pPM-C-His
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepPM-C-His
VectorTypeProtein Vector
Antibiotic InformationKanamycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
Additional InformationOriginal Vector: 6459bp

Vector without Insert Cassette: 4752bp
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


ORIGIN

1 TTTTGGATTG AAGCCAATAT GATAATGAGG GGGTGGAGTT TGTGACGTGG
51 CGCGGGGCGT GGGAACGGGG CGGGTGACGT AGTAGTGTGG CGGAAGTGTG
101 ATGTTGCAAG TGTGGCGGAA CACATGTAAG CGACGGATGT GGCAAAAGTG
151 ACGTTTTTGG TGTGCGCCGG TGTACACAGG AAGTGACAAT TTTCGCGCGG
201 TTTTAGGCGG ATGTTGTAGT AAATTTGGGC GTAACCGAGT AAGATTTGGC
251 CATTTTCGCG GGAAAACTGA ATAAGAGGAA GTGAAATCTG AATAATTTTG
301 TGTTACTCAT AGCGCGTAAT ACGGCAGACC TCAGCGCTAG ATTATTGAAG
351 CATTTATCAG GGTTATTGTC TCATGAGCGG ATACATATTT GAATGTATTT
401 AGAAAAATAA ACAAATAGGG GTTCCGCGCA CATTTCCCCG AAAAGTGCCA
451 CCTGACGTTA ACTATAACGG TCCTAAGGTA GCGAAAGCTC AGATCTGGAT
501 CTCCCGATCC CCTATGGTCG ACTCTCAGTA CAATCTGCTC TGATGCCGCA
551 TAGTTAAGCC AGTATCTGCT CCCTGCTTGT GTGTTGGAGG TCGCTGAGTA
601 GTGCGCGAGC AAAATTTAAG CTACAACAAG GCAAGGCTTG ACCGACAATT
651 GCATGAAGAA TCTGCTTAGG GTTAGGCGTT TTGCGCTGCT TCGCGATGTA
701 CGGGCCAGAT ATACGCGTTG ACATTGATTA TTGACTAGTT ATTAATAGTA
751 ATCAATTACG GGGTCATTAG TTCATAGCCC ATATATGGAG TTCCGCGTTA
801 CATAACTTAC GGTAAATGGC CCGCCTGGCT GACCGCCCAA CGACCCCCGC
851 CCATTGACGT CAATAATGAC GTATGTTCCC ATAGTAACGC CAATAGGGAC
901 TTTCCATTGA CGTCAATGGG TGGAGTATTT ACGGTAAACT GCCCACTTGG
951 CAGTACATCA AGTGTATCAT ATGCCAAGTA CGCCCCCTAT TGACGTCAAT
1001 GACGGTAAAT GGCCCGCCTG GCATTATGCC CAGTACATGA CCTTATGGGA
1051 CTTTCCTACT TGGCAGTACA TCTACGTATT AGTCATCGCT ATTACCATGG
1101 TGATGCGGTT TTGGCAGTAC ATCAATGGGC GTGGATAGCG GTTTGACTCA
1151 CGGGGATTTC CAAGTCTCCA CCCCATTGAC GTCAATGGGA GTTTGTTTTG
1201 GAACCAAAAT CAACGGGACT TTCCAAAATG TCGTAACAAC TCCGCCCCAT
1251 TGACGCAAAT GGGCGGTAGG CGTGTACGGT GGGAGGTCTA TATAAGCAGA
1301 GCTCTCCCTA TCAGTGATAG AGATCTCCCT ATCAGTGATA GAGATCGTCG
1351 ACGAGCTCGT TTAGTGAACC GTCAGATCGC CTGGAGACGC CATCCACGCT
1401 GTTTTGACCT CCATAGAGCT AGCGATATCA ACAAGTTTGT ACAAAAAAGC
1451 TGAACGAGAA ACGTAAAATG ATATAAATAT CAATATATTA AATTAGATTT
1501 TGCATAAAAA ACAGACTACA TAATACTGTA AAACACAACA TATCCAGTCA
1551 CTATGGCGGC CGCATTAGGC ACCCCAGGCT TTACACTTTA TGCTTCCGGC
1601 TCGTATAATG TGTGGATTTT GAGTTAGGAT CCGTCGAGAT TTTCAGGAGC
1651 TAAGGAAGCT AAAATGGAGA AAAAAATCAC TGGATATACC ACCGTTGATA
1701 TATCCCAATG GCATCGTAAA GAACATTTTG AGGCATTTCA GTCAGTTGCT
1751 CAATGTACCT ATAACCAGAC CGTTCAGCTG GATATTACGG CCTTTTTAAA
1801 GACCGTAAAG AAAAATAAGC ACAAGTTTTA TCCGGCCTTT ATTCACATTC
1851 TTGCCCGCCT GATGAATGCT CATCCGGAAT TCCGTATGGC AATGAAAGAC
1901 GGTGAGCTGG TGATATGGGA TAGTGTTCAC CCTTGTTACA CCGTTTTCCA
1951 TGAGCAAACT GAAACGTTTT CATCGCTCTG GAGTGAATAC CACGACGATT
2001 TCCGGCAGTT TCTACACATA TATTCGCAAG ATGTGGCGTG TTACGGTGAA
2051 AACCTGGCCT ATTTCCCTAA AGGGTTTATT GAGAATATGT TTTTCGTCTC
2101 AGCCAATCCC TGGGTGAGTT TCACCAGTTT TGATTTAAAC GTGGCCAATA
2151 TGGACAACTT CTTCGCCCCC GTTTTCACCA TGGGCAAATA TTATACGCAA
2201 GGCGACAAGG TGCTGATGCC GCTGGCGATT CAGGTTCATC ATGCCGTTTG
2251 TGATGGCTTC CATGTCGGCA GAATGCTTAA TGAATTACAA CAGTACTGCG
2301 ATGAGTGGCA GGGCGGGGCG TAAAGATCTG GATCCGGCTT ACTAAAAGCC
2351 AGATAACAGT ATGCGTATTT GCGCGCTGAT TTTTGCGGTA TAAGAATATA
2401 TACTGATATG TATACCCGAA GTATGTCAAA AAGAGGTATG CTATGAAGCA
2451 GCGTATTACA GTGACAGTTG ACAGCGACAG CTATCAGTTG CTCAAGGCAT
2501 ATATGATGTC AATATCTCCG GTCTGGTAAG CACAACCATG CAGAATGAAG
2551 CCCGTCGTCT GCGTGCCGAA CGCTGGAAAG CGGAAAATCA GGAAGGGATG
2601 GCTGAGGTCG CCCGGTTTAT TGAAATGAAC GGCTCTTTTG CTGACGAGAA
2651 CAGGGGCTGG TGAAATGCAG TTTAAGGTTT ACACCTATAA AAGAGAGAGC
2701 CGTTATCGTC TGTTTGTGGA TGTACAGAGT GATATTATTG ACACGCCCGG
2751 GCGACGGATG GTGATCCCCC TGGCCAGTGC ACGTCTGCTG TCAGATAAAG
2801 TCTCCCGTGA ACTTTACCCG GTGGTGCATA TCGGGGATGA AAGCTGGCGC
2851 ATGATGACCA CCGATATGGC CAGTGTGCCG GTCTCCGTTA TCGGGGAAGA
2901 AGTGGCTGAT CTCAGCCACC GCGAAAATGA CATCAAAAAC GCCATTAACC
2951 TGATGTTCTG GGGAATATAA ATGTCAGGCT CCCTTATACA CAGCCAGTCT
3001 GCAGGTCGAC CATAGTGACT GGATATGTTG TGTTTTACAG TATTATGTAG
3051 TCTGTTTTTT ATGCAAAATC TAATTTAATA TATTGATATT TATATCATTT
3101 TACGTTTCTC GTTCAGCTTT CTTGTACAAA GTGGTTGATA TCCTCGAGCA
3151 TCATCACCAT CACCATTGAG TTTAAACCGC TGATCAGCCT CGACTGTGCC
3201 TTCTAGTTGC CAGCCATCTG TTGTTTGCCC CTCCCCCGTG CCTTCCTTGA
3251 CCCTGGAAGG TGCCACTCCC ACTGTCCTTT CCTAATAAAA TGAGGAAATT
3301 GCATCGCATT GTCTGAGTAG GTGTCATTCT ATTCTGGGGG GTGGGGTGGG
3351 GCAGGACAGC AAGGGGGAGG ATTGGGAAGA CAATAGCAGG CATGCTGGGG
3401 ATGCGGTGGG CTCTATGGCT TCTGAGGCGG AAAGAACCAG CAGATCGATC
3451 TGCATCTATG TCGGGTGCGG AGAAAGAGGT AATGAAATGG CATTATGGGT
3501 ATTATGGGTC TGCATTAATG AATCGGCCAA CGGATCCATA TGCGGTGTGA
3551 AATACCGCAC AGATGCGTAA GGAGAAAATA CCGCATCAGG CGCTCTTCCG
3601 CTTCCTCGCT CACTGACTCG CTGCGCTCGG TCGTTCGGCT GCGGCGAGCG
3651 GTATCAGCTC ACTCAAAGGC GGTAATACGG TTATCCACAG AATCAGGGGA
3701 TAACGCAGGA AAGAACATGT GAGCAAAAGG CCAGCAAAAG GCCAGGAACC
3751 GTAAAAAGGC CGCGTTGCTG GCGTTTTTCC ATAGGCTCCG CCCCCCTGAC
3801 GAGCATCACA AAAATCGACG CTCAAGTCAG AGGTGGCGAA ACCCGACAGG
3851 ACTATAAAGA TACCAGGCGT TTCCCCCTGG AAGCTCCCTC GTGCGCTCTC
3901 CTGTTCCGAC CCTGCCGCTT ACCGGATACC TGTCCGCCTT TCTCCCTTCG
3951 GGAAGCGTGG CGCTTTCTCA TAGCTCACGC TGTAGGTATC TCAGTTCGGT
4001 GTAGGTCGTT CGCTCCAAGC TGGGCTGTGT GCACGAACCC CCCGTTCAGC
4051 CCGACCGCTG CGCCTTATCC GGTAACTATC GTCTTGAGTC CAACCCGGTA
4101 AGACACGACT TATCGCCACT GGCAGCAGCC ACTGGTAACA GGATTAGCAG
4151 AGCGAGGTAT GTAGGCGGTG CTACAGAGTT CTTGAAGTGG TGGCCTAACT
4201 ACGGCTACAC TAGAAGGACA GTATTTGGTA TCTGCGCTCT GCTGAAGCCA
4251 GTTACCTTCG GAAAAAGAGT TGGTAGCTCT TGATCCGGCA AACAAACCAC
4301 CGCTGGTAGC GGTGGTTTTT TTGTTTGCAA GCAGCAGATT ACGCGCAGAA
4351 AAAAAGGATC TCAAGAAGAT CCTTTGATCT TTTCTACGGG GTCTGACGCT
4401 CAGTGGAACG AAAACTCACG TTAAGGGATT TTGGTCATGA GATTATCAAA
4451 AAGGATCTTC ACCTAGATCC TTTTAAATTA AAAATGAAGT TTTAAATCAA
4501 TCTAAAGTAT ATATGAGTAA ACTTGGTCTG ACAGTTACCA ATGCTTAATC
4551 AGTGAGGCAC CTATCTCAGC GATCTGTCTA TTTCGTTCAT CCATAGTTGC
4601 CTGACTCCCC GTCGTGTAGA TAACTACGAT ACGGGAGGGC TTACCATCTG
4651 GCCCCAGTGC TGCAATGATA CCGCGAGACC CACGCTCACC GGCTCCAGAT
4701 TTATCAGCAA TAAACCAGCC AGCCGGAAGG GCCGAGCGCA GAAGTGGTCC
4751 TGCAACTTTA TCCGCCTCCA TCCAGTCTAT TAATTGTTGC CGGGAAGCTA
4801 GAGTAAGTAG TTCGCCAGTT AATAGTTTGC GCAACGTTGT TGAAAAAGGA
4851 TCTTCACCTA GATCCTTTTC ACGTAGAAAG CCAGTCCGCA GAAACGGTGC
4901 TGACCCCGGA TGAATGTCAG CTACTGGGCT ATCTGGACAA GGGAAAACGC
4951 AAGCGCAAAG AGAAAGCAGG TAGCTTGCAG TGGGCTTACA TGGCGATAGC
5001 TAGACTGGGC GGTTTTATGG ACAGCAAGCG AACCGGAATT GCCAGCTGGG
5051 GCGCCCTCTG GTAAGGTTGG GAAGCCCTGC AAAGTAAACT GGATGGCTTT
5101 CTCGCCGCCA AGGATCTGAT GGCGCAGGGG ATCAAGCTCT GATCAAGAGA
5151 CAGGATGAGG ATCGTTTCGC ATGATTGAAC AAGATGGATT GCACGCAGGT
5201 TCTCCGGCCG CTTGGGTGGA GAGGCTATTC GGCTATGACT GGGCACAACA
5251 GACAATCGGC TGCTCTGATG CCGCCGTGTT CCGGCTGTCA GCGCAGGGGC
5301 GCCCGGTTCT TTTTGTCAAG ACCGACCTGT CCGGTGCCCT GAATGAACTG
5351 CAAGACGAGG CAGCGCGGCT ATCGTGGCTG GCCACGACGG GCGTTCCTTG
5401 CGCAGCTGTG CTCGACGTTG TCACTGAAGC GGGAAGGGAC TGGCTGCTAT
5451 TGGGCGAAGT GCCGGGGCAG GATCTCCTGT CATCTCACCT TGCTCCTGCC
5501 GAGAAAGTAT CCATCATGGC TGATGCAATG CGGCGGCTGC ATACGCTTGA
5551 TCCGGCTACC TGCCCATTCG ACCACCAAGC GAAACATCGC ATCGAGCGAG
5601 CACGTACTCG GATGGAAGCC GGTCTTGTCG ATCAGGATGA TCTGGACGAA
5651 GAGCATCAGG GGCTCGCGCC AGCCGAACTG TTCGCCAGGC TCAAGGCGAG
5701 CATGCCCGAC GGCGAGGATC TCGTCGTGAC CCATGGCGAT GCCTGCTTGC
5751 CGAATATCAT GGTGGAAAAT GGCCGCTTTT CTGGATTCAT CGACTGTGGC
5801 CGGCTGGGTG TGGCGGACCG CTATCAGGAC ATAGCGTTGG CTACCCGTGA
5851 TATTGCTGAA GAGCTTGGCG GCGAATGGGC TGACCGCTTC CTCGTGCTTT
5901 ACGGTATCGC CGCTCCCGAT TCGCAGCGCA TCGCCTTCTA TCGCCTTCTT
5951 GACGAGTTCT TCTGAATTTT GTTAAAATTT TTGTTAAATC AGCTCATTTT
6001 TTAACCAATA GGCCGAAATC GGCAACATCC CTTATAAATC AAAAGAATAG
6051 ACCGCGATAG GGTTGAGTGT TGTTCCAGTT TGGAACAAGA GTCCACTATT
6101 AAAGAACGTG GACTCCAACG TCAAAGGGCG AAAAACCGTC TATCAGGGCG
6151 ATGGCCCACT ACGTGAACCA TCACCCAAAT CAAGTTTTTT GCGGTCGAGG
6201 TGCCGTAAAG CTCTAAATCG GAACCCTAAA GGGAGCCCCC GATTTAGAGC
6251 TTGACGGGGA AAGCCGGCGA ACGTGGCGAG AAAGGAAGGG AAGAAAGCGA
6301 AAGGAGCGGG CGCTAGGGCG CTGGCAAGTG TAGCGGTCAC GCTGCGCGTA
6351 ACCACCACAC CCGCGCGCTT AATGCGCCGC TACAGGGCGC GTCCATTCGC
6401 CATTCAGGAT CGAATTAATT CTTAATTAAC ATCATCAATA ATATACCTT
//
                                    LOCUS       dna                      6459 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
misc_binding 691..696
/dbxref="REBASE:NruI"
misc_binding 968..973
/dbxref="REBASE:NdeI"
Regulatory_Seq 1305..1344
/gene="tetO reg"
misc_binding 1557..1564
/dbxref="REBASE:NotI"
Marker 1665..2324
/gene="CAT marker"
ORF 1665..2324
/sequence="ORF_1 rf(3)"
misc_binding 1878..1883
/dbxref="REBASE:EcoRI"
Other Gene 2666..2971
/gene="ccdB other"
misc_binding 3000..3005
/dbxref="REBASE:PstI"
misc_binding 3144..3149
/dbxref="REBASE:XhoI"
Tag 3150..3167
/gene="6xHis tag"
misc_binding 3459..3464
/dbxref="REBASE:ClaI"
Rep_Origin 3771..4390
/gene="pBR322 origin"
Promoter 5043..5092
/gene="NEOKAN prom"
ORF 5181..5975
/sequence="ORF_2 rf(3)"
Marker 5184..5972
/gene="NTP_II marker"
Rep_Origin 6080..6385
/gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaagctcagatctggatctcccgatcccctatggtcgactctcagtacaatctgctc 540
CGCTTTCGAGTCTAGACCTAGAGGGCTAGGGGATACCAGCTGAGAGTCATGTTAGACGAG

541 tgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagta 600
ACTACGGCGTATCAATTCGGTCATAGACGAGGGACGAACACACAACCTCCAGCGACTCAT

601 gtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaa 660
CACGCGCTCGTTTTAAATTCGATGTTGTTCCGTTCCGAACTGGCTGTTAACGTACTTCTT

NruI
|
661 tctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttg 720
AGACGAATCCCAATCCGCAAAACGCGACGAAGCGCTACATGCCCGGTCTATATGCGCAAC

721 acattgattattgactagttattaatagtaatcaattacggggtcattagttcatagccc 780
TGTAACTAATAACTGATCAATAATTATCATTAGTTAATGCCCCAGTAATCAAGTATCGGG

781 atatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaa 840
TATATACCTCAAGGCGCAATGTATTGAATGCCATTTACCGGGCGGACCGACTGGCGGGTT

841 cgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggac 900
GCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAAGGGTATCATTGCGGTTATCCCTG

901 tttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatca 960
AAAGGTAACTGCAGTTACCCACCTCATAAATGCCATTTGACGGGTGAACCGTCATGTAGT

NdeI
|
961 agtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctg 1020
TCACATAGTATACGGTTCATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGAC

1021 gcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtatt 1080
CGTAATACGGGTCATGTACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCATAA

1081 agtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcg 1140
TCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCATGTAGTTACCCGCACCTATCGC

1141 gtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttg 1200
CAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAACTGCAGTTACCCTCAAACAAAAC

1201 gaaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaat 1260
CTTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGTTGAGGCGGGGTAACTGCGTTTA

tetO reg(1305,1344)>>>
|
1261 gggcggtaggcgtgtacggtgggaggtctatataagcagagctctccctatcagtgatag 1320
CCCGCCATCCGCACATGCCACCCTCCAGATATATTCGTCTCGAGAGGGATAGTCACTATC

1321 agatctccctatcagtgatagagatcgtcgacgagctcgtttagtgaaccgtcagatcgc 1380
TCTAGAGGGATAGTCACTATCTCTAGCAGCTGCTCGAGCAAATCACTTGGCAGTCTAGCG


1381 ctggagacgccatccacgctgttttgacctccatagaagctagcgatatcaacaagtttg 1440
GACCTCTGCGGTAGGTGCGACAAAACTGGAGGTATCTTCGATCGCTATAGTTGTTCAAAC

1441 tacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagatt 1500
ATGTTTTTTCGACTTGCTCTTTGCATTTTACTATATTTATAGTTATATAATTTAATCTAA

NotI
|
1501 ttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcgg 1560
AACGTATTTTTTGTCTGATGTATTATGACATTTTGTGTTGTATAGGTCAGTGATACCGCC

1561 ccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattt 1620
GGCGTAATCCGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATATTACACACCTAAA

ORF_1 rf(3)(1665,2324)>>>
|
CAT marker(1665,2324)>>>
|
1621 tgagttaggatccgtcgagattttcaggagctaaggaagctaaaatggagaaaaaaatca 1680
ACTCAATCCTAGGCAGCTCTAAAAGTCCTCGATTCCTTCGATTTTACCTCTTTTTTTAGT

1681 ctggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttc 1740
GACCTATATGGTGGCAACTATATAGGGTTACCGTAGCATTTCTTGTAAAACTCCGTAAAG

1741 agtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaa 1800
TCAGTCAACGAGTTACATGGATATTGGTCTGGCAAGTCGACCTATAATGCCGGAAAAATT

1801 agaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcc 1860
TCTGGCATTTCTTTTTATTCGTGTTCAAAATAGGCCGGAAATAAGTGTAAGAACGGGCGG

EcoRI
|
1861 tgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatggg 1920
ACTACTTACGAGTAGGCCTTAAGGCATACCGTTACTTTCTGCCACTCGACCACTATACCC

1921 atagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctct 1980
TATCACAAGTGGGAACAATGTGGCAAAAGGTACTCGTTTGACTTTGCAAAAGTAGCGAGA

1981 ggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgt 2040
CCTCACTTATGGTGCTGCTAAAGGCCGTCAAAGATGTGTATATAAGCGTTCTACACCGCA

2041 gttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtct 2100
CAATGCCACTTTTGGACCGGATAAAGGGATTTCCCAAATAACTCTTATACAAAAAGCAGA

2101 cagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaact 2160
GTCGGTTAGGGACCCACTCAAAGTGGTCAAAACTAAATTTGCACCGGTTATACCTGTTGA

2161 tcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgc 2220
AGAAGCGGGGGCAAAAGTGGTACCCGTTTATAATATGCGTTCCGCTGTTCCACGACTACG

2221 cgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgctta 2280
GCGACCGCTAAGTCCAAGTAGTACGGCAAACACTACCGAAGGTACAGCCGTCTTACGAAT

2281 atgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatccggct 2340
TACTTAATGTTGTCATGACGCTACTCACCGTCCCGCCCCGCATTTCTAGACCTAGGCCGA

2341 tactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatat 2400
ATGATTTTCGGTCTATTGTCATACGCATAAACGCGCGACTAAAAACGCCATATTCTTATA

2401 atactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgaagcagcgtattac 2460
TATGACTATACATATGGGCTTCATACAGTTTTTCTCCATACGATACTTCGTCGCATAATG

2461 agtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctcc 2520
TCACTGTCAACTGTCGCTGTCGATAGTCAACGAGTTCCGTATATACTACAGTTATAGAGG

2521 ggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaa 2580
CCAGACCATTCGTGTTGGTACGTCTTACTTCGGGCAGCAGACGCACGGCTTGCGACCTTT

2581 gcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctctttt 2640
CGCCTTTTAGTCCTTCCCTACCGACTCCAGCGGGCCAAATAACTTTACTTGCCGAGAAAA

ccdB other(2666,2971)>>>
|
2641 gctgacgagaacaggggctggtgaaatgcagtttaaggtttacacctataaaagagagag 2700
CGACTGCTCTTGTCCCCGACCACTTTACGTCAAATTCCAAATGTGGATATTTTCTCTCTC

2701 ccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggat 2760
GGCAATAGCAGACAAACACCTACATGTCTCACTATAATAACTGTGCGGGCCCGCTGCCTA

2761 ggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttaccc 2820
CCACTAGGGGGACCGGTCACGTGCAGACGACAGTCTATTTCAGAGGGCACTTGAAATGGG

2821 ggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgcc 2880
CCACCACGTATAGCCCCTACTTTCGACCGCGTACTACTGGTGGCTATACCGGTCACACGG

2881 ggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaa 2940
CCAGAGGCAATAGCCCCTTCTTCACCGACTAGAGTCGGTGGCGCTTTTACTGTAGTTTTT

2941 cgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtc 3000
GCGGTAATTGGACTACAAGACCCCTTATATTTACAGTCCGAGGGAATATGTGTCGGTCAG

PstI
|
3001 tgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttt 3060
ACGTCCAGCTGGTATCACTGACCTATACAACACAAAATGTCATAATACATCAGACAAAAA

3061 tatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctt 3120
ATACGTTTTAGATTAAATTATATAACTATAAATATAGTAAAATGCAAAGAGCAAGTCGAA

XhoI 6xHis tag(3150,3167)>>>
| |
3121 tcttgtacaaagtggttgatatcctcgagcatcatcaccatcaccattgtttaaaccgct 3180
AGAACATGTTTCACCAACTATAGGAGCTCGTAGTAGTGGTAGTGGTAACAAATTTGGCGA

3181 gatcagcctcgactgtgccttctagttgccagccatctgttgttgcccgggcgcgatcgc 3240
CTAGTCGGAGCTGACACGGAAGATCAACGGTCGGTAGACAACAACGGGCCCGCGCTAGCG

3241 tgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaa 3300
ACGGGGAGGGGGCACGGAAGGAACTGGGACCTTCCACGGTGAGGGTGACAGGAAAGGATT

3301 taaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggg 3360
ATTTTACTCCTTTAACGTAGCGTAACAGACTCATCCACAGTAAGATAAGACCCCCCACCC

3361 gtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcg 3420
CACCCCGTCCTGTCGTTCCCCCTCCTAACCCTTCTGTTATCGTCCGTACGACCCCTACGC

ClaI
|
3421 gtgggctctatggcttctgaggcggaaagaaccagcagatcgatctgcatctatgtcggg 3480
CACCCGAGATACCGAAGACTCCGCCTTTCTTGGTCGTCTAGCTAGACGTAGATACAGCCC

3481 tgcggagaaagaggtaatgaaatggcattatgggtattatgggtctgcattaatgaatcg 3540
ACGCCTCTTTCTCCATTACTTTACCGTAATACCCATAATACCCAGACGTAATTACTTAGC

3541 gccaacggatcccggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcagg 3600
CGGTTGCCTAGGGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTTATGGCGTAGTCC

3601 cgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcg 3660
GCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCCGACGCCGCTCGC

3661 gtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcagga 3720
CATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCCCTATTGCGTCCT

pBR322 origin(3771,4390)<<<
|
3721 aagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctg 3780
TTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCCGGCGCAACGAC

3781 gcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcag 3840
CGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTC

3841 aggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctc 3900
TCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAG

3901 gtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcg 3960
CACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGAAAGAGGGAAGC

3961 ggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgtt 4020
CCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGCCACATCCAGCAA

4021 cgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatcc 4080
GCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGG

4081 ggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcc 4140
CCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGACCGTCGTCGG

4141 actggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtgg 4200
TGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTCAAGAACTTCACC

4201 tggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagcca 4260
ACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCGAGACGACTTCGGT

4261 gttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagc 4320
CAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGGTGGCGACCATCG

4321 ggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagat 4380
CCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTA

4381 cctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggatt 4440
GGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGTGCAATTCCCTAA

4441 ttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagt 4500
AACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTAATTTTTACTTCA

4501 tttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatc 4560
AAATTTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAATGGTTACGAATTAG

4561 agtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactcccc 4620
TCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAACGGACTGAGGGG

4621 gtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgata 4680
CAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCACGACGTTACTAT

4681 ccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagg 4740
GGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTCGGTCGGCCTTCC

4741 gccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgc 4800
CGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGATAATTAACAACG

4801 cgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgaaaaagga 4860
GCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAACAACTTTTTCCT

4861 tcttcacctagatccttttcacgtagaaagccagtccgcagaaacggtgctgaccccgga 4920
AGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCACGACTGGGGCCT

4921 tgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcagg 4980
ACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCC

4981 tagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcg 5040
ATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAAATACCTGTCGTTCGC

NEOKAN prom(5043,5092)>>>
|
5041 aaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaact 5100
TTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGACGTTTCATTTGA

5101 ggatggctttctcgccgccaaggatctgatggcgcaggggatcaagctctgatcaagaga 5160
CCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGAGACTAGTTCTCT

NTP_II marker(5184,5972)>>>
|
ORF_2 rf(3)(5181,5975)>>>
| |
5161 caggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccg 5220
GTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTCCAAGAGGCCGGC

5221 cttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatg 5280
GAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGCCGACGAGACTAC

5281 ccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgt 5340
GGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGTTCTGGCTGGACA

5341 ccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgg 5400
GGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCGACCGGTGCTGCC

5401 gcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctat 5460
CGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCCTGACCGACGATA

5461 tgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtat 5520
ACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGACGGCTCTTTCATA

5521 ccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcg 5580
GGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCCGATGGACGGGTAAGC

5581 accaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcg 5640
TGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTCGGCCAGAACAGC

5641 atcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggc 5700
TAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCG

5701 tcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgc 5760
AGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGCTACGGACGAACG

5761 cgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtg 5820
GCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACACCGGCCGACCCAC

5821 tggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcg 5880
ACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAACGACTTCTCGAACCGC

5881 gcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgca 5940
CGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGCTAAGCGTCGCGT

5941 tcgccttctatcgccttcttgacgagttcttctgaattttgttaaaatttttgttaaatc 6000
AGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTAAAAACAATTTAG

6001 agctcattttttaaccaataggccgaaatcggcaacatcccttataaatcaaaagaatag 6060
TCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTTAGTTTTCTTATC

f1 origin(6080,6385)<<<
|
6061 accgcgatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtg 6120
TGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGATAATTTCTTGCAC

6121 gactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaacca 6180
CTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGTGATGCACTTGGT

6181 tcacccaaatcaagttttttgcggtcgaggtgccgtaaagctctaaatcggaaccctaaa 6240
AGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTAGCCTTGGGATTT

6241 gggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaaggg 6300
CCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCC

6301 aagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgta 6360
TTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAGTGCGACGCGCAT

6361 accaccacacccgcgcgcttaatgcgccgctacagggcgcgtccattcgccattcaggat 6420
TGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTA

6421 cgaattaattcttaattaacatcatcaataatatacctt 6459
GCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA