pShuttle-HA
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepShuttle-HA
VectorTypePlasmid
Antibiotic InformationKanamycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcatgaagaa
661 tctgcttagg gttaggcgtt ttgcgctgct tcgcgatgta cgggccagat atacgcgttg
721 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc
781 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa
841 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac
901 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca
961 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg
1021 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt
1081 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg
1141 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg
1201 gaaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat
1261 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctcccta tcagtgatag
1321 agatctccct atcagtgata gagatcgtcg acgagctcgt ttagtgaacc gtcagatcgc
1381 ctggagacgc catccacgct gttttgacct ccatagagct agccttaaga agcttggtac
1441 cgaattcgat atcctgcaga gcggccgctc tagagggccc ctcgagtacc catacgacgt
1501 cccagactac gcttgagttt aaaccgctga tcagcctcga ctgtgccttc tagttgccag
1561 ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc cactcccact
1621 gtcctttcct aataaaatga ggaaattgca tcgcattgtc tgagtaggtg tcattctatt
1681 ctggggggtg gggtggggca ggacagcaag ggggaggatt gggaagacaa tagcaggcat
1741 gctggggatg cggtgggctc tatggcttct gaggcggaaa gaaccagcag atcgatctct
1801 atgtcgggtg cggagaaaga ggtaatgaaa tggcattatg ggtattatgg gtctgcatta
1861 atgaatcggc caaggatcca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa
1921 taccgcatca ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg
1981 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg
2041 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag
2101 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga
2161 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct
2221 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc
2281 tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg
2341 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc
2401 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca
2461 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag
2521 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct
2581 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc
2641 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga
2701 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca
2761 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat
2821 taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac
2881 caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc atccatagtt
2941 gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc tggccccagt
3001 gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc aataaaccag
3061 ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc catccagtct
3121 attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt gcgcaacgtt
3181 gttgaaaaag gatcttcacc tagatccttt tcacgtagaa agccagtccg cagaaacggt
3241 gctgaccccg gatgaatgtc agctactggg ctatctggac aagggaaaac gcaagcgcaa
3301 agagaaagca ggtagcttgc agtgggctta catggcgata gctagactgg gcggttttat
3361 ggacagcaag cgaaccggaa ttgccagctg gggcgccctc tggtaaggtt gggaagccct
3421 gcaaagtaaa ctggatggct ttctcgccgc caaggatctg atggcgcagg ggatcaagct
3481 ctgatcaaga gacaggatga ggatcgtttc gcatgattga acaagatgga ttgcacgcag
3541 gttctccggc cgcttgggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg
3601 gctgctctga tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca
3661 agaccgacct gtccggtgcc ctgaatgaac tgcaagacga ggcagcgcgg ctatcgtggc
3721 tggccacgac gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg
3781 actggctgct attgggcgaa gtgccggggc aggatctcct gtcatctcac cttgctcctg
3841 ccgagaaagt atccatcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta
3901 cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact cggatggaag
3961 ccggtcttgt cgatcaggat gatctggacg aagagcatca ggggctcgcg ccagccgaac
4021 tgttcgccag gctcaaggcg agcatgcccg acggcgagga tctcgtcgtg acccatggcg
4081 atgcctgctt gccgaatatc atggtggaaa atggccgctt ttctggattc atcgactgtg
4141 gccggctggg tgtggcggac cgctatcagg acatagcgtt ggctacccgt gatattgctg
4201 aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg
4261 attcgcagcg catcgccttc tatcgccttc ttgacgagtt cttctgaatt ttgttaaaat
4321 ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa tcggcaacat cccttataaa
4381 tcaaaagaat agaccgcgat agggttgagt gttgttccag tttggaacaa gagtccacta
4441 ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca
4501 ctacgtgaac catcacccaa atcaagtttt ttgcggtcga ggtgccgtaa agctctaaat
4561 cggaacccta aagggagccc ccgatttaga gcttgacggg gaaagccggc gaacgtggcg
4621 agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc
4681 acgctgcgcg taaccaccac acccgcgcgc ttaatgcgcc gctacagggc gcgtccattc
4741 gccattcagg atcgaattaa ttcttaatta acatcatcaa taatatacct t
                                    LOCUS       dna                      4791 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
misc_binding 691..696
/dbxref="REBASE:NruI"
Regulatory_Seq 1305..1344
/gene="tetO reg"
misc_binding 1430..1435
/dbxref="REBASE:HindIII"
misc_binding 1436..1441
/dbxref="REBASE:KpnI"
misc_binding 1442..1447
/dbxref="REBASE:EcoRI"
misc_binding 1448..1453
/dbxref="REBASE:EcoRV"
misc_binding 1454..1459
/dbxref="REBASE:PstI"
misc_binding 1461..1468
/dbxref="REBASE:NotI"
misc_binding 1469..1474
/dbxref="REBASE:XbaI"
misc_binding 1475..1480
/dbxref="REBASE:ApaI"
misc_binding 1481..1486
/dbxref="REBASE:XhoI"
misc_binding 1481..1486
/dbxref="REBASE:AvrI"
misc_binding 1481..1486
/dbxref="REBASE:AvaI"
misc_binding 1791..1796
/dbxref="REBASE:ClaI"
misc_binding 1874..1879
/dbxref="REBASE:BamHI"
Rep_Origin 2103..2722
/gene="pBR322 origin"
Promoter 3375..3424
/gene="NEOKAN prom"
ORF 3513..4307
/sequence="ORF_1 rf(3)"
Marker 3516..4304
/gene="NTP_II marker"
Rep_Origin 4412..4717
/gene="f1 origin"
BASE COUNT 1171 a 1164 c 1307 g 1149 t 0 others
ORIGIN
1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcatgaagaa
661 tctgcttagg gttaggcgtt ttgcgctgct tcgcgatgta cgggccagat atacgcgttg
721 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc
781 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa
841 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac
901 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca
961 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg
1021 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt
1081 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg
1141 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg
1201 gaaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat
1261 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctcccta tcagtgatag
1321 agatctccct atcagtgata gagatcgtcg acgagctcgt ttagtgaacc gtcagatcgc
1381 ctggagacgc catccacgct gttttgacct ccatagagct agccttaaga agcttggtac
1441 cgaattcgat atcctgcaga gcggccgctc tagagggccc ctcgagtacc catacgacgt
1501 cccagactac gcttgagttt aaaccgctga tcagcctcga ctgtgccttc tagttgccag
1561 ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc cactcccact
1621 gtcctttcct aataaaatga ggaaattgca tcgcattgtc tgagtaggtg tcattctatt
1681 ctggggggtg gggtggggca ggacagcaag ggggaggatt gggaagacaa tagcaggcat
1741 gctggggatg cggtgggctc tatggcttct gaggcggaaa gaaccagcag atcgatctct
1801 atgtcgggtg cggagaaaga ggtaatgaaa tggcattatg ggtattatgg gtctgcatta
1861 atgaatcggc caaggatcca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa
1921 taccgcatca ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg
1981 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg
2041 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag
2101 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga
2161 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct
2221 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc
2281 tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg
2341 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc
2401 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca
2461 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag
2521 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct
2581 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc
2641 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga
2701 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca
2761 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat
2821 taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac
2881 caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc atccatagtt
2941 gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc tggccccagt
3001 gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc aataaaccag
3061 ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc catccagtct
3121 attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt gcgcaacgtt
3181 gttgaaaaag gatcttcacc tagatccttt tcacgtagaa agccagtccg cagaaacggt
3241 gctgaccccg gatgaatgtc agctactggg ctatctggac aagggaaaac gcaagcgcaa
3301 agagaaagca ggtagcttgc agtgggctta catggcgata gctagactgg gcggttttat
3361 ggacagcaag cgaaccggaa ttgccagctg gggcgccctc tggtaaggtt gggaagccct
3421 gcaaagtaaa ctggatggct ttctcgccgc caaggatctg atggcgcagg ggatcaagct
3481 ctgatcaaga gacaggatga ggatcgtttc gcatgattga acaagatgga ttgcacgcag
3541 gttctccggc cgcttgggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg
3601 gctgctctga tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca
3661 agaccgacct gtccggtgcc ctgaatgaac tgcaagacga ggcagcgcgg ctatcgtggc
3721 tggccacgac gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg
3781 actggctgct attgggcgaa gtgccggggc aggatctcct gtcatctcac cttgctcctg
3841 ccgagaaagt atccatcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta
3901 cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact cggatggaag
3961 ccggtcttgt cgatcaggat gatctggacg aagagcatca ggggctcgcg ccagccgaac
4021 tgttcgccag gctcaaggcg agcatgcccg acggcgagga tctcgtcgtg acccatggcg
4081 atgcctgctt gccgaatatc atggtggaaa atggccgctt ttctggattc atcgactgtg
4141 gccggctggg tgtggcggac cgctatcagg acatagcgtt ggctacccgt gatattgctg
4201 aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg
4261 attcgcagcg catcgccttc tatcgccttc ttgacgagtt cttctgaatt ttgttaaaat
4321 ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa tcggcaacat cccttataaa
4381 tcaaaagaat agaccgcgat agggttgagt gttgttccag tttggaacaa gagtccacta
4441 ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca
4501 ctacgtgaac catcacccaa atcaagtttt ttgcggtcga ggtgccgtaa agctctaaat
4561 cggaacccta aagggagccc ccgatttaga gcttgacggg gaaagccggc gaacgtggcg
4621 agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc
4681 acgctgcgcg taaccaccac acccgcgcgc ttaatgcgcc gctacagggc gcgtccattc
4741 gccattcagg atcgaattaa ttcttaatta acatcatcaa taatatacct t
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaagctcagatctggatctcccgatcccctatggtcgactctcagtacaatctgctc 540
CGCTTTCGAGTCTAGACCTAGAGGGCTAGGGGATACCAGCTGAGAGTCATGTTAGACGAG

541 tgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagta 600
ACTACGGCGTATCAATTCGGTCATAGACGAGGGACGAACACACAACCTCCAGCGACTCAT

601 gtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaa 660
CACGCGCTCGTTTTAAATTCGATGTTGTTCCGTTCCGAACTGGCTGTTAACGTACTTCTT

NruI
|
661 tctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttg 720
AGACGAATCCCAATCCGCAAAACGCGACGAAGCGCTACATGCCCGGTCTATATGCGCAAC

721 acattgattattgactagttattaatagtaatcaattacggggtcattagttcatagccc 780
TGTAACTAATAACTGATCAATAATTATCATTAGTTAATGCCCCAGTAATCAAGTATCGGG

781 atatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaa 840
TATATACCTCAAGGCGCAATGTATTGAATGCCATTTACCGGGCGGACCGACTGGCGGGTT

841 cgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggac 900
GCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAAGGGTATCATTGCGGTTATCCCTG

901 tttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatca 960
AAAGGTAACTGCAGTTACCCACCTCATAAATGCCATTTGACGGGTGAACCGTCATGTAGT

961 agtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctg 1020
TCACATAGTATACGGTTCATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGAC

1021 gcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtatt 1080
CGTAATACGGGTCATGTACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCATAA

1081 agtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcg 1140
TCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCATGTAGTTACCCGCACCTATCGC

1141 gtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttg 1200
CAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAACTGCAGTTACCCTCAAACAAAAC

1201 gaaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaat 1260
CTTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGTTGAGGCGGGGTAACTGCGTTTA

tetO reg(1305,1344)>>>
|
1261 gggcggtaggcgtgtacggtgggaggtctatataagcagagctctccctatcagtgatag 1320
CCCGCCATCCGCACATGCCACCCTCCAGATATATTCGTCTCGAGAGGGATAGTCACTATC

