pPM-C-HA
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepPM-C-HA
VectorTypeProtein Vector
Antibiotic InformationKanamycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
Additional InformationOriginal Vector: 6470bp
Vector without Insert Cassette: 4765bp
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
       61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa     
      121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg     
      181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt     
      241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg     
      301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag     
      361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg     
      421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta     
      481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc     
      541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta     
      601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcatgaagaa     
      661 tctgcttagg gttaggcgtt ttgcgctgct tcgcgatgta cgggccagat atacgcgttg     
      721 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc     
      781 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa     
      841 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac     
      901 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca     
      961 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg     
     1021 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt     
     1081 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg     
     1141 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg     
     1201 gaaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat     
     1261 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctcccta tcagtgatag     
     1321 agatctccct atcagtgata gagatcgtcg acgagctcgt ttagtgaacc gtcagatcgc     
     1381 ctggagacgc catccacgct gttttgacct ccatagaagc tagcgatatc aacaagtttg     
     1441 tacaaaaaag ctgaacgaga aacgtaaaat gatataaata tcaatatatt aaattagatt     
     1501 ttgcataaaa aacagactac ataatactgt aaaacacaac atatccagtc actatggcgg     
     1561 ccgcattagg caccccaggc tttacacttt atgcttccgg ctcgtataat gtgtggattt     
     1621 tgagttagga tccgtcgaga ttttcaggag ctaaggaagc taaaatggag aaaaaaatca     
     1681 ctggatatac caccgttgat atatcccaat ggcatcgtaa agaacatttt gaggcatttc     
     1741 agtcagttgc tcaatgtacc tataaccaga ccgttcagct ggatattacg gcctttttaa     
     1801 agaccgtaaa gaaaaataag cacaagtttt atccggcctt tattcacatt cttgcccgcc     
     1861 tgatgaatgc tcatccggaa ttccgtatgg caatgaaaga cggtgagctg gtgatatggg     
     1921 atagtgttca cccttgttac accgttttcc atgagcaaac tgaaacgttt tcatcgctct     
     1981 ggagtgaata ccacgacgat ttccggcagt ttctacacat atattcgcaa gatgtggcgt     
     2041 gttacggtga aaacctggcc tatttcccta aagggtttat tgagaatatg tttttcgtct     
     2101 cagccaatcc ctgggtgagt ttcaccagtt ttgatttaaa cgtggccaat atggacaact     
     2161 tcttcgcccc cgttttcacc atgggcaaat attatacgca aggcgacaag gtgctgatgc     
     2221 cgctggcgat tcaggttcat catgccgttt gtgatggctt ccatgtcggc agaatgctta     
     2281 atgaattaca acagtactgc gatgagtggc agggcggggc gtaaagatct ggatccggct     
     2341 tactaaaagc cagataacag tatgcgtatt tgcgcgctga tttttgcggt ataagaatat     
     2401 atactgatat gtatacccga agtatgtcaa aaagaggtat gctatgaagc agcgtattac     
     2461 agtgacagtt gacagcgaca gctatcagtt gctcaaggca tatatgatgt caatatctcc     
     2521 ggtctggtaa gcacaaccat gcagaatgaa gcccgtcgtc tgcgtgccga acgctggaaa     
     2581 gcggaaaatc aggaagggat ggctgaggtc gcccggttta ttgaaatgaa cggctctttt     
     2641 gctgacgaga acaggggctg gtgaaatgca gtttaaggtt tacacctata aaagagagag     
     2701 ccgttatcgt ctgtttgtgg atgtacagag tgatattatt gacacgcccg ggcgacggat     
     2761 ggtgatcccc ctggccagtg cacgtctgct gtcagataaa gtctcccgtg aactttaccc     
     2821 ggtggtgcat atcggggatg aaagctggcg catgatgacc accgatatgg ccagtgtgcc     
     2881 ggtctccgtt atcggggaag aagtggctga tctcagccac cgcgaaaatg acatcaaaaa     
     2941 cgccattaac ctgatgttct ggggaatata aatgtcaggc tcccttatac acagccagtc     
     3001 tgcaggtcga ccatagtgac tggatatgtt gtgttttaca gtattatgta gtctgttttt     
     3061 tatgcaaaat ctaatttaat atattgatat ttatatcatt ttacgtttct cgttcagctt     
     3121 tcttgtacaa agtggttgat atcctcgagt acccatacga cgtcccagac tacgcttgag     
     3181 tttaaaccgc tgatcagcct cgactgtgcc ttctagttgc cagccatctg ttgttgcccg     
     3241 ggcgcgatcg ctgcccctcc cccgtgcctt ccttgaccct ggaaggtgcc actcccactg     
     3301 tcctttccta ataaaatgag gaaattgcat cgcattgtct gagtaggtgt cattctattc     
     3361 tggggggtgg ggtggggcag gacagcaagg gggaggattg ggaagacaat agcaggcatg     
     3421 ctggggatgc ggtgggctct atggcttctg aggcggaaag aaccagcaga tcgatctgca     
     3481 tctatgtcgg gtgcggagaa agaggtaatg aaatggcatt atgggtatta tgggtctgca     
     3541 ttaatgaatc ggccaacgga tcccggtgtg aaataccgca cagatgcgta aggagaaaat     
     3601 accgcatcag gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc     
     3661 tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg     
     3721 ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg     
     3781 ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac     
     3841 gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg     
     3901 gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct     
     3961 ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg     
     4021 tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct     
     4081 gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac     
     4141 tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt     
     4201 tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc     
     4261 tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca     
     4321 ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat     
     4381 ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac     
     4441 gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc cttttaaatt     
     4501 aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct gacagttacc     
     4561 aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca tccatagttg     
     4621 cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct ggccccagtg     
     4681 ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca ataaaccagc     
     4741 cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc atccagtcta     
     4801 ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg cgcaacgttg     
     4861 ttgaaaaagg atcttcacct agatcctttt cacgtagaaa gccagtccgc agaaacggtg     
     4921 ctgaccccgg atgaatgtca gctactgggc tatctggaca agggaaaacg caagcgcaaa     
     4981 gagaaagcag gtagcttgca gtgggcttac atggcgatag ctagactggg cggttttatg     
     5041 gacagcaagc gaaccggaat tgccagctgg ggcgccctct ggtaaggttg ggaagccctg     
     5101 caaagtaaac tggatggctt tctcgccgcc aaggatctga tggcgcaggg gatcaagctc     
     5161 tgatcaagag acaggatgag gatcgtttcg catgattgaa caagatggat tgcacgcagg     
     5221 ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac agacaatcgg     
     5281 ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc tttttgtcaa     
     5341 gaccgacctg tccggtgccc tgaatgaact gcaagacgag gcagcgcggc tatcgtggct     
     5401 ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga     
     5461 ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc ttgctcctgc     
     5521 cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg atccggctac     
     5581 ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc ggatggaagc     
     5641 cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc cagccgaact     
     5701 gttcgccagg ctcaaggcga gcatgcccga cggcgaggat ctcgtcgtga cccatggcga     
     5761 tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca tcgactgtgg     
     5821 ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg atattgctga     
     5881 agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg ccgctcccga     
     5941 ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgaattt tgttaaaatt     
     6001 tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaacatc ccttataaat     
     6061 caaaagaata gaccgcgata gggttgagtg ttgttccagt ttggaacaag agtccactat     
     6121 taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt ctatcagggc gatggcccac     
     6181 tacgtgaacc atcacccaaa tcaagttttt tgcggtcgag gtgccgtaaa gctctaaatc     
     6241 ggaaccctaa agggagcccc cgatttagag cttgacgggg aaagccggcg aacgtggcga     
     6301 gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc gctggcaagt gtagcggtca     
     6361 cgctgcgcgt aaccaccaca cccgcgcgct taatgcgccg ctacagggcg cgtccattcg     
     6421 ccattcagga tcgaattaat tcttaattaa catcatcaat aatatacctt
                                    LOCUS       dna                      6470 bp                                   
FEATURES             Location/Qualifiers
     Other Gene      162..310
                     /gene="Encap other"
     Promoter        365..393
                     /gene="amp prom"
     misc_binding    457..462
                     /dbxref="REBASE:HpaI"
     misc_binding    691..696
                     /dbxref="REBASE:NruI"
     misc_binding    968..973
                     /dbxref="REBASE:NdeI"
     Regulatory_Seq  1305..1344
                     /gene="tetO reg"
     misc_binding    1557..1564
                     /dbxref="REBASE:NotI"
     Marker          1665..2324
                     /gene="CAT marker"
     ORF             1665..2324
                     /sequence="ORF_2 rf(3)"
     misc_binding    1878..1883
                     /dbxref="REBASE:EcoRI"
     Other Gene      2666..2971
                     /gene="ccdB other"
     misc_binding    3000..3005
                     /dbxref="REBASE:PstI"
     misc_binding    3144..3149
                     /dbxref="REBASE:XhoI"
     misc_binding    3470..3475
                     /dbxref="REBASE:ClaI"
     Rep_Origin      3782..4401
                     /gene="pBR322 origin"
     Promoter        5054..5103
                     /gene="NEOKAN prom"
     ORF             5192..5986
                     /sequence="ORF_1 rf(2)"
     Marker          5195..5983
                     /gene="NTP_II marker"
     Rep_Origin      6091..6396
                     /gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
      AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61    gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
      CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

                                               Encap other(162,310)>>> 
                                               |
121   cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
      GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181   aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
      TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241   aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
      TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301   tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
      ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

          amp prom(365,393)<<< 
          |
361   ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
      CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

                                             HpaI 
                                             |
421   gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
      CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481   gcgaaagctcagatctggatctcccgatcccctatggtcgactctcagtacaatctgctc 540
      CGCTTTCGAGTCTAGACCTAGAGGGCTAGGGGATACCAGCTGAGAGTCATGTTAGACGAG

541   tgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagta 600
      ACTACGGCGTATCAATTCGGTCATAGACGAGGGACGAACACACAACCTCCAGCGACTCAT

601   gtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaa 660
      CACGCGCTCGTTTTAAATTCGATGTTGTTCCGTTCCGAACTGGCTGTTAACGTACTTCTT

                                       NruI 
                                       |
661   tctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttg 720
      AGACGAATCCCAATCCGCAAAACGCGACGAAGCGCTACATGCCCGGTCTATATGCGCAAC

721   acattgattattgactagttattaatagtaatcaattacggggtcattagttcatagccc 780
      TGTAACTAATAACTGATCAATAATTATCATTAGTTAATGCCCCAGTAATCAAGTATCGGG

781   atatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaa 840
      TATATACCTCAAGGCGCAATGTATTGAATGCCATTTACCGGGCGGACCGACTGGCGGGTT

841   cgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggac 900
      GCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAAGGGTATCATTGCGGTTATCCCTG

901   tttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatca 960
      AAAGGTAACTGCAGTTACCCACCTCATAAATGCCATTTGACGGGTGAACCGTCATGTAGT

               NdeI 
               |
961   agtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctg 1020
      TCACATAGTATACGGTTCATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGAC

1021  gcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtatt 1080
      CGTAATACGGGTCATGTACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCATAA

1081  agtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcg 1140
      TCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCATGTAGTTACCCGCACCTATCGC

1141  gtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttg 1200
      CAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAACTGCAGTTACCCTCAAACAAAAC

1201  gaaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaat 1260
      CTTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGTTGAGGCGGGGTAACTGCGTTTA

                                                  tetO reg(1305,1344)>>> 
                                                  |
1261  gggcggtaggcgtgtacggtgggaggtctatataagcagagctctccctatcagtgatag 1320
      CCCGCCATCCGCACATGCCACCCTCCAGATATATTCGTCTCGAGAGGGATAGTCACTATC

1321  agatctccctatcagtgatagagatcgtcgacgagctcgtttagtgaaccgtcagatcgc 1380
      TCTAGAGGGATAGTCACTATCTCTAGCAGCTGCTCGAGCAAATCACTTGGCAGTCTAGCG

1381  ctggagacgccatccacgctgttttgacctccatagaagctagcgatatcaacaagtttg 1440
      GACCTCTGCGGTAGGTGCGACAAAACTGGAGGTATCTTCGATCGCTATAGTTGTTCAAAC

1441  tacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagatt 1500
      ATGTTTTTTCGACTTGCTCTTTGCATTTTACTATATTTATAGTTATATAATTTAATCTAA

                                                                NotI 
                                                                |
1501  ttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcgg 1560
      AACGTATTTTTTGTCTGATGTATTATGACATTTTGTGTTGTATAGGTCAGTGATACCGCC

1561  ccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattt 1620
      GGCGTAATCCGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATATTACACACCTAAA

                                                  ORF_2 rf(3)(1665,2324)>>> 
                                                  |
                                                  CAT marker(1665,2324)>>> 
                                                  |
1621  tgagttaggatccgtcgagattttcaggagctaaggaagctaaaatggagaaaaaaatca 1680
      ACTCAATCCTAGGCAGCTCTAAAAGTCCTCGATTCCTTCGATTTTACCTCTTTTTTTAGT

1681  ctggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttc 1740
      GACCTATATGGTGGCAACTATATAGGGTTACCGTAGCATTTCTTGTAAAACTCCGTAAAG

1741  agtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaa 1800
      TCAGTCAACGAGTTACATGGATATTGGTCTGGCAAGTCGACCTATAATGCCGGAAAAATT

1801  agaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcc 1860
      TCTGGCATTTCTTTTTATTCGTGTTCAAAATAGGCCGGAAATAAGTGTAAGAACGGGCGG

                        EcoRI 
                        |
1861  tgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatggg 1920
      ACTACTTACGAGTAGGCCTTAAGGCATACCGTTACTTTCTGCCACTCGACCACTATACCC

1921  atagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctct 1980
      TATCACAAGTGGGAACAATGTGGCAAAAGGTACTCGTTTGACTTTGCAAAAGTAGCGAGA

1981  ggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgt 2040
      CCTCACTTATGGTGCTGCTAAAGGCCGTCAAAGATGTGTATATAAGCGTTCTACACCGCA

2041  gttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtct 2100
      CAATGCCACTTTTGGACCGGATAAAGGGATTTCCCAAATAACTCTTATACAAAAAGCAGA

2101  cagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaact 2160
      GTCGGTTAGGGACCCACTCAAAGTGGTCAAAACTAAATTTGCACCGGTTATACCTGTTGA

2161  tcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgc 2220
      AGAAGCGGGGGCAAAAGTGGTACCCGTTTATAATATGCGTTCCGCTGTTCCACGACTACG

2221  cgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgctta 2280
      GCGACCGCTAAGTCCAAGTAGTACGGCAAACACTACCGAAGGTACAGCCGTCTTACGAAT

2281  atgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatccggct 2340
      TACTTAATGTTGTCATGACGCTACTCACCGTCCCGCCCCGCATTTCTAGACCTAGGCCGA

2341  tactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatat 2400
      ATGATTTTCGGTCTATTGTCATACGCATAAACGCGCGACTAAAAACGCCATATTCTTATA

2401  atactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgaagcagcgtattac 2460
      TATGACTATACATATGGGCTTCATACAGTTTTTCTCCATACGATACTTCGTCGCATAATG

2461  agtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctcc 2520
      TCACTGTCAACTGTCGCTGTCGATAGTCAACGAGTTCCGTATATACTACAGTTATAGAGG

2521  ggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaa 2580
      CCAGACCATTCGTGTTGGTACGTCTTACTTCGGGCAGCAGACGCACGGCTTGCGACCTTT

2581  gcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctctttt 2640
      CGCCTTTTAGTCCTTCCCTACCGACTCCAGCGGGCCAAATAACTTTACTTGCCGAGAAAA

                               ccdB other(2666,2971)>>> 
                               |
2641  gctgacgagaacaggggctggtgaaatgcagtttaaggtttacacctataaaagagagag 2700
      CGACTGCTCTTGTCCCCGACCACTTTACGTCAAATTCCAAATGTGGATATTTTCTCTCTC

2701  ccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggat 2760
      GGCAATAGCAGACAAACACCTACATGTCTCACTATAATAACTGTGCGGGCCCGCTGCCTA

2761  ggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttaccc 2820
      CCACTAGGGGGACCGGTCACGTGCAGACGACAGTCTATTTCAGAGGGCACTTGAAATGGG

2821  ggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgcc 2880
      CCACCACGTATAGCCCCTACTTTCGACCGCGTACTACTGGTGGCTATACCGGTCACACGG

2881  ggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaa 2940
      CCAGAGGCAATAGCCCCTTCTTCACCGACTAGAGTCGGTGGCGCTTTTACTGTAGTTTTT

2941  cgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtc 3000
      GCGGTAATTGGACTACAAGACCCCTTATATTTACAGTCCGAGGGAATATGTGTCGGTCAG

          PstI
          |
3001  tgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttt 3060
      ACGTCCAGCTGGTATCACTGACCTATACAACACAAAATGTCATAATACATCAGACAAAAA

3061  tatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctt 3120
      ATACGTTTTAGATTAAATTATATAACTATAAATATAGTAAAATGCAAAGAGCAAGTCGAA

                              XhoI 
                              |
3121  tcttgtacaaagtggttgatatcctcgagtacccatacgacgtcccagactacgcttgag 3180
      AGAACATGTTTCACCAACTATAGGAGCTCATGGGTATGCTGCAGGGTCTGATGCGAACTC

3181  tttaaaccgctgatcagcctcgactgtgccttctagttgccagccatctgttgttgcccg 3240
      AAATTTGGCGACTAGTCGGAGCTGACACGGAAGATCAACGGTCGGTAGACAACAACGGGC

