAATGG GACGCGCCCT GTAGCGGCGC ATTAAGCGCG GCGGGTGTGG
51 TGGTTACGCG CAGCGTGACC GCTACACTTG CCAGCGCCCT AGCGCCCGCT
101 CCTTTCGCTT TCTTCCCTTC CTTTCTCGCC ACGTTCGCCG GCTTTCCCCG
151 TCAAGCTCTA AATCGGGGGC TCCCTTTAGG GTTCCGATTT AGTGCTTTAC
201 GGCACCTCGA CCCCAAAAAA CTTGATTAGG GTGATGGTTC ACGTAGTGGG
251 CCATCGCCCT GATAGACGGT TTTTCGCCCT TTGACGTTGG AGTCCACGTT
301 CTTTAATAGT GGACTCTTGT TCCAAACTGG AACAACACTC AACCCTATCT
351 CGGTCTATTC TTTTGATTTA TAAGGGATTT TGCCGATTTC GGCCTATTGG
401 TTAAAAAATG AGCTGATTTA ACAAAAATTT AACGCGAATT TTAACAAAAT
451 ATTAACGTTT ACAATTTCAG GTGGCACTTT TCGGGGAAAT GTGCGCGGAA
501 CCCCTATTTG TTTATTTTTC TAAATACATT CAAATATGTA TCCGCTCATG
551 AATTAATTCT TAGAAAAACT CATCGAGCAT CAAATGAAAC TGCAATTTAT
601 TCATATCAGG ATTATCAATA CCATATTTTT GAAAAAGCCG TTTCTGTAAT
651 GAAGGAGAAA ACTCACCGAG GCAGTTCCAT AGGATGGCAA GATCCTGGTA
701 TCGGTCTGCG ATTCCGACTC GTCCAACATC AATACAACCT ATTAATTTCC
751 CCTCGTCAAA AATAAGGTTA TCAAGTGAGA AATCACCATG AGTGACGACT
801 GAATCCGGTG AGAATGGCAA AAGTTTATGC ATTTCTTTCC AGACTTGTTC
851 AACAGGCCAG CCATTACGCT CGTCATCAAA ATCACTCGCA TCAACCAAAC
901 CGTTATTCAT TCGTGATTGC GCCTGAGCGA GACGAAATAC GCGATCGCTG
951 TTAAAAGGAC AATTACAAAC AGGAATCGAA TGCAACCGGC GCAGGAACAC
1001 TGCCAGCGCA TCAACAATAT TTTCACCTGA ATCAGGATAT TCTTCTAATA
1051 CCTGGAATGC TGTTTTCCCG GGGATCGCAG TGGTGAGTAA CCATGCATCA
1101 TCAGGAGTAC GGATAAAATG CTTGATGGTC GGAAGAGGCA TAAATTCCGT
1151 CAGCCAGTTT AGTCTGACCA TCTCATCTGT AACATCATTG GCAACGCTAC
1201 CTTTGCCATG TTTCAGAAAC AACTCTGGCG CATCGGGCTT CCCATACAAT
1251 CGATAGATTG TCGCACCTGA TTGCCCGACA TTATCGCGAG CCCATTTATA
1301 CCCATATAAA TCAGCATCCA TGTTGGAATT TAATCGCGGC CTAGAGCAAG
1351 ACGTTTCCCG TTGAATATGG CTCATAACAC CCCTTGTATT ACTGTTTATG
1401 TAAGCAGACA GTTTTATTGT TCATGACCAA AATCCCTTAA CGTGAGTTTT
1451 CGTTCCACTG AGCGTCAGAC CCCGTAGAAA AGATCAAAGG ATCTTCTTGA
1501 GATCCTTTTT TTCTGCGCGT AATCTGCTGC TTGCAAACAA AAAAACCACC
1551 GCTACCAGCG GTGGTTTGTT TGCCGGATCA AGAGCTACCA ACTCTTTTTC
1601 CGAAGGTAAC TGGCTTCAGC AGAGCGCAGA TACCAAATAC TGTCCTTCTA
1651 GTGTAGCCGT AGTTAGGCCA CCACTTCAAG AACTCTGTAG CACCGCCTAC
1701 ATACCTCGCT CTGCTAATCC TGTTACCAGT GGCTGCTGCC AGTGGCGATA
1751 AGTCGTGTCT TACCGGGTTG GACTCAAGAC GATAGTTACC GGATAAGGCG
1801 CAGCGGTCGG GCTGAACGGG GGGTTCGTGC ACACAGCCCA GCTTGGAGCG
1851 AACGACCTAC ACCGAACTGA GATACCTACA GCGTGAGCTA TGAGAAAGCG
1901 CCACGCTTCC CGAAGGGAGA AAGGCGGACA GGTATCCGGT AAGCGGCAGG
1951 GTCGGAACAG GAGAGCGCAC GAGGGAGCTT CCAGGGGGAA ACGCCTGGTA
2001 TCTTTATAGT CCTGTCGGGT TTCGCCACCT CTGACTTGAG CGTCGATTTT
2051 TGTGATGCTC GTCAGGGGGG CGGAGCCTAT GGAAAAACGC CAGCAACGCG
2101 GCCTTTTTAC GGTTCCTGGC CTTTTGCTGG CCTTTTGCTC ACATGTTCTT
2151 TCCTGCGTTA TCCCCTGATT CTGTGGATAA CCGTATTACC GCCTTTGAGT
2201 GAGCTGATAC CGCTCGCCGC AGCCGAACGA CCGAGCGCAG CGAGTCAGTG
2251 AGCGAGGAAG CGGAAGAGCG CCTGATGCGG TATTTTCTCC TTACGCATCT
2301 GTGCGGTATT TCACACCGCA TATATGGTGC ACTCTCAGTA CAATCTGCTC
2351 TGATGCCGCA TAGTTAAGCC AGTATACACT CCGCTATCGC TACGTGACTG
2401 GGTCATGGCT GCGCCCCGAC ACCCGCCAAC ACCCGCTGAC GCGCCCTGAC
2451 GGGCTTGTCT GCTCCCGGCA TCCGCTTACA GACAAGCTGT GACCGTCTCC
2501 GGGAGCTGCA TGTGTCAGAG GTTTTCACCG TCATCACCGA AACGCGCGAG
2551 GCAGCTGCGG TAAAGCTCAT CAGCGTGGTC GTGAAGCGAT TCACAGATGT
2601 CTGCCTGTTC ATCCGCGTCC AGCTCGTTGA GTTTCTCCAG AAGCGTTAAT
2651 GTCTGGCTTC TGATAAAGCG GGCCATGTTA AGGGCGGTTT TTTCCTGTTT
2701 GGTCACTGAT GCCTCCGTGT AAGGGGGATT TCTGTTCATG GGGGTAATGA
2751 TACCGATGAA ACGAGAGAGG ATGCTCACGA TACGGGTTAC TGATGATGAA
2801 CATGCCCGGT TACTGGAACG TTGTGAGGGT AAACAACTGG CGGTATGGAT
2851 GCGGCGGGAC CAGAGAAAAA TCACTCAGGG TCAATGCCAG CGCTTCGTTA
2901 ATACAGATGT AGGTGTTCCA CAGGGTAGCC AGCAGCATCC TGCGATGCAG
2951 ATCCGGAACA TAATGGTGCA GGGCGCTGAC TTCCGCGTTT CCAGACTTTA
3001 CGAAACACGG AAACCGAAGA CCATTCATGT TGTTGCTCAG GTCGCAGACG