1321 agatctccctatcagtgatagagatcgtcgacgagctcgtttagtgaaccgtcagatcgc 1380
TCTAGAGGGATAGTCACTATCTCTAGCAGCTGCTCGAGCAAATCACTTGGCAGTCTAGCG

HindIII
|
1381 ctggagacgccatccacgctgttttgacctccatagagctagccttaagaagcttggtac 1440
GACCTCTGCGGTAGGTGCGACAAAACTGGAGGTATCTCGATCGGAATTCTTCGAACCATG

XhoI
|
AvrI
|
EcoRI NotI AvaI
| | |
KpnI EcoRV PstI XbaI ApaI
| | | | | | | |
1441 cgaattcgatatcctgcagagcggccgctctagagggcccctcgagtacccatacgacgt 1500
GCTTAAGCTATAGGACGTCTCGCCGGCGAGATCTCCCGGGGAGCTCATGGGTATGCTGCA

1501 cccagactacgcttgagtttaaaccgctgatcagcctcgactgtgccttctagttgccag 1560
GGGTCTGATGCGAACTCAAATTTGGCGACTAGTCGGAGCTGACACGGAAGATCAACGGTC

1561 ccatCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACT 1620
GGTAGACAACAAACGGGGAGGGGGCACGGAAGGAACTGGGACCTTCCACGGTGAGGGTGA

1621 GTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATT 1680
CAGGAAAGGATTATTTTACTCCTTTAACGTAGCGTAACAGACTCATCCACAGTAAGATAA

1681 CTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCAT 1740
GACCCCCCACCCCACCCCGTCCTGTCGTTCCCCCTCCTAACCCTTCTGTTATCGTCCGTA

ClaI
|
1741 GCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCAGATCGATCTCT 1800
CGACCCCTACGCCACCCGAGATACCGAAGACTCCGCCTTTCTTGGTCGTCTAGCTAGAGA

1801 ATGTCGGGTGCGGAGAAAGAGGTAATGAAATGGCATTATGGGTATTATGGGTCTGCATTA 1860
TACAGCCCACGCCTCTTTCTCCATTACTTTACCGTAATACCCATAATACCCAGACGTAAT

BamHI
|
1861 ATGAATCGGCCAAGGATCCATATGCggtgtgaaataccgcacagatgcgtaaggagaaaa 1920
TACTTAGCCGGTTCCTAGGTATACGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTT

1921 taccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcgg 1980
ATGGCGTAGTCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCC

1981 ctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggg 2040
GACGCCGCTCGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCC

2041 gataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaag 2100
CTATTGCGTCCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTC

pBR322 origin(2103,2722)<<<
|
2101 gccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcga 2160
CGGCGCAACGACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCT

2161 cgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccct 2220
GCGAGTTCAGTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGA

2221 ggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcc 2280
CCTTCGAGGGAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGG

2281 tttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcg 2340
AAAGAGGGAAGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGC

2341 gtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgc 2400
CACATCCAGCAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCG

2401 tgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcca 2460
ACGCGGAATAGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGT

2461 ctggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagag 2520
GACCGTCGTCGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTC

2521 ttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgct 2580
AAGAACTTCACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCGA

2581 ctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaacc 2640
GACGACTTCGGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGG

2641 accgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagga 2700
TGGCGACCATCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCT

2701 tctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactca 2760
AGAGTTCTTCTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGT

2761 cgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaat 2820
GCAATTCCCTAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTA

2821 taaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttac 2880
ATTTTTACTTCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAATG

2881 caatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagtt 2940
GTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAA

2941 gcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagt 3000
CGGACTGAGGGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCA

3001 gctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccag 3060
CGACGTTACTATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTC

3061 ccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtct 3120
GGTCGGCCTTCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGA

3121 attaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgtt 3180
TAATTAACAACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAA

3181 gttgaaaaaggatcttcacctagatccttttcacgtagaaagccagtccgcagaaacggt 3240
CAACTTTTTCCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCA

3241 gctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaa 3300
CGACTGGGGCCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTT

3301 agagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttat 3360
TCTCTTTCGTCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAAATA

NEOKAN prom(3375,3424)>>>
|
3361 ggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccct 3420
CCTGTCGTTCGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGA

3421 gcaaagtaaactggatggctttctcgccgccaaggatctgatggcgcaggggatcaagct 3480
CGTTTCATTTGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGA

NTP_II marker(3516,4304)>>>
|
ORF_1 rf(3)(3513,4307)>>>
| |
3481 ctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcag 3540
GACTAGTTCTCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTC

3541 gttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcg 3600
CAAGAGGCCGGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGC

3601 gctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtca 3660
CGACGAGACTACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGT

3661 agaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggc 3720
TCTGGCTGGACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCG

3721 tggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaaggg 3780
ACCGGTGCTGCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCC

3781 actggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctg 3840
TGACCGACGATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGAC

3841 ccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggcta 3900
GGCTCTTTCATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCCGAT

3901 cctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaag 3960
GGACGGGTAAGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTC

3961 ccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaac 4020
GGCCAGAACAGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTG

4021 tgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcg 4080
ACAAGCGGTCCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGC

4081 atgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtg 4140
TACGGACGAACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACAC

4141 gccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctg 4200
CGGCCGACCCACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAACGAC

4201 aagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccg 4260
TTCTCGAACCGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGC

4261 attcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattttgttaaaat 4320
TAAGCGTCGCGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTA

4321 ttttgttaaatcagctcattttttaaccaataggccgaaatcggcaacatcccttataaa 4380
AAAACAATTTAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTT

f1 origin(4412,4717)<<<
|
4381 tcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaagagtccacta 4440
AGTTTTCTTATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGAT

4441 ttaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggccca 4500
AATTTCTTGCACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGT

4501 ctacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaaagctctaaat 4560
GATGCACTTGGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTA

4561 cggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcg 4620
GCCTTGGGATTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGC

4621 agaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtc 4680
TCTTTCCTTCCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAG

4681 acgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgctacagggcgcgtccattc 4740
TGCGACGCGCATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAG

4741 gccattcaggatcgaattaattcttaattaacatcatcaataatatacctt 4791
CGGTAAGTCCTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA
                                    LOCUS       dna                      4791 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
misc_binding 691..696
/dbxref="REBASE:NruI"
Regulatory_Seq 1305..1344
/gene="tetO reg"
misc_binding 1430..1435
/dbxref="REBASE:HindIII"
misc_binding 1436..1441
/dbxref="REBASE:KpnI"
misc_binding 1442..1447
/dbxref="REBASE:EcoRI"
misc_binding 1448..1453
/dbxref="REBASE:EcoRV"
misc_binding 1454..1459
/dbxref="REBASE:PstI"
misc_binding 1461..1468
/dbxref="REBASE:NotI"
misc_binding 1469..1474
/dbxref="REBASE:XbaI"
misc_binding 1475..1480
/dbxref="REBASE:ApaI"
misc_binding 1481..1486
/dbxref="REBASE:XhoI"
misc_binding 1481..1486
/dbxref="REBASE:AvrI"
misc_binding 1481..1486
/dbxref="REBASE:AvaI"
misc_binding 1791..1796
/dbxref="REBASE:ClaI"
misc_binding 1874..1879
/dbxref="REBASE:BamHI"
Rep_Origin 2103..2722
/gene="pBR322 origin"
Promoter 3375..3424
/gene="NEOKAN prom"
ORF 3513..4307
/sequence="ORF_1 rf(3)"
Marker 3516..4304
/gene="NTP_II marker"
Rep_Origin 4412..4717
/gene="f1 origin"
BASE COUNT 1171 a 1164 c 1307 g 1149 t 0 others