pShuttle(-)
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepShuttle(-)
VectorTypePlasmid
Antibiotic InformationKanamycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcatgaagaa
661 tctgcttagg gttaggcgtt ttgcgctgct tcgcgatgta cgggccagat atacgcgttg
721 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc
781 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa
841 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac
901 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca
961 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg
1021 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt
1081 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg
1141 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg
1201 gaaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat
1261 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctcccta tcagtgatag
1321 agatctccct atcagtgata gagatcgtcg acgagctcgt ttagtgaacc gtcagatcgc
1381 ctggagacgc catccacgct gttttgacct ccatagaagc tagcgtttaa acgggccctc
                                    LOCUS       dna                      4801 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
promoter 651..1392
/gene="CMV"
misc_binding 691..696
/dbxref="REBASE:NruI"
misc_binding 968..973
/dbxref="REBASE:NdeI"
Regulatory_Seq 1305..1344
/gene="tetO reg"
misc_binding 1433..1438
/dbxref="REBASE:ApaI"
misc_binding 1439..1444
/dbxref="REBASE:XbaI"
misc_binding 1445..1450
/dbxref="REBASE:AvrI"
misc_binding 1445..1450
/dbxref="REBASE:XhoI"
misc_binding 1445..1450
/dbxref="REBASE:AvaI"
misc_binding 1450..1457
/dbxref="REBASE:NotI"
misc_binding 1468..1473
/dbxref="REBASE:EcoRV"
misc_binding 1473..1478
/dbxref="REBASE:PstI"
misc_binding 1478..1483
/dbxref="REBASE:EcoRI"
misc_binding 1513..1518
/dbxref="REBASE:KpnI"
misc_binding 1519..1524
/dbxref="REBASE:HindIII"
misc_binding 1801..1806
/dbxref="REBASE:ClaI"
Rep_Origin 2113..2732
/gene="pBR322 origin"
Promoter 3385..3434
/gene="NEOKAN prom"
ORF 3523..4317
/sequence="ORF_1 rf(1)"
Marker 3526..4314
/gene="NTP_II marker"
selectable_marker531..4323
/gene="Kan"
Rep_Origin 4422..4727
/gene="f1 origin"
BASE COUNT 1173 a 1167 c 1310 g 1151 t 0 others
ORIGIN
1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcatgaagaa
661 tctgcttagg gttaggcgtt ttgcgctgct tcgcgatgta cgggccagat atacgcgttg
721 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc
781 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa
841 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac
901 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca
961 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg
1021 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt
1081 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg
1141 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg
1201 gaaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat
1261 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctcccta tcagtgatag
1321 agatctccct atcagtgata gagatcgtcg acgagctcgt ttagtgaacc gtcagatcgc
1381 ctggagacgc catccacgct gttttgacct ccatagaagc tagcgtttaa acgggccctc
1441 tagactcgag cggccgccac tgtgctggat atctgcagaa ttccaccaca ctggactagt
1501 ggatccgagc tcggtaccaa gcttaagttt aaaccgctga tcagcctcga ctgtgccttc
1561 tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc
1621 cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc tgagtaggtg
1681 tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt gggaagacaa
1741 tagcaggcat gctggggatg cggtgggctc tatggcttct gaggcggaaa gaaccagcag
1801 atcgatctgc atctatgtcg ggtgcggaga aagaggtaat gaaatggcat tatgggtatt
1861 atgggtctgc attaatgaat cggccaacgg atcccggtgt gaaataccgc acagatgcgt
1921 aaggagaaaa taccgcatca ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc
1981 ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac
2041 agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa
2101 ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca
2161 caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc
2221 gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata
2281 cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta
2341 tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca
2401 gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga
2461 cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg
2521 tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg
2581 tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg
2641 caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag
2701 aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa
2761 cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat
2821 ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc
2881 tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc
2941 atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc
3001 tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc
3061 aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc
3121 catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt
3181 gcgcaacgtt gttgaaaaag gatcttcacc tagatccttt tcacgtagaa agccagtccg
3241 cagaaacggt gctgaccccg gatgaatgtc agctactggg ctatctggac aagggaaaac
3301 gcaagcgcaa agagaaagca ggtagcttgc agtgggctta catggcgata gctagactgg
3361 gcggttttat ggacagcaag cgaaccggaa ttgccagctg gggcgccctc tggtaaggtt
3421 gggaagccct gcaaagtaaa ctggatggct ttctcgccgc caaggatctg atggcgcagg
3481 ggatcaagct ctgatcaaga gacaggatga ggatcgtttc gcatgattga acaagatgga
3541 ttgcacgcag gttctccggc cgcttgggtg gagaggctat tcggctatga ctgggcacaa
3601 cagacaatcg gctgctctga tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt
3661 ctttttgtca agaccgacct gtccggtgcc ctgaatgaac tgcaagacga ggcagcgcgg
3721 ctatcgtggc tggccacgac gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa
3781 gcgggaaggg actggctgct attgggcgaa gtgccggggc aggatctcct gtcatctcac
3841 cttgctcctg ccgagaaagt atccatcatg gctgatgcaa tgcggcggct gcatacgctt
3901 gatccggcta cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact
3961 cggatggaag ccggtcttgt cgatcaggat gatctggacg aagagcatca ggggctcgcg
4021 ccagccgaac tgttcgccag gctcaaggcg agcatgcccg acggcgagga tctcgtcgtg
4081 acccatggcg atgcctgctt gccgaatatc atggtggaaa atggccgctt ttctggattc
4141 atcgactgtg gccggctggg tgtggcggac cgctatcagg acatagcgtt ggctacccgt
4201 gatattgctg aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc
4261 gccgctcccg attcgcagcg catcgccttc tatcgccttc ttgacgagtt cttctgaatt
4321 ttgttaaaat ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa tcggcaacat
4381 cccttataaa tcaaaagaat agaccgcgat agggttgagt gttgttccag tttggaacaa
4441 gagtccacta ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg
4501 cgatggccca ctacgtgaac catcacccaa atcaagtttt ttgcggtcga ggtgccgtaa
4561 agctctaaat cggaacccta aagggagccc ccgatttaga gcttgacggg gaaagccggc
4621 gaacgtggcg agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag
4681 tgtagcggtc acgctgcgcg taaccaccac acccgcgcgc ttaatgcgcc gctacagggc
4741 gcgtccattc gccattcagg atcgaattaa ttcttaatta acatcatcaa taatatacct
4801 t

***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaagctcagatctggatctcccgatcccctatggtcgactctcagtacaatctgctc 540
CGCTTTCGAGTCTAGACCTAGAGGGCTAGGGGATACCAGCTGAGAGTCATGTTAGACGAG

541 tgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagta 600
ACTACGGCGTATCAATTCGGTCATAGACGAGGGACGAACACACAACCTCCAGCGACTCAT

CMV(651,1392)>>>
|
601 gtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaa 660
CACGCGCTCGTTTTAAATTCGATGTTGTTCCGTTCCGAACTGGCTGTTAACGTACTTCTT

NruI
|
661 tctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttg 720
AGACGAATCCCAATCCGCAAAACGCGACGAAGCGCTACATGCCCGGTCTATATGCGCAAC

721 acattgattattgactagttattaatagtaatcaattacggggtcattagttcatagccc 780
TGTAACTAATAACTGATCAATAATTATCATTAGTTAATGCCCCAGTAATCAAGTATCGGG

781 atatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaa 840
TATATACCTCAAGGCGCAATGTATTGAATGCCATTTACCGGGCGGACCGACTGGCGGGTT

841 cgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggac 900
GCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAAGGGTATCATTGCGGTTATCCCTG

901 tttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatca 960
AAAGGTAACTGCAGTTACCCACCTCATAAATGCCATTTGACGGGTGAACCGTCATGTAGT

NdeI
|
961 agtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctg 1020
TCACATAGTATACGGTTCATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGAC

1021 gcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtatt 1080
CGTAATACGGGTCATGTACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCATAA

1081 agtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcg 1140
TCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCATGTAGTTACCCGCACCTATCGC

1141 gtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttg 1200
CAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAACTGCAGTTACCCTCAAACAAAAC

1201 gaaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaat 1260
CTTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGTTGAGGCGGGGTAACTGCGTTTA

tetO reg(1305,1344)>>>
|
1261 gggcggtaggcgtgtacggtgggaggtctatataagcagagctctccctatcagtgatag 1320
CCCGCCATCCGCACATGCCACCCTCCAGATATATTCGTCTCGAGAGGGATAGTCACTATC

1321 agatctccctatcagtgatagagatcgtcgacgagctcgtttagtgaaccgtcagatcgc 1380
TCTAGAGGGATAGTCACTATCTCTAGCAGCTGCTCGAGCAAATCACTTGGCAGTCTAGCG

ApaI
|
1381 ctggagacgccatccacgctgttttgacctccatagaagctagcgtttaaacgggccctc 1440
GACCTCTGCGGTAGGTGCGACAAAACTGGAGGTATCTTCGATCGCAAATTTGCCCGGGAG

AvrI
|
AvaI EcoRI
| |
XbaI XhoI NotI EcoRV PstI
| | | | ||
1441 tagactcgagcggccgccactgtgctggatatctgcagaattccaccacactggactagt 1500
ATCTGAGCTCGCCGGCGGTGACACGACCTATAGACGTCTTAAGGTGGTGTGACCTGATCA

HindIII
|
KpnI
| |
1501 ggatccgagctcggtaccaagcttaagtttaaaccgctgatcagcctcgactgtgccttc 1560
CCTAGGCTCGAGCCATGGTTCGAATTCAAATTTGGCGACTAGTCGGAGCTGACACGGAAG

1561 tagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgc 1620
ATCAACGGTCGGTAGACAACAAACGGGGAGGGGGCACGGAAGGAACTGGGACCTTCCACG

1621 cactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtg 1680
GTGAGGGTGACAGGAAAGGATTATTTTACTCCTTTAACGTAGCGTAACAGACTCATCCAC

1681 tcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaa 1740
AGTAAGATAAGACCCCCCACCCCACCCCGTCCTGTCGTTCCCCCTCCTAACCCTTCTGTT

1741 tagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagcag 1800
ATCGTCCGTACGACCCCTACGCCACCCGAGATACCGAAGACTCCGCCTTTCTTGGTCGTC

ClaI
|
1801 atcgatctgcatctatgtcgggtgcggagaaagaggtaatgaaatggcattatgggtatt 1860
TAGCTAGACGTAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGTAATACCCATAA

1861 atgggtctgcattaatgaatcggccaacggatcccggtgtgaaataccgcacagatgcgt 1920
TACCCAGACGTAATTACTTAGCCGGTTGCCTAGGGCCACACTTTATGGCGTGTCTACGCA

1921 aaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctc 1980
TTCCTCTTTTATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAG

1981 ggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccac 2040
CCAGCAAGCCGACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTG

2041 agaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaa 2100
TCTTAGTCCCCTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTT

pBR322 origin(2113,2732)<<<
|
2101 ccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatca 2160
GGCATTTTTCCGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGT

2161 caaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggc 2220
GTTTTTAGCTGCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCG

2221 gtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggata 2280
CAAAGGGGGACCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTAT

2281 cctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggta 2340
GGACAGGCGGAAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCAT

2341 tctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttca 2400
AGAGTCAAGCCACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGT

2401 gcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacga 2460
CGGGCTGGCGACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCT

2461 cttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcgg 2520
GAATAGCGGTGACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCC

2521 tgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttgg 2580
ACGATGTCTCAAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACC

2581 tatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccgg 2640
ATAGACGCGAGACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCC

2641 caaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcag 2700
GTTTGTTTGGTGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTC

2701 aaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaa 2760
TTTTTTTCCTAGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTT

2761 cgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagat 2820
GCTTTTGAGTGCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTA

2821 ccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtc 2880
GGAAAATTTAATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAG

2881 tgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttc 2940
ACTGTCAATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAG

2941 atccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatc 3000
TAGGTATCAACGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAG

3001 tggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagc 3060
ACCGGGGTCACGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCG

3061 aataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctc 3120
TTATTTGGTCGGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAG

3121 catccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagttt 3180
GTAGGTCAGATAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAA

3181 gcgcaacgttgttgaaaaaggatcttcacctagatccttttcacgtagaaagccagtccg 3240
CGCGTTGCAACAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGC

3241 cagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaac 3300
GTCTTTGCCACGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTG

3301 gcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgg 3360
CGTTCGCGTTTCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACC

NEOKAN prom(3385,3434)>>>
|
3361 gcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggtt 3420
CGCCAAAATACCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAA

3421 gggaagccctgcaaagtaaactggatggctttctcgccgccaaggatctgatggcgcagg 3480
CCCTTCGGGACGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCC

Kan(3531,4323)>>>
|
NTP_II marker(3526,4314)>>>
| |
ORF_1 rf(1)(3523,4317)>>>
| | |
3481 ggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatgga 3540
CCTAGTTCGAGACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCT

3541 ttgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaa 3600
AACGTGCGTCCAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTT

3601 cagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggtt 3660
GTCTGTTAGCCGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAA

3661 ctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcgg 3720
GAAAAACAGTTCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCC

3721 ctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaa 3780
GATAGCACCGACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTT

3781 gcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcac 3840
CGCCCTTCCCTGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTG

3841 cttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgctt 3900
GAACGAGGACGGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAA

3901 gatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtact 3960
CTAGGCCGATGGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGA

3961 cggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcg 4020
GCCTACCTTCGGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGC

4021 ccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtg 4080
GGTCGGCTTGACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCAC

4081 acccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattc 4140
TGGGTACCGCTACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAG

4141 atcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgt 4200
TAGCTGACACCGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCA

4201 gatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatc 4260
CTATAACGACTTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAG

4261 gccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaatt 4320
CGGCGAGGGCTAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAA

4321 ttgttaaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaacat 4380
AACAATTTTAAAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTA

f1 origin(4422,4727)<<<
|
4381 cccttataaatcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaa 4440
GGGAATATTTAGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTT

4441 gagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcaggg 4500
CTCAGGTGATAATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCC

4501 cgatggcccactacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaa 4560
GCTACCGGGTGATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATT

4561 agctctaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggc 4620
TCGAGATTTAGCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCG

4621 gaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaag 4680
CTTGCACCGCTCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTC

4681 tgtagcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacagggc 4740
ACATCGCCAGTGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCG

4741 gcgtccattcgccattcaggatcgaattaattcttaattaacatcatcaataatatacct 4800
CGCAGGTAAGCGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGA

4801 t 4801
A

                                        I-Ceu I
Start: 463 End: 484

CMV promoter
Start: 652 End: 1392

PI-Sce I
Start: 1811 End: 1848

ORI
Start: 2007 End: 2786

Kan
Start: 3532 End: 4323