3051 TTTTGCAGCA GCAGTCGCTT CACGTTCGCT CGCGTATCGG TGATTCATTC
3101 TGCTAACCAG TAAGGCAACC CCGCCAGCCT AGCCGGGTCC TCAACGACAG
3151 GAGCACGATC ATGCGCACCC GTGGGGCCGC CATGCCGGCG ATAATGGCCT
3201 GCTTCTCGCC GAAACGTTTG GTGGCGGGAC CAGTGACGAA GGCTTGAGCG
3251 AGGGCGTGCA AGATTCCGAA TACCGCAAGC GACAGGCCGA TCATCGTCGC
3301 GCTCCAGCGA AAGCGGTCCT CGCCGAAAAT GACCCAGAGC GCTGCCGGCA
3351 CCTGTCCTAC GAGTTGCATG ATAAAGAAGA CAGTCATAAG TGCGGCGACG
3401 ATAGTCATGC CCCGCGCCCA CCGGAAGGAG CTGACTGGGT TGAAGGCTCT
3451 CAAGGGCATC GGTCGAGATC CCGGTGCCTA ATGAGTGAGC TAACTTACAT
3501 TAATTGCGTT GCGCTCACTG CCCGCTTTCC AGTCGGGAAA CCTGTCGTGC
3551 CAGCTGCATT AATGAATCGG CCAACGCGCG GGGAGAGGCG GTTTGCGTAT
3601 TGGGCGCCAG GGTGGTTTTT CTTTTCACCA GTGAGACGGG CAACAGCTGA
3651 TTGCCCTTCA CCGCCTGGCC CTGAGAGAGT TGCAGCAAGC GGTCCACGCT
3701 GGTTTGCCCC AGCAGGCGAA AATCCTGTTT GATGGTGGTT AACGGCGGGA
3751 TATAACATGA GCTGTCTTCG GTATCGTCGT ATCCCACTAC CGAGATATCC
3801 GCACCAACGC GCAGCCCGGA CTCGGTAATG GCGCGCATTG CGCCCAGCGC
3851 CATCTGATCG TTGGCAACCA GCATCGCAGT GGGAACGATG CCCTCATTCA
3901 GCATTTGCAT GGTTTGTTGA AAACCGGACA TGGCACTCCA GTCGCCTTCC
3951 CGTTCCGCTA TCGGCTGAAT TTGATTGCGA GTGAGATATT TATGCCAGCC
4001 AGCCAGACGC AGACGCGCCG AGACAGAACT TAATGGGCCC GCTAACAGCG
4051 CGATTTGCTG GTGACCCAAT GCGACCAGAT GCTCCACGCC CAGTCGCGTA
4101 CCGTCTTCAT GGGAGAAAAT AATACTGTTG ATGGGTGTCT GGTCAGAGAC
4151 ATCAAGAAAT AACGCCGGAA CATTAGTGCA GGCAGCTTCC ACAGCAATGG
4201 CATCCTGGTC ATCCAGCGGA TAGTTAATGA TCAGCCCACT GACGCGTTGC
4251 GCGAGAAGAT TGTGCACCGC CGCTTTACAG GCTTCGACGC CGCTTCGTTC
4301 TACCATCGAC ACCACCACGC TGGCACCCAG TTGATCGGCG CGAGATTTAA
4351 TCGCCGCGAC AATTTGCGAC GGCGCGTGCA GGGCCAGACT GGAGGTGGCA
4401 ACGCCAATCA GCAACGACTG TTTGCCCGCC AGTTGTTGTG CCACGCGGTT
4451 GGGAATGTAA TTCAGCTCCG CCATCGCCGC TTCCACTTTT TCCCGCGTTT
4501 TCGCAGAAAC GTGGCTGGCC TGGTTCACCA CGCGGGAAAC GGTCTGATAA
4551 GAGACACCGG CATACTCTGC GACATCGTAT AACGTTACTG GTTTCACATT
4601 CACCACCCTG AATTGACTCT CTTCCGGGCG CTATCATGCC ATACCGCGAA
4651 AGGTTTTGCG CCATTCGATG GTGTCCGGGA TCTCGACGCT CTCCCTTATG
4701 CGACTCCTGC ATTAGGAAGC AGCCCAGTAG TAGGTTGAGG CCGTTGAGCA
4751 CCGCCGCCGC AAGGAATGGT GCATGCAAGG AGATGGCGCC CAACAGTCCC
4801 CCGGCCACGG GGCCTGCCAC CATACCCACG CCGAAACAAG CGCTCATGAG
4851 CCCGAAGTGG CGAGCCCGAT CTTCCCCATC GGTGATGTCG GCGATATAGG
4901 CGCCAGCAAC CGCACCTGTG GCGCCGGTGA TGCCGGCCAC GATGCGTCCG
4951 GCGTAGAGGA TCGAGATCTC GATCCCGCGA AATTAATACG ACTCACTATA
5001 GGGGAATTGT GAGCGGATAA CAATTCCCCT CTAGAAATAA TTTTGTTTAA
5051 CTTTAAGAAG GAGATATACC ATGGGCAGCA GCCATCATCA TCATCATCAC
5101 GGTACCTCCC CTATACTAGG TTATTGGAAA ATTAAGGGCC TTGTGCAACC
5151 CACTCGACTT CTTTTGGAAT ATCTTGAAGA AAAATATGAA GAGCATTTGT
5201 ATGAGCGCGA TGAAGGTGAT AAATGGCGAA ACAAAAAGTT TGAATTGGGT
5251 TTGGAGTTTC CCAATCTTCC TTATTATATT GATGGTGATG TTAAATTAAC
5301 ACAGTCTATG GCCATCATAC GTTATATAGC TGACAAGCAC AACATGTTGG
5351 GTGGTTGTCC AAAAGAGCGT GCAGAGATTT CAATGCTTGA AGGAGCGGTT
5401 TTGGATATTA GATACGGTGT TTCGAGAATT GCATATAGTA AAGACTTTGA
5451 AACTCTCAAA GTTGATTTTC TTAGCAAGCT ACCTGAAATG CTGAAAATGT
5501 TCGAAGATCG TTTATGTCAT AAAACATATT TAAATGGTGA TCATGTAACC
5551 CATCCTGACT TCATGTTGTA TGACGCTCTT GATGTTGTTT TATACATGGA
5601 CCCAATGTGC CTGGATGCGT TCCCAAAATT AGTTTGTTTT AAAAAACGTA
5651 TTGAAGCTAT CCCACAAATT GATAAGTACT TGAAATCCAG CAAGTATATA
5701 GCATGGCCTT TGCAGGGCTG GCAAGCCACG TTTGGTGGTG GCGACCATCC
5751 TCCAAAATCG GATGGTAGCG GCTCTGGTTC TGGTAGCGGC TCTGAAAACC
5801 TTTACTTCCA GGGCACTGCT AGCTACATCA CAAGTTTGTA CAAAAAAGCT
5851 GAACGAGAAA CGTAAAATGA TATAAATATC AATATATTAA ATTAGATTTT
5901 GCATAAAAAA CAGACTACAT AATACTGTAA AACACAACAT ATCCAGTCAC
5951 TATGGCGGCC GCATTAGGCA CCCCAGGCTT TACACTTTAT GCTTCCGGCT
6001 CGTATAATGT GTGGATTTTG AGTTAGGATC CGTCGAGATT TTCAGGAGCT
6051 AAGGAAGCTA AAATGGAGAA AAAAATCACT GGATATACCA CCGTTGATAT
6101 ATCCCAATGG CATCGTAAAG AACATTTTGA GGCATTTCAG TCAGTTGCTC
6151 AATGTACCTA TAACCAGACC GTTCAGCTGG ATATTACGGC CTTTTTAAAG
6201 ACCGTAAAGA AAAATAAGCA CAAGTTTTAT CCGGCCTTTA TTCACATTCT
6251 TGCCCGCCTG ATGAATGCTC ATCCGGAATT CCGTATGGCA ATGAAAGACG
6301 GTGAGCTGGT GATATGGGAT AGTGTTCACC CTTGTTACAC CGTTTTCCAT
6351 GAGCAAACTG AAACGTTTTC ATCGCTCTGG AGTGAATACC ACGACGATTT
6401 CCGGCAGTTT CTACACATAT ATTCGCAAGA TGTGGCGTGT TACGGTGAAA
6451 ACCTGGCCTA TTTCCCTAAA GGGTTTATTG AGAATATGTT TTTCGTCTCA
6501 GCCAATCCCT GGGTGAGTTT CACCAGTTTT GATTTAAACG TGGCCAATAT
6551 GGACAACTTC TTCGCCCCCG TTTTCACCAT GGGCAAATAT TATACGCAAG
6601 GCGACAAGGT GCTGATGCCG CTGGCGATTC AGGTTCATCA TGCCGTTTGT
6651 GATGGCTTCC ATGTCGGCAG AATGCTTAAT GAATTACAAC AGTACTGCGA
6701 TGAGTGGCAG GGCGGGGCGT AAAGATCTGG ATCCGGCTTA CTAAAAGCCA
6751 GATAACAGTA TGCGTATTTG CGCGCTGATT TTTGCGGTAT AAGAATATAT
6801 ACTGATATGT ATACCCGAAG TATGTCAAAA AGAGGTATGC TATGAAGCAG
6851 CGTATTACAG TGACAGTTGA CAGCGACAGC TATCAGTTGC TCAAGGCATA
6901 TATGATGTCA ATATCTCCGG TCTGGTAAGC ACAACCATGC AGAATGAAGC
6951 CCGTCGTCTG CGTGCCGAAC GCTGGAAAGC GGAAAATCAG GAAGGGATGG
7001 CTGAGGTCGC CCGGTTTATT GAAATGAACG GCTCTTTTGC TGACGAGAAC
7051 AGGGGCTGGT GAAATGCAGT TTAAGGTTTA CACCTATAAA AGAGAGAGCC
7101 GTTATCGTCT GTTTGTGGAT GTACAGAGTG ATATTATTGA CACGCCCGGG
7151 CGACGGATGG TGATCCCCCT GGCCAGTGCA CGTCTGCTGT CAGATAAAGT
7201 CTCCCGTGAA CTTTACCCGG TGGTGCATAT CGGGGATGAA AGCTGGCGCA
7251 TGATGACCAC CGATATGGCC AGTGTGCCGG TCTCCGTTAT CGGGGAAGAA
7301 GTGGCTGATC TCAGCCACCG CGAAAATGAC ATCAAAAACG CCATTAACCT
7351 GATGTTCTGG GGAATATAAA TGTCAGGCTC CCTTATACAC AGCCAGTCTG
7401 CAGGTCGACC ATAGTGACTG GATATGTTGT GTTTTACAGT ATTATGTAGT
7451 CTGTTTTTTA TGCAAAATCT AATTTAATAT ATTGATATTT ATATCATTTT
7501 ACGTTTCTCG TTCAGCTTTC TTGTACAAAG TGGTTGATAT CTGACTCGAG
7551 CACCACCACC ACCACCACTG AGATCCGGCT GCTAACAAAG CCCGAAAGGA
7601 AGCTGAGTTG GCTGCTGCCA CCGCTGAGCA ATAACTAGCA TAACCCCTTG
7651 GGGCCTCTAA ACGGGTCTTG AGGGGTTTTT TGCTGAAAGG AGGAACTATA
7701 TCCGGAT
//
                                    LOCUS       dna                      7708 bp                                   
FEATURES Location/Qualifiers
Rep_Origin 29..335
/gene="f1 origin"
Marker 560..1375
/gene="kan2 marker"
ORF 560..1375
/sequence="ORF_4 rf(4)"
misc_binding 1249..1254
/dbxref="REBASE:ClaI"
misc_binding 1284..1289
/dbxref="REBASE:NruI"
Rep_Origin 1481..2100
/gene="pBR322 origin"
Other Gene 2515..2706
/gene="ROP other"
misc_binding 3179..3189
/dbxref="REBASE:BglI"
Regulatory_Seq 3515..4606
/gene="lacI reg"
ORF 3515..4474
/sequence="ORF_3 rf(4)"
misc_binding 3738..3743
/dbxref="REBASE:HpaI"
misc_binding 4035..4040
/dbxref="REBASE:ApaI"
misc_binding 4771..4776
/dbxref="REBASE:SphI"
Promoter 4984..5002
/gene="T7 prom"
Regulatory_Seq 5002..5029
/gene="lacO reg"
misc_binding 5030..5035
/dbxref="REBASE:XbaI"
ORF 5071..5853
/sequence="ORF_1 rf(1)"
misc_binding 5101..5106
/dbxref="REBASE:KpnI"
Other Gene 5831..5955
/gene="attR1 other"
Other Gene 5855..5955
/gene="attR2 other"
misc_binding 5956..5963
/dbxref="REBASE:NotI"
Marker 6064..6723
/gene="CAT marker"
ORF 6064..6723
/sequence="ORF_2 rf(1)"
misc_binding 6277..6282
/dbxref="REBASE:EcoRI"
Other Gene 7065..7370
/gene="ccdB other"
misc_binding 7399..7404
/dbxref="REBASE:PstI"
Other Gene 7411..7530
/gene="attR1 other"
Other Gene 7411..7511
/gene="attR2 other"
misc_binding 7546..7551
/dbxref="REBASE:XhoI"
Terminator 7580..7708
/gene="T7 term"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
                                  f1 origin(29,335)>>> 
|
1 tggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcg 60
ACCGCTTACCCTGCGCGGGACATCGCCGCGTAATTCGCGCCGCCCACACCACCAATGCGC

61 cagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttc 120
GTCGCACTGGCGATGTGAACGGTCGCGGGATCGCGGGCGAGGAAAGCGAAAGAAGGGAAG

121 ctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagg 180
GAAAGAGCGGTGCAAGCGGCCGAAAGGGGCAGTTCGAGATTTAGCCCCCGAGGGAAATCC

181 gttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttc 240
CAAGGCTAAATCACGAAATGCCGTGGAGCTGGGGTTTTTTGAACTAATCCCACTACCAAG

241 acgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgtt 300
TGCATCACCCGGTAGCGGGACTATCTGCCAAAAAGCGGGAAACTGCAACCTCAGGTGCAA

301 ctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattc 360
GAAATTATCACCTGAGAACAAGGTTTGACCTTGTTGTGAGTTGGGATAGAGCCAGATAAG

361 ttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgattta 420
AAAACTAAATATTCCCTAAAACGGCTAAAGCCGGATAACCAATTTTTTACTCGACTAAAT

421 acaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcaggtggcacttt 480
TGTTTTTAAATTGCGCTTAAAATTGTTTTATAATTGCAAATGTTAAAGTCCACCGTGAAA

481 tcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgta 540
AGCCCCTTTACACGCGCCTTGGGGATAAACAAATAAAAAGATTTATGTAAGTTTATACAT

ORF_4 rf(4)(560,1375)<<<
|
kan2 marker(560,1375)<<<
|
541 tccgctcatgaattaattcttagaaaaactcatcgagcatcaaatgaaactgcaatttat 600
AGGCGAGTACTTAATTAAGAATCTTTTTGAGTAGCTCGTAGTTTACTTTGACGTTAAATA

601 tcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaa 660
AGTATAGTCCTAATAGTTATGGTATAAAAACTTTTTCGGCAAAGACATTACTTCCTCTTT

661 actcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgattccgactc 720
TGAGTGGCTCCGTCAAGGTATCCTACCGTTCTAGGACCATAGCCAGACGCTAAGGCTGAG

721 gtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtgaga 780
CAGGTTGTAGTTATGTTGGATAATTAAAGGGGAGCAGTTTTTATTCCAATAGTTCACTCT

781 aatcaccatgagtgacgactgaatccggtgagaatggcaaaagtttatgcatttctttcc 840
TTAGTGGTACTCACTGCTGACTTAGGCCACTCTTACCGTTTTCAAATACGTAAAGAAAGG

841 agacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaac 900
TCTGAACAAGTTGTCCGGTCGGTAATGCGAGCAGTAGTTTTAGTGAGCGTAGTTGGTTTG

901 cgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggac 960
GCAATAAGTAAGCACTAACGCGGACTCGCTCTGCTTTATGCGCTAGCGACAATTTTCCTG

961 aattacaaacaggaatcgaatgcaaccggcgcaggaacactgccagcgcatcaacaatat 1020
TTAATGTTTGTCCTTAGCTTACGTTGGCCGCGTCCTTGTGACGGTCGCGTAGTTGTTATA

1021 tttcacctgaatcaggatattcttctaatacctggaatgctgttttcccggggatcgcag 1080
AAAGTGGACTTAGTCCTATAAGAAGATTATGGACCTTACGACAAAAGGGCCCCTAGCGTC

1081 tggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggca 1140
ACCACTCATTGGTACGTAGTAGTCCTCATGCCTATTTTACGAACTACCAGCCTTCTCCGT

1141 taaattccgtcagccagtttagtctgaccatctcatctgtaacatcattggcaacgctac 1200
ATTTAAGGCAGTCGGTCAAATCAGACTGGTAGAGTAGACATTGTAGTAACCGTTGCGATG

ClaI
|
1201 ctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaatcgatagattg 1260
GAAACGGTACAAAGTCTTTGTTGAGACCGCGTAGCCCGAAGGGTATGTTAGCTATCTAAC

NruI
|
1261 tcgcacctgattgcccgacattatcgcgagcccatttatacccatataaatcagcatcca 1320
AGCGTGGACTAACGGGCTGTAATAGCGCTCGGGTAAATATGGGTATATTTAGTCGTAGGT

1321 tgttggaatttaatcgcggcctagagcaagacgtttcccgttgaatatggctcataacac 1380
ACAACCTTAAATTAGCGCCGGATCTCGTTCTGCAAAGGGCAACTTATACCGAGTATTGTG

1381 cccttgtattactgtttatgtaagcagacagttttattgttcatgaccaaaatcccttaa 1440
GGGAACATAATGACAAATACATTCGTCTGTCAAAATAACAAGTACTGGTTTTAGGGAATT

pBR322 origin(1481,2100)>>>
|
1441 cgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttga 1500
GCACTCAAAAGCAAGGTGACTCGCAGTCTGGGGCATCTTTTCTAGTTTCCTAGAAGAACT

1501 gatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcg 1560
CTAGGAAAAAAAGACGCGCATTAGACGACGAACGTTTGTTTTTTTGGTGGCGATGGTCGC

1561 gtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagc 1620
CACCAAACAAACGGCCTAGTTCTCGATGGTTGAGAAAAAGGCTTCCATTGACCGAAGTCG

1621 agagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaag 1680
TCTCGCGTCTATGGTTTATGACAGGAAGATCACATCGGCATCAATCCGGTGGTGAAGTTC

1681 aactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcc 1740
TTGAGACATCGTGGCGGATGTATGGAGCGAGACGATTAGGACAATGGTCACCGACGACGG

1741 agtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcg 1800
TCACCGCTATTCAGCACAGAATGGCCCAACCTGAGTTCTGCTATCAATGGCCTATTCCGC

1801 cagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctac 1860
GTCGCCAGCCCGACTTGCCCCCCAAGCACGTGTGTCGGGTCGAACCTCGCTTGCTGGATG

1861 accgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggaga 1920
TGGCTTGACTCTATGGATGTCGCACTCGATACTCTTTCGCGGTGCGAAGGGCTTCCCTCT

1921 aaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagctt 1980
TTCCGCCTGTCCATAGGCCATTCGCCGTCCCAGCCTTGTCCTCTCGCGTGCTCCCTCGAA

1981 ccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgag 2040
GGTCCCCCTTTGCGGACCATAGAAATATCAGGACAGCCCAAAGCGGTGGAGACTGAACTC

2041 cgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcg 2100
GCAGCTAAAAACACTACGAGCAGTCCCCCCGCCTCGGATACCTTTTTGCGGTCGTTGCGC

2101 gcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgtta 2160
CGGAAAAATGCCAAGGACCGGAAAACGACCGGAAAACGAGTGTACAAGAAAGGACGCAAT

2161 tcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgc 2220
AGGGGACTAAGACACCTATTGGCATAATGGCGGAAACTCACTCGACTATGGCGAGCGGCG

2221 agccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcgg 2280
TCGGCTTGCTGGCTCGCGTCGCTCAGTCACTCGCTCCTTCGCCTTCTCGCGGACTACGCC

2281 tattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagta 2340
ATAAAAGAGGAATGCGTAGACACGCCATAAAGTGTGGCGTATATACCACGTGAGAGTCAT

2341 caatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactg 2400
GTTAGACGAGACTACGGCGTATCAATTCGGTCATATGTGAGGCGATAGCGATGCACTGAC

2401 ggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtct 2460
CCAGTACCGACGCGGGGCTGTGGGCGGTTGTGGGCGACTGCGCGGGACTGCCCGAACAGA

ROP other(2515,2706)<<<
|
2461 gctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagag 2520
CGAGGGCCGTAGGCGAATGTCTGTTCGACACTGGCAGAGGCCCTCGACGTACACAGTCTC

2521 gttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtc 2580
CAAAAGTGGCAGTAGTGGCTTTGCGCGCTCCGTCGACGCCATTTCGAGTAGTCGCACCAG

2581 gtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccag 2640
CACTTCGCTAAGTGTCTACAGACGGACAAGTAGGCGCAGGTCGAGCAACTCAAAGAGGTC

2641 aagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgttt 2700
TTCGCAATTACAGACCGAAGACTATTTCGCCCGGTACAATTCCCGCCAAAAAAGGACAAA

2701 ggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaa 2760
CCAGTGACTACGGAGGCACATTCCCCCTAAAGACAAGTACCCCCATTACTATGGCTACTT

2761 acgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacg 2820
TGCTCTCTCCTACGAGTGCTATGCCCAATGACTACTACTTGTACGGGCCAATGACCTTGC

2821 ttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcaggg 2880
AACACTCCCATTTGTTGACCGCCATACCTACGCCGCCCTGGTCTCTTTTTAGTGAGTCCC

2881 tcaatgccagcgcttcgttaatacagatgtaggtgttccacagggtagccagcagcatcc 2940
AGTTACGGTCGCGAAGCAATTATGTCTACATCCACAAGGTGTCCCATCGGTCGTCGTAGG

2941 tgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagacttta 3000
ACGCTACGTCTAGGCCTTGTATTACCACGTCCCGCGACTGAAGGCGCAAAGGTCTGAAAT

3001 cgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagca 3060
GCTTTGTGCCTTTGGCTTCTGGTAAGTACAACAACGAGTCCAGCGTCTGCAAAACGTCGT

3061 gcagtcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaacc 3120
CGTCAGCGAAGTGCAAGCGAGCGCATAGCCACTAAGTAAGACGATTGGTCATTCCGTTGG

3121 ccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggggccgc 3180
GGCGGTCGGATCGGCCCAGGAGTTGCTGTCCTCGTGCTAGTACGCGTGGGCACCCCGGCG

BglI
|
3181 catgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaa 3240
GTACGGCCGCTATTACCGGACGAAGAGCGGCTTTGCAAACCACCGCCCTGGTCACTGCTT

3241 ggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgc 3300
CCGAACTCGCTCCCGCACGTTCTAAGGCTTATGGCGTTCGCTGTCCGGCTAGTAGCAGCG

3301 gctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctac 3360
CGAGGTCGCTTTCGCCAGGAGCGGCTTTTACTGGGTCTCGCGACGGCCGTGGACAGGATG

3361 gagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgccca 3420
CTCAACGTACTATTTCTTCTGTCAGTATTCACGCCGCTGCTATCAGTACGGGGCGCGGGT

3421 ccggaaggagctgactgggttgaaggctctcaagggcatcggtcgagatcccggtgccta 3480
GGCCTTCCTCGACTGACCCAACTTCCGAGAGTTCCCGTAGCCAGCTCTAGGGCCACGGAT

lacI reg(3515,4606)<<<
|
ORF_3 rf(4)(3515,4474)<<<
|
3481 atgagtgagctaacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaa 3540
TACTCACTCGATTGAATGTAATTAACGCAACGCGAGTGACGGGCGAAAGGTCAGCCCTTT

3541 cctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtat 3600
GGACAGCACGGTCGACGTAATTACTTAGCCGGTTGCGCGCCCCTCTCCGCCAAACGCATA

3601 tgggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttca 3660
ACCCGCGGTCCCACCAAAAAGAAAAGTGGTCACTCTGCCCGTTGTCGACTAACGGGAAGT

3661 ccgcctggccctgagagagttgcagcaagcggtccacgctggtttgccccagcaggcgaa 3720
GGCGGACCGGGACTCTCTCAACGTCGTTCGCCAGGTGCGACCAAACGGGGTCGTCCGCTT

HpaI
|
3721 aatcctgtttgatggtggttaacggcgggatataacatgagctgtcttcggtatcgtcgt 3780
TTAGGACAAACTACCACCAATTGCCGCCCTATATTGTACTCGACAGAAGCCATAGCAGCA

3781 atcccactaccgagatatccgcaccaacgcgcagcccggactcggtaatggcgcgcattg 3840
TAGGGTGATGGCTCTATAGGCGTGGTTGCGCGTCGGGCCTGAGCCATTACCGCGCGTAAC

3841 cgcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgccctcattca 3900
GCGGGTCGCGGTAGACTAGCAACCGTTGGTCGTAGCGTCACCCTTGCTACGGGAGTAAGT

3901 gcatttgcatggtttgttgaaaaccggacatggcactccagtcgccttcccgttccgcta 3960
CGTAAACGTACCAAACAACTTTTGGCCTGTACCGTGAGGTCAGCGGAAGGGCAAGGCGAT

3961 tcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgccg 4020
AGCCGACTTAAACTAACGCTCACTCTATAAATACGGTCGGTCGGTCTGCGTCTGCGCGGC

ApaI
|
4021 agacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagat 4080
TCTGTCTTGAATTACCCGGGCGATTGTCGCGCTAAACGACCACTGGGTTACGCTGGTCTA

4081 gctccacgcccagtcgcgtaccgtcttcatgggagaaaataatactgttgatgggtgtct 4140
CGAGGTGCGGGTCAGCGCATGGCAGAAGTACCCTCTTTTATTATGACAACTACCCACAGA

4141 ggtcagagacatcaagaaataacgccggaacattagtgcaggcagcttccacagcaatgg 4200
CCAGTCTCTGTAGTTCTTTATTGCGGCCTTGTAATCACGTCCGTCGAAGGTGTCGTTACC

4201 catcctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagat 4260
GTAGGACCAGTAGGTCGCCTATCAATTACTAGTCGGGTGACTGCGCAACGCGCTCTTCTA

4261 tgtgcaccgccgctttacaggcttcgacgccgcttcgttctaccatcgacaccaccacgc 4320
ACACGTGGCGGCGAAATGTCCGAAGCTGCGGCGAAGCAAGATGGTAGCTGTGGTGGTGCG

4321 tggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgca 4380
ACCGTGGGTCAACTAGCCGCGCTCTAAATTAGCGGCGCTGTTAAACGCTGCCGCGCACGT

4381 gggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgccagttgttgtg 4440
CCCGGTCTGACCTCCACCGTTGCGGTTAGTCGTTGCTGACAAACGGGCGGTCAACAACAC

4441 ccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccgcgttt 4500
GGTGCGCCAACCCTTACATTAAGTCGAGGCGGTAGCGGCGAAGGTGAAAAAGGGCGCAAA

4501 tcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccgg 4560
AGCGTCTTTGCACCGACCGGACCAAGTGGTGCGCCCTTTGCCAGACTATTCTCTGTGGCC

4561 catactctgcgacatcgtataacgttactggtttcacattcaccaccctgaattgactct 4620
GTATGAGACGCTGTAGCATATTGCAATGACCAAAGTGTAAGTGGTGGGACTTAACTGAGA

4621 cttccgggcgctatcatgccataccgcgaaaggttttgcgccattcgatggtgtccggga 4680
GAAGGCCCGCGATAGTACGGTATGGCGCTTTCCAAAACGCGGTAAGCTACCACAGGCCCT

4681 tctcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgagg 4740
AGAGCTGCGAGAGGGAATACGCTGAGGACGTAATCCTTCGTCGGGTCATCATCCAACTCC

SphI
|
4741 ccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtccc 4800
GGCAACTCGTGGCGGCGGCGTTCCTTACCACGTACGTTCCTCTACCGCGGGTTGTCAGGG

4801 ccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtgg 4860
GGCCGGTGCCCCGGACGGTGGTATGGGTGCGGCTTTGTTCGCGAGTACTCGGGCTTCACC

4861 cgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtg 4920
GCTCGGGCTAGAAGGGGTAGCCACTACAGCCGCTATATCCGCGGTCGTTGGCGTGGACAC

4921 gcgccggtgatgccggccacgatgcgtccggcgtagaggatcgagatctcgatcccgcga 4980
CGCGGCCACTACGGCCGGTGCTACGCAGGCCGCATCTCCTAGCTCTAGAGCTAGGGCGCT

lacO reg(5002,5029)>>>
|
T7 prom(4984,5002)>>> XbaI
| | |
4981 aattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataa 5040
TTAATTATGCTGAGTGATATCCCCTTAACACTCGCCTATTGTTAAGGGGAGATCTTTATT

ORF_1 rf(1)(5071,5853)>>>
|
5041 ttttgtttaactttaagaaggagatataccatgggcagcagccatcatcatcatcatcac 5100
AAAACAAATTGAAATTCTTCCTCTATATGGTACCCGTCGTCGGTAGTAGTAGTAGTAGTG

KpnI
|
5101 ggtacctcccctatactaggttattggaaaattaagggccttgtgcaacccactcgactt 5160
CCATGGAGGGGATATGATCCAATAACCTTTTAATTCCCGGAACACGTTGGGTGAGCTGAA

5161 cttttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgat 5220
GAAAACCTTATAGAACTTCTTTTTATACTTCTCGTAAACATACTCGCGCTACTTCCACTA

5221 aaatggcgaaacaaaaagtttgaattgggtttggagtttcccaatcttccttattatatt 5280
TTTACCGCTTTGTTTTTCAAACTTAACCCAAACCTCAAAGGGTTAGAAGGAATAATATAA

5281 gatggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcac 5340
CTACCACTACAATTTAATTGTGTCAGATACCGGTAGTATGCAATATATCGACTGTTCGTG

5341 aacatgttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagcggtt 5400
TTGTACAACCCACCAACAGGTTTTCTCGCACGTCTCTAAAGTTACGAACTTCCTCGCCAA

5401 ttggatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaa 5460
AACCTATAATCTATGCCACAAAGCTCTTAACGTATATCATTTCTGAAACTTTGAGAGTTT

5461 gttgattttcttagcaagctacctgaaatgctgaaaatgttcgaagatcgtttatgtcat 5520
CAACTAAAAGAATCGTTCGATGGACTTTACGACTTTTACAAGCTTCTAGCAAATACAGTA

5521 aaaacatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctctt 5580
TTTTGTATAAATTTACCACTAGTACATTGGGTAGGACTGAAGTACAACATACTGCGAGAA

5581 gatgttgttttatacatggacccaatgtgcctggatgcgttcccaaaattagtttgtttt 5640
CTACAACAAAATATGTACCTGGGTTACACGGACCTACGCAAGGGTTTTAATCAAACAAAA

5641 aaaaaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatata 5700
TTTTTTGCATAACTTCGATAGGGTGTTTAACTATTCATGAACTTTAGGTCGTTCATATAT

5701 gcatggcctttgcagggctggcaagccacgtttggtggtggcgaccatcctccaaaatcg 5760
CGTACCGGAAACGTCCCGACCGTTCGGTGCAAACCACCACCGCTGGTAGGAGGTTTTAGC

5761 gatggtagcggctctggttctggtagcggctctgaaaacctttacttccagggcactgct 5820
CTACCATCGCCGAGACCAAGACCATCGCCGAGACTTTTGGAAATGAAGGTCCCGTGACGA

attR2 other(5855,5955)<<<
|
attR1 other(5831,5955)>>>
| |
5821 agcgatatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatat 5880
TCGCTATAGTTGTTCAAACATGTTTTTTCGACTTGCTCTTTGCATTTTACTATATTTATA

5881 caatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaaca 5940
GTTATATAATTTAATCTAAAACGTATTTTTTGTCTGATGTATTATGACATTTTGTGTTGT

NotI
|
5941 tatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggc 6000
ATAGGTCAGTGATACCGCCGGCGTAATCCGTGGGGTCCGAAATGTGAAATACGAAGGCCG

6001 tcgtataatgtgtggattttgagttaggatccgtcgagattttcaggagctaaggaagct 6060
AGCATATTACACACCTAAAACTCAATCCTAGGCAGCTCTAAAAGTCCTCGATTCCTTCGA

ORF_2 rf(1)(6064,6723)>>>
|
CAT marker(6064,6723)>>>
|
6061 aaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaa 6120
TTTTACCTCTTTTTTTAGTGACCTATATGGTGGCAACTATATAGGGTTACCGTAGCATTT

6121 gaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctg 6180
CTTGTAAAACTCCGTAAAGTCAGTCAACGAGTTACATGGATATTGGTCTGGCAAGTCGAC

6181 gatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggccttt 6240
CTATAATGCCGGAAAAATTTCTGGCATTTCTTTTTATTCGTGTTCAAAATAGGCCGGAAA

EcoRI
|
6241 attcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagac 6300
TAAGTGTAAGAACGGGCGGACTACTTACGAGTAGGCCTTAAGGCATACCGTTACTTTCTG

6301 ggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaact 6360
CCACTCGACCACTATACCCTATCACAAGTGGGAACAATGTGGCAAAAGGTACTCGTTTGA

6361 gaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacata 6420
CTTTGCAAAAGTAGCGAGACCTCACTTATGGTGCTGCTAAAGGCCGTCAAAGATGTGTAT

6421 tattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttatt 6480
ATAAGCGTTCTACACCGCACAATGCCACTTTTGGACCGGATAAAGGGATTTCCCAAATAA

6481 gagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaac 6540
CTCTTATACAAAAAGCAGAGTCGGTTAGGGACCCACTCAAAGTGGTCAAAACTAAATTTG

6541 gtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaa 6600
CACCGGTTATACCTGTTGAAGAAGCGGGGGCAAAAGTGGTACCCGTTTATAATATGCGTT

6601 ggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttc 6660
CCGCTGTTCCACGACTACGGCGACCGCTAAGTCCAAGTAGTACGGCAAACACTACCGAAG

6661 catgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcg 6720
GTACAGCCGTCTTACGAATTACTTAATGTTGTCATGACGCTACTCACCGTCCCGCCCCGC

6721 taaagatctggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgat 6780
ATTTCTAGACCTAGGCCGAATGATTTTCGGTCTATTGTCATACGCATAAACGCGCGACTA

6781 ttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatg 6840
AAAACGCCATATTCTTATATATGACTATACATATGGGCTTCATACAGTTTTTCTCCATAC

6841 ctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcat 6900
GATACTTCGTCGCATAATGTCACTGTCAACTGTCGCTGTCGATAGTCAACGAGTTCCGTA

6901 atatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtct 6960
TATACTACAGTTATAGAGGCCAGACCATTCGTGTTGGTACGTCTTACTTCGGGCAGCAGA

6961 gcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttat 7020
CGCACGGCTTGCGACCTTTCGCCTTTTAGTCCTTCCCTACCGACTCCAGCGGGCCAAATA

ccdB other(7065,7370)>>>
|
7021 tgaaatgaacggctcttttgctgacgagaacaggggctggtgaaatgcagtttaaggttt 7080
ACTTTACTTGCCGAGAAAACGACTGCTCTTGTCCCCGACCACTTTACGTCAAATTCCAAA

7081 acacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattg 7140
TGTGGATATTTTCTCTCTCGGCAATAGCAGACAAACACCTACATGTCTCACTATAATAAC

7141 acacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaag 7200
TGTGCGGGCCCGCTGCCTACCACTAGGGGGACCGGTCACGTGCAGACGACAGTCTATTTC

7201 tctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgacca 7260
AGAGGGCACTTGAAATGGGCCACCACGTATAGCCCCTACTTTCGACCGCGTACTACTGGT

7261 ccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccacc 7320
GGCTATACCGGTCACACGGCCAGAGGCAATAGCCCCTTCTTCACCGACTAGAGTCGGTGG

7321 gcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggct 7380
CGCTTTTACTGTAGTTTTTGCGGTAATTGGACTACAAGACCCCTTATATTTACAGTCCGA

attR2 other(7411,7511)>>>
|
PstI attR1 other(7411,7530)<<<
| |
7381 cccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacag 7440
GGGAATATGTGTCGGTCAGACGTCCAGCTGGTATCACTGACCTATACAACACAAAATGTC

7441 tattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattt 7500
ATAATACATCAGACAAAAAATACGTTTTAGATTAAATTATATAACTATAAATATAGTAAA

XhoI
|
7501 tacgtttctcgttcagctttcttgtacaaagtggttgatatctgactcgagcaccaccac 7560
ATGCAAAGAGCAAGTCGAAAGAACATGTTTCACCAACTATAGACTGAGCTCGTGGTGGTG

T7 term(7580,7708)>>>
|
7561 caccaccactgagatccggctgctaacaaagcccgaaaggaagctgagttggctgctgcc 7620
GTGGTGGTGACTCTAGGCCGACGATTGTTTCGGGCTTTCCTTCGACTCAACCGACGACGG

7621 accgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggtttt 7680
TGGCGACTCGTTATTGATCGTATTGGGGAACCCCGGAGATTTGCCCAGAACTCCCCAAAA

7681 ttgctgaaaggaggaactatatccggat 7708
AACGACTTTCCTCCTTGATATAGGCCTA