3241  ggcgcgatcgctgcccctcccccgtgccttccttgaccctggaaggtgccactcccactg 3300
      CCGCGCTAGCGACGGGGAGGGGGCACGGAAGGAACTGGGACCTTCCACGGTGAGGGTGAC

3301  tcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattc 3360
      AGGAAAGGATTATTTTACTCCTTTAACGTAGCGTAACAGACTCATCCACAGTAAGATAAG

3361  tggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatg 3420
      ACCCCCCACCCCACCCCGTCCTGTCGTTCCCCCTCCTAACCCTTCTGTTATCGTCCGTAC

                                                         ClaI 
                                                         |
3421  ctggggatgcggtgggctctatggcttctgaggcggaaagaaccagcagatcgatctgca 3480
      GACCCCTACGCCACCCGAGATACCGAAGACTCCGCCTTTCTTGGTCGTCTAGCTAGACGT

3481  tctatgtcgggtgcggagaaagaggtaatgaaatggcattatgggtattatgggtctgca 3540
      AGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGTAATACCCATAATACCCAGACGT

3541  ttaatgaatcggccaacggatcccggtgtgaaataccgcacagatgcgtaaggagaaaat 3600
      AATTACTTAGCCGGTTGCCTAGGGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTTA

3601  accgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggc 3660
      TGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCCG

3661  tgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcagggg 3720
      ACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCCC

3721  ataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaagg 3780
      TATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCC

       pBR322 origin(3782,4401)<<< 
       |
3781  ccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgac 3840
      GGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTG

3841  gctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctg 3900
      CGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGAC

3901  gaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcct 3960
      CTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGA

3961  ttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcgg 4020
      AAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGCC

4021  tgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgct 4080
      ACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCGA

4081  gcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccac 4140
      CGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGTG

4141  tggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagt 4200
      ACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTCA

4201  tcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctc 4260
      AGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCGAG

4261  tgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaacca 4320
      ACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGGT

4321  ccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggat 4380
      GGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTA

4381  ctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcac 4440
      GAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGTG

4441  gttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaatt 4500
      CAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTAA

4501  aaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttacc 4560
      TTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAATGG

4561  aatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttg 4620
      TTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAAC

4621  cctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtg 4680
      GGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCAC

4681  ctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagc 4740
      GACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTCG

4741  cagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtcta 4800
      GTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGAT

4801  ttaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttg 4860
      AATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAAC

4861  ttgaaaaaggatcttcacctagatccttttcacgtagaaagccagtccgcagaaacggtg 4920
      AACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCAC

4921  ctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaa 4980
      GACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTTT

4981  gagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatg 5040
      CTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAAATAC

                   NEOKAN prom(5054,5103)>>> 
                   |
5041  gacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctg 5100
      CTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGAC

5101  caaagtaaactggatggctttctcgccgccaaggatctgatggcgcaggggatcaagctc 5160
      GTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGAG

                                        NTP_II marker(5195,5983)>>> 
                                        |
                                     ORF_1 rf(2)(5192,5986)>>> 
                                     |  |
5161  tgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcagg 5220
      ACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTCC

5221  ttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcgg 5280
      AAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGCC

5281  ctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaa 5340
      GACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGTT

5341  gaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggct 5400
      CTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCGA

5401  ggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaaggga 5460
      CCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCCT

5461  ctggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgc 5520
      GACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGACG

5521  cgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctac 5580
      GCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCCGATG

5581  ctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagc 5640
      GACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTCG

5641  cggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaact 5700
      GCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTGA

5701  gttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcga 5760
      CAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGCT

5761  tgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtgg 5820
      ACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACACC

5821  ccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctga 5880
      GGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAACGACT

5881  agagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccga 5940
      TCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGCT

5941  ttcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattttgttaaaatt 6000
      AAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTAA

6001  tttgttaaatcagctcattttttaaccaataggccgaaatcggcaacatcccttataaat 6060
      AAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTTA

                                    f1 origin(6091,6396)<<< 
                                    |
6061  caaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaagagtccactat 6120
      GTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGATA

6121  taaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccac 6180
      ATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGTG

6181  tacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaaagctctaaatc 6240
      ATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTAG

6241  ggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcga 6300
      CCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGCT

6301  gaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtca 6360
      CTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAGT

6361  cgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacagggcgcgtccattcg 6420
      GCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAGC

6421  ccattcaggatcgaattaattcttaattaacatcatcaataatatacctt 6470
      GGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA