pPM-N-D-C-HA
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepPM-N-D-C-HA
VectorTypeProtein Vector
Antibiotic InformationKanamycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcatgaagaa
661 tctgcttagg gttaggcgtt ttgcgctgct tcgcgatgta cgggccagat atacgcgttg
721 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc
781 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa
841 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac
901 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca
961 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg
1021 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt
1081 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg
1141 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg
1201 gaaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat
1261 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctcccta tcagtgatag
1321 agatctccct atcagtgata gagatcgtcg acgagctcgt ttagtgaacc gtcagatcgc
1381 ctggagacgc catccacgct gttttgacct ccatagagct agcatggact acaaggacga
1441 cgatgacaag gactacaagg acgacgatga caaggactac aaggacgacg atgacaagag
1501 cgaaaacctg tacttccagg gagaattcga tatcctgcag agcggccgct ctagagggcc
1561 cctcgagtac ccatacgacg tcccagacta cgcttgagtt taaaccgctg atcagcctcg
1621 actgtgcctt ctagttgcca gccatctgtt gtttgcccct cccccgtgcc ttccttgacc
1681 ctggaaggtg ccactcccac tgtcctttcc taataaaatg aggaaattgc atcgcattgt
1741 ctgagtaggt gtcattctat tctggggggt ggggtggggc aggacagcaa gggggaggat
1801 tgggaagaca atagcaggca tgctggggat gcggtgggct ctatggcttc tgaggcggaa
1861 agaaccagca gatcgatctc tatgtcgggt gcggagaaag aggtaatgaa atggcattat
1921 gggtattatg ggtctgcatt aatgaatcgg ccaaggatcc atatgcggtg tgaaataccg
1981 cacagatgcg taaggagaaa ataccgcatc aggcgctctt ccgcttcctc gctcactgac
2041 tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata
2101 cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa
2161 aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct
2221 gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa
2281 gataccaggc gtttccccct gaagctccct cgtgcgctct cctgttccga ccctgccgct
2341 taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg
2401 ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc
2461 ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt
2521 aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta
2581 tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac
2641 agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc
2701 ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat
2761 tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc
2821 tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt
2881 cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta
2941 aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct
3001 atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg
3061 cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga
3121 tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt
3181 atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt
3241 taatagtttg cgcaacgttg ttgaaaaagg atcttcacct agatcctttt cacgtagaaa
3301 gccagtccgc agaaacggtg ctgaccccgg atgaatgtca gctactgggc tatctggaca
3361 agggaaaacg caagcgcaaa gagaaagcag gtagcttgca gtgggcttac atggcgatag
3421 ctagactggg cggttttatg gacagcaagc gaaccggaat tgccagctgg ggcgccctct
3481 ggtaaggttg ggaagccctg caaagtaaac tggatggctt tctcgccgcc aaggatctga
3541 tggcgcaggg gatcaagctc tgatcaagag acaggatgag gatcgtttcg catgattgaa
3601 caagatggat tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac
3661 tgggcacaac agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg
3721 cgcccggttc tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaagacgag
3781 gcagcgcggc tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt
3841 gtcactgaag cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg
3901 tcatctcacc ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg
3961 catacgcttg atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga
4021 gcacgtactc ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag
4081 gggctcgcgc cagccgaact gttcgccagg ctcaaggcga gcatgcccga cggcgaggat
4141 ctcgtcgtga cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt
4201 tctggattca tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg
4261 gctacccgtg atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt
4321 tacggtatcg ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc
4381 ttctgaattt tgttaaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat
4441 cggcaacatc ccttataaat caaaagaata gaccgcgata gggttgagtg ttgttccagt
4501 ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt
4561 ctatcagggc gatggcccac tacgtgaacc atcacccaaa tcaagttttt tgcggtcgag
4621 gtgccgtaaa gctctaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg
4681 aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc
4741 gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgcgcgct taatgcgccg
4801 ctacagggcg cgtccattcg ccattcagga tcgaattaat tcttaattaa catcatcaat
4861 aatatacctt
                                    LOCUS       dna                      4870 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
misc_binding 691..696
/dbxref="REBASE:NruI"
Regulatory_Seq 1305..1344
/gene="tetO reg"
misc_binding 1523..1528
/dbxref="REBASE:EcoRI"
misc_binding 1529..1534
/dbxref="REBASE:EcoRV"
misc_binding 1535..1540
/dbxref="REBASE:PstI"
misc_binding 1542..1549
/dbxref="REBASE:NotI"
misc_binding 1550..1555
/dbxref="REBASE:XbaI"
misc_binding 1556..1561
/dbxref="REBASE:ApaI"
misc_binding 1562..1567
/dbxref="REBASE:AvrI"
misc_binding 1562..1567
/dbxref="REBASE:XhoI"
misc_binding 1562..1567
/dbxref="REBASE:AvaI"
misc_binding 1872..1877
/dbxref="REBASE:ClaI"
misc_binding 1955..1960
/dbxref="REBASE:BamHI"
Rep_Origin 2184..2801
/gene="pBR322 origin"
Promoter 3454..3503
/gene="NEOKAN prom"
ORF 3592..4386
/sequence="ORF_1 rf(1)"
Marker 3595..4383
/gene="NTP_II marker"
Rep_Origin 4491..4796
/gene="f1 origin"
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaagctcagatctggatctcccgatcccctatggtcgactctcagtacaatctgctc 540
CGCTTTCGAGTCTAGACCTAGAGGGCTAGGGGATACCAGCTGAGAGTCATGTTAGACGAG

541 tgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagta 600
ACTACGGCGTATCAATTCGGTCATAGACGAGGGACGAACACACAACCTCCAGCGACTCAT

601 gtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaa 660
CACGCGCTCGTTTTAAATTCGATGTTGTTCCGTTCCGAACTGGCTGTTAACGTACTTCTT

NruI
|
661 tctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttg 720
AGACGAATCCCAATCCGCAAAACGCGACGAAGCGCTACATGCCCGGTCTATATGCGCAAC

721 acattgattattgactagttattaatagtaatcaattacggggtcattagttcatagccc 780
TGTAACTAATAACTGATCAATAATTATCATTAGTTAATGCCCCAGTAATCAAGTATCGGG

781 atatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaa 840
TATATACCTCAAGGCGCAATGTATTGAATGCCATTTACCGGGCGGACCGACTGGCGGGTT

841 cgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggac 900
GCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAAGGGTATCATTGCGGTTATCCCTG

901 tttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatca 960
AAAGGTAACTGCAGTTACCCACCTCATAAATGCCATTTGACGGGTGAACCGTCATGTAGT

961 agtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctg 1020
TCACATAGTATACGGTTCATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGAC

1021 gcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtatt 1080
CGTAATACGGGTCATGTACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCATAA

1081 agtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcg 1140
TCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCATGTAGTTACCCGCACCTATCGC

1141 gtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttg 1200
CAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAACTGCAGTTACCCTCAAACAAAAC

1201 gaaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaat 1260
CTTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGTTGAGGCGGGGTAACTGCGTTTA

tetO reg(1305,1344)>>>
|
1261 gggcggtaggcgtgtacggtgggaggtctatataagcagagctctccctatcagtgatag 1320
CCCGCCATCCGCACATGCCACCCTCCAGATATATTCGTCTCGAGAGGGATAGTCACTATC

1321 agatctccctatcagtgatagagatcgtcgacgagctcgtttagtgaaccgtcagatcgc 1380
TCTAGAGGGATAGTCACTATCTCTAGCAGCTGCTCGAGCAAATCACTTGGCAGTCTAGCG

1381 ctggagacgccatccacgctgttttgacctccatagagctagcatggactacaaggacga 1440
GACCTCTGCGGTAGGTGCGACAAAACTGGAGGTATCTCGATCGTACCTGATGTTCCTGCT

1441 cgatgacaaggactacaaggacgacgatgacaaggactacaaggacgacgatgacaagag 1500
GCTACTGTTCCTGATGTTCCTGCTGCTACTGTTCCTGATGTTCCTGCTGCTACTGTTCTC

NotI
|
EcoRI EcoRV PstI XbaI
| | | | |
1501 cgaaaacctgtacttccagggagaattcgatatcctgcagagcggccgctctagagggcc 1560
GCTTTTGGACATGAAGGTCCCTCTTAAGCTATAGGACGTCTCGCCGGCGAGATCTCCCGG

AvaI
|
XhoI
|
AvrI
|
ApaI
| |
1561 cctcgagtacccatacgacgtcccagactacgcttgagtttaaaccgctgatcagcctcg 1620
GGAGCTCATGGGTATGCTGCAGGGTCTGATGCGAACTCAAATTTGGCGACTAGTCGGAGC

1621 actgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgacc 1680
TGACACGGAAGATCAACGGTCGGTAGACAACAAACGGGGAGGGGGCACGGAAGGAACTGG

1681 ctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgt 1740
GACCTTCCACGGTGAGGGTGACAGGAAAGGATTATTTTACTCCTTTAACGTAGCGTAACA

1741 ctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggat 1800
GACTCATCCACAGTAAGATAAGACCCCCCACCCCACCCCGTCCTGTCGTTCCCCCTCCTA

1801 tgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaa 1860
ACCCTTCTGTTATCGTCCGTACGACCCCTACGCCACCCGAGATACCGAAGACTCCGCCTT

ClaI
|
1861 agaaccagcagatcgatctctatgtcgggtgcggagaaagaggtaatgaaatggcattat 1920
TCTTGGTCGTCTAGCTAGAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGTAATA

BamHI
|
1921 gggtattatgggtctgcattaatgaatcggccaaggatccatatgcggtgtgaaataccg 1980
CCCATAATACCCAGACGTAATTACTTAGCCGGTTCCTAGGTATACGCCACACTTTATGGC

1981 cacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgac 2040
GTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTG

2041 tcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaata 2100
AGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTAT

2101 cggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaa 2160
GCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTT

pBR322 origin(2184,2801)<<<
|
2161 aaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccct 2220
TTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGA

2221 gacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataa 2280
CTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATT

2281 gataccaggcgtttccccctgaagctccctcgtgcgctctcctgttccgaccctgccgct 2340
CTATGGTCCGCAAAGGGGGACTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGA

2341 taccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacg 2400
ATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGC

2401 ctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaacc 2460
GACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGG

2461 ccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggt 2520
GGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCA

2521 aagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggta 2580
TTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCAT

2581 tgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggac 2640
ACATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTG

2641 agtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctc 2700
TCATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAG

2701 ttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagat 2760
AACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTA

2761 tacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgc 2820
ATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCG

2821 tcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatctt 2880
AGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAA

2881 cacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagta 2940
GTGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCAT

2941 aacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtct 3000
TTGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGA

3001 atttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggaggg 3060
TAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCC

3061 cttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccaga 3120
GAATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCT

3121 tttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaacttt 3180
AAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAA

3181 atccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagt 3240
TAGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCA

3241 taatagtttgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgtagaaa 3300
ATTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTT

3301 gccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggaca 3360
CGGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGT

3361 agggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatag 3420
TCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATC

NEOKAN prom(3454,3503)>>>
|
3421 ctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctct 3480
GATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGA

3481 ggtaaggttgggaagccctgcaaagtaaactggatggctttctcgccgccaaggatctga 3540
CCATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACT

NTP_II marker(3595,4383)>>>
|
ORF_1 rf(1)(3592,4386)>>>
| |
3541 tggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaa 3600
ACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTT

3601 caagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgac 3660
GTTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTG

3661 tgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcagggg 3720
ACCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCC

3721 cgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgag 3780
GCGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTC

3781 gcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgtt 3840
CGTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAA

3841 gtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctg 3900
CAGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGAC

3901 tcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctg 3960
AGTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGAC

3961 catacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcga 4020
GTATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCT

4021 gcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcag 4080
CGTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTC

4081 gggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggat 4140
CCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTA

4141 ctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttt 4200
GAGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAA

4201 tctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttg 4260
AGACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAAC

4261 gctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctt 4320
CGATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAA

4321 tacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttc 4380
ATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAG

4381 ttctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggccgaaat 4440
AAGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTA

f1 origin(4491,4796)<<<
|
4441 cggcaacatcccttataaatcaaaagaatagaccgcgatagggttgagtgttgttccagt 4500
GCCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCA

4501 ttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgt 4560
AACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCA

4561 ctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttgcggtcgag 4620
GATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTC

4621 gtgccgtaaagctctaaatcggaaccctaaagggagcccccgatttagagcttgacgggg 4680
CACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCC

4681 aaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggc 4740
TTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCG

4741 gctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgccg 4800
CGACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGC

4801 ctacagggcgcgtccattcgccattcaggatcgaattaattcttaattaacatcatcaat 4860
GATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTA

4861 aatatacctt 4870
TTATATGGAA