pPM-N-D-C-His
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
Vector NamepPM-N-D-C-His
VectorTypeProtein Vector
Antibiotic InformationKanamycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcatgaagaa
661 tctgcttagg gttaggcgtt ttgcgctgct tcgcgatgta cgggccagat atacgcgttg
721 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc
781 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa
841 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac
901 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca
961 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg
1021 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt
1081 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg
1141 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg
1201 gaaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat
1261 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctcccta tcagtgatag
1321 agatctccct atcagtgata gagatcgtcg acgagctcgt ttagtgaacc gtcagatcgc
1381 ctggagacgc catccacgct gttttgacct ccatagagct agcatggact acaaggacga
1441 cgatgacaag gactacaagg acgacgatga caaggactac aaggacgacg atgacaagag
1501 cgaaaacctg tacttccagg gagaattcga tatcctgcag agcggccgct ctagagggcc
1561 ctcgagcatc atcaccatca ccattgagtt taaaccgctg atcagcctcg actgtgcctt
1621 ctagttgcca gccatctgtt gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg
1681 ccactcccac tgtcctttcc taataaaatg aggaaattgc atcgcattgt ctgagtaggt
1741 gtcattctat tctggggggt ggggtggggc aggacagcaa gggggaggat tgggaagaca
1801 atagcaggca tgctggggat gcggtgggct ctatggcttc tgaggcggaa agaaccagca
1861 gatcgatctc tatgtcgggt gcggagaaag aggtaatgaa atggcattat gggtattatg
1921 ggtctgcatt aatgaatcgg ccaaggatcc atatgcggtg tgaaataccg cacagatgcg
1981 taaggagaaa ataccgcatc aggcgctctt ccgcttcctc gctcactgac tcgctgcgct
2041 cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca
2101 cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga
2161 accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc
2221 acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg
2281 cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat
2341 acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt
2401 atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc
2461 agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg
2521 acttatcgcc actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg
2581 gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg
2641 gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg
2701 gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca
2761 gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga
2821 acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga
2881 tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt
2941 ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt
3001 catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat
3061 ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag
3121 caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct
3181 ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt
3241 tgcgcaacgt tgttgaaaaa ggatcttcac ctagatcctt ttcacgtaga aagccagtcc
3301 gcagaaacgg tgctgacccc ggatgaatgt cagctactgg gctatctgga caagggaaaa
3361 cgcaagcgca aagagaaagc aggtagcttg cagtgggctt acatggcgat agctagactg
3421 ggcggtttta tggacagcaa gcgaaccgga attgccagct ggggcgccct ctggtaaggt
3481 tgggaagccc tgcaaagtaa actggatggc tttctcgccg ccaaggatct gatggcgcag
3541 gggatcaagc tctgatcaag agacaggatg aggatcgttt cgcatgattg aacaagatgg
3601 attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg actgggcaca
3661 acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg ggcgcccggt
3721 tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaagacg aggcagcgcg
3781 gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga
3841 agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc tgtcatctca
3901 ccttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc tgcatacgct
3961 tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc gagcacgtac
4021 tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc aggggctcgc
4081 gccagccgaa ctgttcgcca ggctcaaggc gagcatgccc gacggcgagg atctcgtcgt
4141 gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct tttctggatt
4201 catcgactgt ggccggctgg gtgtggcgga ccgctatcag gacatagcgt tggctacccg
4261 tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat
4321 cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt tcttctgaat
4381 tttgttaaaa tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaca
4441 tcccttataa atcaaaagaa tagaccgcga tagggttgag tgttgttcca gtttggaaca
4501 agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg
4561 gcgatggccc actacgtgaa ccatcaccca aatcaagttt tttgcggtcg aggtgccgta
4621 aagctctaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg
4681 cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa
4741 gtgtagcggt cacgctgcgc gtaaccacca cacccgcgcg cttaatgcgc cgctacaggg
4801 cgcgtccatt cgccattcag gatcgaatta attcttaatt aacatcatca ataatatacc
4861 tt
                                    LOCUS       dna                      4862 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
misc_binding 691..696
/dbxref="REBASE:NruI"
Regulatory_Seq 1305..1344
/gene="tetO reg"
misc_binding 1523..1528
/dbxref="REBASE:EcoRI"
misc_binding 1529..1534
/dbxref="REBASE:EcoRV"
misc_binding 1535..1540
/dbxref="REBASE:PstI"
misc_binding 1542..1549
/dbxref="REBASE:NotI"
misc_binding 1550..1555
/dbxref="REBASE:XbaI"
misc_binding 1556..1561
/dbxref="REBASE:ApaI"
misc_binding 1561..1566
/dbxref="REBASE:AvrI"
misc_binding 1561..1566
/dbxref="REBASE:XhoI"
misc_binding 1561..1566
/dbxref="REBASE:AvaI"
Tag 1567..1584
/gene="6xHis tag"
misc_binding 1862..1867
/dbxref="REBASE:ClaI"
misc_binding 1945..1950
/dbxref="REBASE:BamHI"
Rep_Origin 2174..2793
/gene="pBR322 origin"
Promoter 3446..3495
/gene="NEOKAN prom"
ORF 3584..4378
/sequence="ORF_1 rf(2)"
Marker 3587..4375
/gene="NTP_II marker"
Rep_Origin 4483..4788
/gene="f1 origin"
BASE COUNT 1204 a 1177 c 1327 g 1154 t 0 others
ORIGIN
1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcatgaagaa
661 tctgcttagg gttaggcgtt ttgcgctgct tcgcgatgta cgggccagat atacgcgttg
721 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc
781 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa
841 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac
901 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca
961 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg
1021 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt
1081 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg
1141 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg
1201 gaaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat
1261 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctcccta tcagtgatag
1321 agatctccct atcagtgata gagatcgtcg acgagctcgt ttagtgaacc gtcagatcgc
1381 ctggagacgc catccacgct gttttgacct ccatagagct agcatggact acaaggacga
1441 cgatgacaag gactacaagg acgacgatga caaggactac aaggacgacg atgacaagag
1501 cgaaaacctg tacttccagg gagaattcga tatcctgcag agcggccgct ctagagggcc
1561 ctcgagcatc atcaccatca ccattgagtt taaaccgctg atcagcctcg actgtgcctt
1621 ctagttgcca gccatctgtt gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg
1681 ccactcccac tgtcctttcc taataaaatg aggaaattgc atcgcattgt ctgagtaggt
1741 gtcattctat tctggggggt ggggtggggc aggacagcaa gggggaggat tgggaagaca
1801 atagcaggca tgctggggat gcggtgggct ctatggcttc tgaggcggaa agaaccagca
1861 gatcgatctc tatgtcgggt gcggagaaag aggtaatgaa atggcattat gggtattatg
1921 ggtctgcatt aatgaatcgg ccaaggatcc atatgcggtg tgaaataccg cacagatgcg
1981 taaggagaaa ataccgcatc aggcgctctt ccgcttcctc gctcactgac tcgctgcgct
2041 cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca
2101 cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga
2161 accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc
2221 acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg
2281 cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat
2341 acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt
2401 atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc
2461 agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg
2521 acttatcgcc actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg
2581 gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg
2641 gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg
2701 gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca
2761 gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga
2821 acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga
2881 tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt
2941 ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt
3001 catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat
3061 ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag
3121 caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct
3181 ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt
3241 tgcgcaacgt tgttgaaaaa ggatcttcac ctagatcctt ttcacgtaga aagccagtcc
3301 gcagaaacgg tgctgacccc ggatgaatgt cagctactgg gctatctgga caagggaaaa
3361 cgcaagcgca aagagaaagc aggtagcttg cagtgggctt acatggcgat agctagactg
3421 ggcggtttta tggacagcaa gcgaaccgga attgccagct ggggcgccct ctggtaaggt
3481 tgggaagccc tgcaaagtaa actggatggc tttctcgccg ccaaggatct gatggcgcag
3541 gggatcaagc tctgatcaag agacaggatg aggatcgttt cgcatgattg aacaagatgg
3601 attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg actgggcaca
3661 acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg ggcgcccggt
3721 tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaagacg aggcagcgcg
3781 gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga
3841 agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc tgtcatctca
3901 ccttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc tgcatacgct
3961 tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc gagcacgtac
4021 tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc aggggctcgc
4081 gccagccgaa ctgttcgcca ggctcaaggc gagcatgccc gacggcgagg atctcgtcgt
4141 gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct tttctggatt
4201 catcgactgt ggccggctgg gtgtggcgga ccgctatcag gacatagcgt tggctacccg
4261 tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat
4321 cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt tcttctgaat
4381 tttgttaaaa tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaca
4441 tcccttataa atcaaaagaa tagaccgcga tagggttgag tgttgttcca gtttggaaca
4501 agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg
4561 gcgatggccc actacgtgaa ccatcaccca aatcaagttt tttgcggtcg aggtgccgta
4621 aagctctaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg
4681 cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa
4741 gtgtagcggt cacgctgcgc gtaaccacca cacccgcgcg cttaatgcgc cgctacaggg
4801 cgcgtccatt cgccattcag gatcgaatta attcttaatt aacatcatca ataatatacc
4861 tt
//
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaagctcagatctggatctcccgatcccctatggtcgactctcagtacaatctgctc 540
CGCTTTCGAGTCTAGACCTAGAGGGCTAGGGGATACCAGCTGAGAGTCATGTTAGACGAG

541 tgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagta 600
ACTACGGCGTATCAATTCGGTCATAGACGAGGGACGAACACACAACCTCCAGCGACTCAT

601 gtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaa 660
CACGCGCTCGTTTTAAATTCGATGTTGTTCCGTTCCGAACTGGCTGTTAACGTACTTCTT

NruI
|
661 tctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttg 720
AGACGAATCCCAATCCGCAAAACGCGACGAAGCGCTACATGCCCGGTCTATATGCGCAAC

721 acattgattattgactagttattaatagtaatcaattacggggtcattagttcatagccc 780
TGTAACTAATAACTGATCAATAATTATCATTAGTTAATGCCCCAGTAATCAAGTATCGGG

781 atatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaa 840
TATATACCTCAAGGCGCAATGTATTGAATGCCATTTACCGGGCGGACCGACTGGCGGGTT

841 cgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggac 900
GCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAAGGGTATCATTGCGGTTATCCCTG

901 tttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatca 960
AAAGGTAACTGCAGTTACCCACCTCATAAATGCCATTTGACGGGTGAACCGTCATGTAGT

961 agtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctg 1020
TCACATAGTATACGGTTCATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGAC

1021 gcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtatt 1080
CGTAATACGGGTCATGTACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCATAA

1081 agtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcg 1140
TCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCATGTAGTTACCCGCACCTATCGC

1141 gtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttg 1200
CAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAACTGCAGTTACCCTCAAACAAAAC

1201 gaaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaat 1260
CTTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGTTGAGGCGGGGTAACTGCGTTTA

tetO reg(1305,1344)>>>
|
1261 gggcggtaggcgtgtacggtgggaggtctatataagcagagctctccctatcagtgatag 1320
CCCGCCATCCGCACATGCCACCCTCCAGATATATTCGTCTCGAGAGGGATAGTCACTATC

1321 agatctccctatcagtgatagagatcgtcgacgagctcgtttagtgaaccgtcagatcgc 1380
TCTAGAGGGATAGTCACTATCTCTAGCAGCTGCTCGAGCAAATCACTTGGCAGTCTAGCG

1381 ctggagacgccatccacgctgttttgacctccatagagctagcatggactacaaggacga 1440
GACCTCTGCGGTAGGTGCGACAAAACTGGAGGTATCTCGATCGTACCTGATGTTCCTGCT

1441 cgatgacaaggactacaaggacgacgatgacaaggactacaaggacgacgatgacaagag 1500
GCTACTGTTCCTGATGTTCCTGCTGCTACTGTTCCTGATGTTCCTGCTGCTACTGTTCTC

NotI
|
EcoRI EcoRV PstI XbaI
| | | | |
1501 cgaaaacctgtacttccagggagaattcgatatcctgcagagcggccgctctagagggcc 1560
GCTTTTGGACATGAAGGTCCCTCTTAAGCTATAGGACGTCTCGCCGGCGAGATCTCCCGG

AvrI
|
AvaI
|
XhoI
|
ApaI 6xHis tag(1567,1584)>>>
|| |
1561 ctcgagcatcatcaccatcaccattgagtttaaaccgctgatcagcctcgactgtgcctt 1620
GAGCTCGTAGTAGTGGTAGTGGTAACTCAAATTTGGCGACTAGTCGGAGCTGACACGGAA

1621 ctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtg 1680
GATCAACGGTCGGTAGACAACAAACGGGGAGGGGGCACGGAAGGAACTGGGACCTTCCAC

1681 ccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggt 1740
GGTGAGGGTGACAGGAAAGGATTATTTTACTCCTTTAACGTAGCGTAACAGACTCATCCA

1741 gtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagaca 1800
CAGTAAGATAAGACCCCCCACCCCACCCCGTCCTGTCGTTCCCCCTCCTAACCCTTCTGT

1801 atagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagca 1860
TATCGTCCGTACGACCCCTACGCCACCCGAGATACCGAAGACTCCGCCTTTCTTGGTCGT

ClaI
|
1861 gatcgatctctatgtcgggtgcggagaaagaggtaatgaaatggcattatgggtattatg 1920
CTAGCTAGAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGTAATACCCATAATAC

BamHI
|
1921 ggtctgcattaatgaatcggccaaggatccatatgcggtgtgaaataccgcacagatgcg 1980
CCAGACGTAATTACTTAGCCGGTTCCTAGGTATACGCCACACTTTATGGCGTGTCTACGC

1981 taaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgct 2040
ATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGA

2041 cggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatcca 2100
GCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGT

2101 cagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccagga 2160
GTCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCT

pBR322 origin(2174,2793)<<<
|
2161 accgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatc 2220
TGGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAG

2221 acaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccagg 2280
TGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCC

2281 cgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggat 2340
GCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTA

2341 acctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggt 2400
TGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCA

2401 atctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttc 2460
TAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAG

2461 agcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacg 2520
TCGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGC

2521 acttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg 2580
TGAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGC

2581 gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttg 2640
CACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAAC

2641 gtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccg 2700
CATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGC

2701 gcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgca 2760
CGTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGT

2761 gaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtgga 2820
CTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCT

2821 acgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctaga 2880
TGCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCT

2881 tccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggt 2940
AGGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCA

2941 ctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgtt 3000
GACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAA

3001 catccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccat 3060
GTAGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTA

3061 ctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcag 3120
GACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTC

3121 caataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcct 3180
GTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGA

3181 ccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtt 3240
GGTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAA

3241 tgcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgtagaaagccagtcc 3300
ACGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGG

3301 gcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaa 3360
CGTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTT

3361 cgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactg 3420
GCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGAC

NEOKAN prom(3446,3495)>>>
|
3421 ggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggt 3480
CCGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCA

3481 tgggaagccctgcaaagtaaactggatggctttctcgccgccaaggatctgatggcgcag 3540
ACCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTC

NTP_II marker(3587,4375)>>>
|
ORF_1 rf(2)(3584,4378)>>>
| |
3541 gggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatgg 3600
CCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACC

3601 attgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcaca 3660
TAACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGT

3661 acagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggt 3720
TGTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCA

3721 tctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcg 3780
AGAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGC

3781 gctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactga 3840
CGATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACT

3841 agcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctca 3900
TCGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGT

3901 ccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgct 3960
GGAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGA

3961 tgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtac 4020
ACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATG

4021 tcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgc 4080
AGCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCG

4081 gccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgt 4140
CGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCA

4141 gacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggatt 4200
CTGGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAA

4201 catcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccg 4260
GTAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGC

4261 tgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtat 4320
ACTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATA

4321 cgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaat 4380
GCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTA

4381 tttgttaaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaca 4440
AAACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGT

f1 origin(4483,4788)<<<
|
4441 tcccttataaatcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaaca 4500
AGGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGT

4501 agagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagg 4560
TCTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCC

4561 gcgatggcccactacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgta 4620
CGCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCAT

4621 aagctctaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccgg 4680
TTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCC

4681 cgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaa 4740
GCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTT

4741 gtgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacaggg 4800
CACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCC

4801 cgcgtccattcgccattcaggatcgaattaattcttaattaacatcatcaataatatacc 4860
GCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGG

4861 tt 4862
AA