pPromoter
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepPromoter
VectorTypePlasmid
Antibiotic InformationKanamycin
Sequencing PrimersSequencing Primer (511-531)
5`---CCTATGGTCGACTCTCAGTA ---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1       ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt  60
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa 120
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg 180
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt 240
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg 300
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag 360
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 420
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta 480
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc 540
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta 600
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcttaagatt 660
661 taaataagct tggtaccgag ctcggatcca ctagtccagt gtggtggaat tctgcagata 720
721 tccagcacag tggcggccgc tcgagtctag agggcccgtt taaaccgctg atcagcctcg 780
781 actgtgcctt ctagttgcca gccatctgtt gttgcccggg cgcgatcgct gcccctcccc 840
841 cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat aaaatgagga 900
901 aattgcatcg cattgtctga gtaggtgtca ttctattctg gggggtgggg tggggcagga 960
961 cagcaagggg gaggattggg aagacaatag caggcatgct ggggatgcgg tgggctctat 1020
1021 ggcttctgag gcggaaagaa ccagcagatc gatctgcatc tatgtcgggt gcggagaaag 1080
1081 aggtaatgaa atggcattat gggtattatg ggtctgcatt aatgaatcgg ccaacggatc 1140
1141 ccggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc 1200
1201 ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca 1260
1261 ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg 1320
1321 agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca 1380
1381 taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa 1440
1441 cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc 1500
1501 tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc 1560
1561 gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct 1620
1621 gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg 1680
1681 tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag 1740
1741 gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta 1800
1801 cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg 1860
1861 aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt 1920
1921 tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt 1980
1981 ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag 2040
2041 attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat 2100
2101 ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc 2160
2161 tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat 2220
2221 aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc 2280
2281 acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag 2340
2341 aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag 2400
2401 agtaagtagt tcgccagtta atagtttgcg caacgttgtt gaaaaaggat cttcacctag 2460
2461 atccttttca cgtagaaagc cagtccgcag aaacggtgct gaccccggat gaatgtcagc 2520
2521 tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt agcttgcagt 2580
2581 gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga accggaattg 2640
2641 ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg gatggctttc 2700
2701 tcgccgccaa ggatctgatg gcgcagggga tcaagctctg atcaagagac aggatgagga 2760
2761 tcgtttcgca tgattgaaca agatggattg cacgcaggtt ctccggccgc ttgggtggag 2820
2821 aggctattcg gctatgactg ggcacaacag acaatcggct gctctgatgc cgccgtgttc 2880
2881 cggctgtcag cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc cggtgccctg 2940
2941 aatgaactgc aagacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc 3000
3001 gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt gggcgaagtg 3060
3061 ccggggcagg atctcctgtc atctcacctt gctcctgccg agaaagtatc catcatggct 3120
3121 gatgcaatgc ggcggctgca tacgcttgat ccggctacct gcccattcga ccaccaagcg 3180
3181 aaacatcgca tcgagcgagc acgtactcgg atggaagccg gtcttgtcga tcaggatgat 3240
3241 ctggacgaag agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgagc 3300
3301 atgcccgacg gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc gaatatcatg 3360
3361 gtggaaaatg gccgcttttc tggattcatc gactgtggcc ggctgggtgt ggcggaccgc 3420
3421 tatcaggaca tagcgttggc tacccgtgat attgctgaag agcttggcgg cgaatgggct 3480
3481 gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat cgccttctat 3540
3541 cgccttcttg acgagttctt ctgaattttg ttaaaatttt tgttaaatca gctcattttt 3600
3601 taaccaatag gccgaaatcg gcaacatccc ttataaatca aaagaataga ccgcgatagg 3660
3661 gttgagtgtt gttccagttt ggaacaagag tccactatta aagaacgtgg actccaacgt 3720
3721 caaagggcga aaaaccgtct atcagggcga tggcccacta cgtgaaccat cacccaaatc 3780
3781 aagttttttg cggtcgaggt gccgtaaagc tctaaatcgg aaccctaaag ggagcccccg 3840
3841 atttagagct tgacggggaa agccggcgaa cgtggcgaga aaggaaggga agaaagcgaa 3900
3901 aggagcgggc gctagggcgc tggcaagtgt agcggtcacg ctgcgcgtaa ccaccacacc 3960
3961 cgcgcgctta atgcgccgct acagggcgcg tccattcgcc attcaggatc gaattaattc 4020
4021 ttaattaaca tcatcaataa tatacctt 4048
                                    LOCUS       dna                      4048 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
misc_binding 491..496
/dbxref="REBASE:BglII"
misc_binding 517..522
/dbxref="REBASE:AccI"
misc_binding 666..671
/dbxref="REBASE:HindIII"
misc_binding 672..677
/dbxref="REBASE:KpnI"
misc_binding 678..683
/dbxref="REBASE:SacI"
misc_binding 707..712
/dbxref="REBASE:EcoRI"
misc_binding 712..717
/dbxref="REBASE:PstI"
misc_binding 717..722
/dbxref="REBASE:EcoRV"
misc_binding 733..740
/dbxref="REBASE:NotI"
misc_binding 740..745
/dbxref="REBASE:XhoI"
misc_binding 746..751
/dbxref="REBASE:XbaI"
misc_binding 752..757
/dbxref="REBASE:ApaI"
misc_binding 815..820
/dbxref="REBASE:SmaI"
misc_binding 815..820
/dbxref="REBASE:XmaI"
misc_binding 1048..1053
/dbxref="REBASE:ClaI"
Rep_Origin 1360..1979
/gene="pBR322 origin"
misc_binding 2321..2331
/dbxref="REBASE:BglI"
Promoter 2632..2681
/gene="NEOKAN prom"
selectable_marker769..3561
/gene="Kan"
ORF 2770..3564
/sequence="ORF_1 rf(1)"
Marker 2773..3561
/gene="NTP_II marker"
misc_binding 3330..3335
/dbxref="REBASE:NcoI"
Rep_Origin 3669..3974
/gene="f1 origin"
BASE COUNT 983 a 983 c 1134 g 948 t 0 others
ORIGIN
1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcttaagatt
661 taaataagct tggtaccgag ctcggatcca ctagtccagt gtggtggaat tctgcagata
721 tccagcacag tggcggccgc tcgagtctag agggcccgtt taaaccgctg atcagcctcg
781 actgtgcctt ctagttgcca gccatctgtt gttgcccggg cgcgatcgct gcccctcccc
841 cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat aaaatgagga
901 aattgcatcg cattgtctga gtaggtgtca ttctattctg gggggtgggg tggggcagga
961 cagcaagggg gaggattggg aagacaatag caggcatgct ggggatgcgg tgggctctat
1021 ggcttctgag gcggaaagaa ccagcagatc gatctgcatc tatgtcgggt gcggagaaag
1081 aggtaatgaa atggcattat gggtattatg ggtctgcatt aatgaatcgg ccaacggatc
1141 ccggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc
1201 ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca
1261 ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg
1321 agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca
1381 taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa
1441 cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc
1501 tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc
1561 gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct
1621 gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg
1681 tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag
1741 gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta
1801 cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg
1861 aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt
1921 tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt
1981 ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag
2041 attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat
2101 ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc
2161 tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat
2221 aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc
2281 acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag
2341 aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag
2401 agtaagtagt tcgccagtta atagtttgcg caacgttgtt gaaaaaggat cttcacctag
2461 atccttttca cgtagaaagc cagtccgcag aaacggtgct gaccccggat gaatgtcagc
2521 tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt agcttgcagt
2581 gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga accggaattg
2641 ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg gatggctttc
2701 tcgccgccaa ggatctgatg gcgcagggga tcaagctctg atcaagagac aggatgagga
2761 tcgtttcgca tgattgaaca agatggattg cacgcaggtt ctccggccgc ttgggtggag
2821 aggctattcg gctatgactg ggcacaacag acaatcggct gctctgatgc cgccgtgttc
2881 cggctgtcag cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc cggtgccctg
2941 aatgaactgc aagacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc
3001 gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt gggcgaagtg
3061 ccggggcagg atctcctgtc atctcacctt gctcctgccg agaaagtatc catcatggct
3121 gatgcaatgc ggcggctgca tacgcttgat ccggctacct gcccattcga ccaccaagcg
3181 aaacatcgca tcgagcgagc acgtactcgg atggaagccg gtcttgtcga tcaggatgat
3241 ctggacgaag agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgagc
3301 atgcccgacg gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc gaatatcatg
3361 gtggaaaatg gccgcttttc tggattcatc gactgtggcc ggctgggtgt ggcggaccgc
3421 tatcaggaca tagcgttggc tacccgtgat attgctgaag agcttggcgg cgaatgggct
3481 gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat cgccttctat
3541 cgccttcttg acgagttctt ctgaattttg ttaaaatttt tgttaaatca gctcattttt
3601 taaccaatag gccgaaatcg gcaacatccc ttataaatca aaagaataga ccgcgatagg
3661 gttgagtgtt gttccagttt ggaacaagag tccactatta aagaacgtgg actccaacgt
3721 caaagggcga aaaaccgtct atcagggcga tggcccacta cgtgaaccat cacccaaatc
3781 aagttttttg cggtcgaggt gccgtaaagc tctaaatcgg aaccctaaag ggagcccccg
3841 atttagagct tgacggggaa agccggcgaa cgtggcgaga aaggaaggga agaaagcgaa
3901 aggagcgggc gctagggcgc tggcaagtgt agcggtcacg ctgcgcgtaa ccaccacacc
3961 cgcgcgctta atgcgccgct acagggcgcg tccattcgcc attcaggatc gaattaattc
4021 ttaattaaca tcatcaataa tatacctt
//
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

BglII AccI
| |
481 gcgaaagctcagatctggatctcccgatcccctatggtcgactctcagtacaatctgctc 540
CGCTTTCGAGTCTAGACCTAGAGGGCTAGGGGATACCAGCTGAGAGTCATGTTAGACGAG

541 tgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagta 600
ACTACGGCGTATCAATTCGGTCATAGACGAGGGACGAACACACAACCTCCAGCGACTCAT

601 gtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcttaagatt 660
CACGCGCTCGTTTTAAATTCGATGTTGTTCCGTTCCGAACTGGCTGTTAACGAATTCTAA

HindIII KpnI SacI EcoRI PstI
| | | | |
661 taaataagcttggtaccgagctcggatccactagtccagtgtggtggaattctgcagata 720
ATTTATTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGACGTCTAT

EcoRV NotI XhoI XbaI ApaI
| | | | |
721 tccagcacagtggcggccgctcgagtctagagggcccgtttaaaccgctgatcagcctcg 780
AGGTCGTGTCACCGCCGGCGAGCTCAGATCTCCCGGGCAAATTTGGCGACTAGTCGGAGC

SmaI
|
XmaI
| |
781 actgtgccttctagttgccagccatctgttgttgcccgggcgcgatcgctgcccctcccc 840
TGACACGGAAGATCAACGGTCGGTAGACAACAACGGGCCCGCGCTAGCGACGGGGAGGGG

841 cgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgagga 900
GCACGGAAGGAACTGGGACCTTCCACGGTGAGGGTGACAGGAAAGGATTATTTTACTCCT

901 aattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcagga 960
TTAACGTAGCGTAACAGACTCATCCACAGTAAGATAAGACCCCCCACCCCACCCCGTCCT

961 cagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctat 1020
GTCGTTCCCCCTCCTAACCCTTCTGTTATCGTCCGTACGACCCCTACGCCACCCGAGATA

ClaI
|
1021 ggcttctgaggcggaaagaaccagcagatcgatctgcatctatgtcgggtgcggagaaag 1080
CCGAAGACTCCGCCTTTCTTGGTCGTCTAGCTAGACGTAGATACAGCCCACGCCTCTTTC

1081 aggtaatgaaatggcattatgggtattatgggtctgcattaatgaatcggccaacggatc 1140
TCCATTACTTTACCGTAATACCCATAATACCCAGACGTAATTACTTAGCCGGTTGCCTAG

1141 ccggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgc 1200
GGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCG

1201 ttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctca 1260
AAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCCGACGCCGCTCGCCATAGTCGAGT

1261 ctcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtg 1320
GAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCCCTATTGCGTCCTTTCTTGTACAC

pBR322 origin(1360,1979)<<<
|
1321 agcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttcca 1380
TCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCCGGCGCAACGACCGCAAAAAGGT

1381 taggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaa 1440
ATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTT

1441 cccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcc 1500
GGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCACGCGAGAGG

1501 tgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggc 1560
ACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCCTTCGCACCG

1561 gctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagct 1620
CGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGCCACATCCAGCAAGCGAGGTTCGA

1621 gggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcg 1680
CCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCCATTGATAGC

1681 tcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacag 1740
AGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTGACCATTGTC

1741 gattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaacta 1800
CTAATCGTCTCGCTCCATACATCCGCCACGATGTCTCAAGAACTTCACCACCGGATTGAT

1801 cggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcgg 1860
GCCGATGTGATCTTCCTGTCATAAACCATAGACGCGAGACGACTTCGGTCAATGGAAGCC

1861 aaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttt 1920
TTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCACCAAAAAA

1921 tgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatctt 1980
ACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAA

1981 ttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgag 2040
AAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGTGCAATTCCCTAAAACCAGTACTC

2041 attatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaat 2100
TAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTAATTTTTACTTCAAAATTTAGTTA

2101 ctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacc 2160
GATTTCATATATACTCATTTGAACCAGACTGTCAATGGTTACGAATTAGTCACTCCGTGG

2161 tatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagat 2220
ATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAACGGACTGAGGGGCAGCACATCTA

2221 aactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagaccc 2280
TTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCACGACGTTACTATGGCGCTCTGGG

BglI
|
2281 acgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcag 2340
TGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTC

2341 aagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctag 2400
TTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGATAATTAACAACGGCCCTTCGATC

2401 agtaagtagttcgccagttaatagtttgcgcaacgttgttgaaaaaggatcttcacctag 2460
TCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAACAACTTTTTCCTAGAAGTGGATC

2461 atccttttcacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagc 2520
TAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCACGACTGGGGCCTACTTACAGTCG

2521 tactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagt 2580
ATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTTTCTCTTTCGTCCATCGAACGTCA

NEOKAN prom(2632,2681)>>>
|
2581 gggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattg 2640
CCCGAATGTACCGCTATCGATCTGACCCGCCAAAATACCTGTCGTTCGCTTGGCCTTAAC

2641 ccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttc 2700
GGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGACGTTTCATTTGACCTACCGAAAG

2701 tcgccgccaaggatctgatggcgcaggggatcaagctctgatcaagagacaggatgagga 2760
AGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGAGACTAGTTCTCTGTCCTACTCCT

NTP_II marker(2773,3561)>>>
|
ORF_1 rf(1)(2770,3564)>>>
| |
Kan(2769,3561)>>>
|| |
2761 tcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggag 2820
AGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTCCAAGAGGCCGGCGAACCCACCTC

2821 aggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttc 2880
TCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGCCGACGAGACTACGGCGGCACAAG

2881 cggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctg 2940
GCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGTTCTGGCTGGACAGGCCACGGGAC

2941 aatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgc 3000
TTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCGACCGGTGCTGCCCGCAAGGAACG

3001 gcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtg 3060
CGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCCTGACCGACGATAACCCGCTTCAC

3061 ccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggct 3120
GGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGACGGCTCTTTCATAGGTAGTACCGA

3121 gatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcg 3180
CTACGTTACGCCGCCGACGTATGCGAACTAGGCCGATGGACGGGTAAGCTGGTGGTTCGC

3181 aaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgat 3240
TTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTCGGCCAGAACAGCTAGTCCTACTA

3241 ctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagc 3300
GACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCG

NcoI
|
3301 atgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatg 3360
TACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGCTACGGACGAACGGCTTATAGTAC

3361 gtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgc 3420
CACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACACCGGCCGACCCACACCGCCTGGCG

3421 tatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggct 3480
ATAGTCCTGTATCGCAACCGATGGGCACTATAACGACTTCTCGAACCGCCGCTTACCCGA

3481 gaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctat 3540
CTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATA

3541 cgccttcttgacgagttcttctgaattttgttaaaatttttgttaaatcagctcattttt 3600
GCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTAAAAACAATTTAGTCGAGTAAAAA

3601 taaccaataggccgaaatcggcaacatcccttataaatcaaaagaatagaccgcgatagg 3660
ATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTTAGTTTTCTTATCTGGCGCTATCC

f1 origin(3669,3974)<<<
|
3661 gttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgt 3720
CAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGATAATTTCTTGCACCTGAGGTTGCA

3721 caaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcacccaaatc 3780
GTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGTGATGCACTTGGTAGTGGGTTTAG

3781 aagttttttgcggtcgaggtgccgtaaagctctaaatcggaaccctaaagggagcccccg 3840
TTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTAGCCTTGGGATTTCCCTCGGGGGC

3841 atttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaa 3900
TAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTT

3901 aggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacc 3960
TCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAGTGCGACGCGCATTGGTGGTGTGG

3961 cgcgcgcttaatgcgccgctacagggcgcgtccattcgccattcaggatcgaattaattc 4020
GCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAG

4021 ttaattaacatcatcaataatatacctt 4048
AATTAATTGTAGTAGTTATTATATGGAA

                                    	Misc. Feature (4 total)
I-Ceu I
Start: 459 End: 484
PI-Sce I
Start: 1058 End: 1096
Ori
Start: 1251 End: 2030
Kan
Start: 2770 End: 3561