pShuttle-His
  • Properties
  • Map
  • Sequence
  • Genbank
  • Text Map
  • Features
Vector NamepShuttle-His
VectorTypePlasmid
Antibiotic InformationKanamycin
Sequencing PrimersCMV sequencing primer
5`---CGC AAA TGG GCG GTA GGC GTG---3`
Additional InformationNo Additional Information
***Note: Features may not be to scale, please refer to sequence or text map for detailed information.
***Note: The vector sequence shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page. The restriction sites within the cloning region may differ from the provided sequence.


        1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt     
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcatgaagaa
661 tctgcttagg gttaggcgtt ttgcgctgct tcgcgatgta cgggccagat atacgcgttg
721 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc
781 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa
841 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac
901 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca
961 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg
1021 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt
1081 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg
1141 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg
1201 gaaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat
1261 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctcccta tcagtgatag
1321 agatctccct atcagtgata gagatcgtcg acgagctcgt ttagtgaacc gtcagatcgc
1381 ctggagacgc catccacgct gttttgacct ccatagagct agccttaaga agcttggtac
1441 cgaattcgat atcctgcaga gcggccgctc tagagggccc ctcgagcatc atcaccatca
1501 ccattgagtt taaaccgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt
1561 gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc
1621 taataaaatg aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt
1681 ggggtggggc aggacagcaa gggggaggat tgggaagaca atagcaggca tgctggggat
1741 gcggtgggct ctatggcttc tgaggcggaa agaaccagca gatcgatctc tatgtcgggt
1801 gcggagaaag aggtaatgaa atggcattat gggtattatg ggtctgcatt aatgaatcgg
1861 ccaaggatcc atatgcggtg tgaaataccg cacagatgcg taaggagaaa ataccgcatc
1921 aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga
1981 gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca
2041 ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg
2101 ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt
2161 cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc
2221 ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct
2281 tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc
2341 gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta
2401 tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca
2461 gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag
2521 tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag
2581 ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt
2641 agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa
2701 gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg
2761 attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga
2821 agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta
2881 atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc
2941 cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg
3001 ataccgcgag acccacgctc accggctcca gatttatcag caataaacca gccagccgga
3061 agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt
3121 tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgaaaaa
3181 ggatcttcac ctagatcctt ttcacgtaga aagccagtcc gcagaaacgg tgctgacccc
3241 ggatgaatgt cagctactgg gctatctgga caagggaaaa cgcaagcgca aagagaaagc
3301 aggtagcttg cagtgggctt acatggcgat agctagactg ggcggtttta tggacagcaa
3361 gcgaaccgga attgccagct ggggcgccct ctggtaaggt tgggaagccc tgcaaagtaa
3421 actggatggc tttctcgccg ccaaggatct gatggcgcag gggatcaagc tctgatcaag
3481 agacaggatg aggatcgttt cgcatgattg aacaagatgg attgcacgca ggttctccgg
3541 ccgcttgggt ggagaggcta ttcggctatg actgggcaca acagacaatc ggctgctctg
3601 atgccgccgt gttccggctg tcagcgcagg ggcgcccggt tctttttgtc aagaccgacc
3661 tgtccggtgc cctgaatgaa ctgcaagacg aggcagcgcg gctatcgtgg ctggccacga
3721 cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga agcgggaagg gactggctgc
3781 tattgggcga agtgccgggg caggatctcc tgtcatctca ccttgctcct gccgagaaag
3841 tatccatcat ggctgatgca atgcggcggc tgcatacgct tgatccggct acctgcccat
3901 tcgaccacca agcgaaacat cgcatcgagc gagcacgtac tcggatggaa gccggtcttg
3961 tcgatcagga tgatctggac gaagagcatc aggggctcgc gccagccgaa ctgttcgcca
4021 ggctcaaggc gagcatgccc gacggcgagg atctcgtcgt gacccatggc gatgcctgct
4081 tgccgaatat catggtggaa aatggccgct tttctggatt catcgactgt ggccggctgg
4141 gtgtggcgga ccgctatcag gacatagcgt tggctacccg tgatattgct gaagagcttg
4201 gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc gattcgcagc
4261 gcatcgcctt ctatcgcctt cttgacgagt tcttctgaat tttgttaaaa tttttgttaa
4321 atcagctcat tttttaacca ataggccgaa atcggcaaca tcccttataa atcaaaagaa
4381 tagaccgcga tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac
4441 gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa
4501 ccatcaccca aatcaagttt tttgcggtcg aggtgccgta aagctctaaa tcggaaccct
4561 aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa
4621 gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc
4681 gtaaccacca cacccgcgcg cttaatgcgc cgctacaggg cgcgtccatt cgccattcag
4741 gatcgaatta attcttaatt aacatcatca ataatatacc tt
//
                                    LOCUS       dna                      4782 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
misc_binding 691..696
/dbxref="REBASE:NruI"
Regulatory_Seq 1305..1344
/gene="tetO reg"
misc_binding 1430..1435
/dbxref="REBASE:HindIII"
misc_binding 1436..1441
/dbxref="REBASE:KpnI"
misc_binding 1442..1447
/dbxref="REBASE:EcoRI"
misc_binding 1448..1453
/dbxref="REBASE:EcoRV"
misc_binding 1454..1459
/dbxref="REBASE:PstI"
misc_binding 1461..1468
/dbxref="REBASE:NotI"
misc_binding 1469..1474
/dbxref="REBASE:XbaI"
misc_binding 1475..1480
/dbxref="REBASE:ApaI"
misc_binding 1481..1486
/dbxref="REBASE:AvaI"
misc_binding 1481..1486
/dbxref="REBASE:XhoI"
misc_binding 1481..1486
/dbxref="REBASE:AvrI"
Tag 1487..1504
/gene="6xHis tag"
misc_binding 1782..1787
/dbxref="REBASE:ClaI"
misc_binding 1865..1870
/dbxref="REBASE:BamHI"
Rep_Origin 2094..2713
/gene="pBR322 origin"
Promoter 3366..3415
/gene="NEOKAN prom"
ORF 3504..4298
/sequence="ORF_1 rf(3)"
Marker 3507..4295
/gene="NTP_II marker"
Rep_Origin 4403..4708
/gene="f1 origin"
BASE COUNT 1170 a 1161 c 1303 g 1148 t 0 others
ORIGIN
1 ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt
61 gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa
121 cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg
181 aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt
241 aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg
301 tgttactcat agcgcgtaat acggcagacc tcagcgctag attattgaag catttatcag
361 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
421 gttccgcgca catttccccg aaaagtgcca cctgacgtta actataacgg tcctaaggta
481 gcgaaagctc agatctggat ctcccgatcc cctatggtcg actctcagta caatctgctc
541 tgatgccgca tagttaagcc agtatctgct ccctgcttgt gtgttggagg tcgctgagta
601 gtgcgcgagc aaaatttaag ctacaacaag gcaaggcttg accgacaatt gcatgaagaa
661 tctgcttagg gttaggcgtt ttgcgctgct tcgcgatgta cgggccagat atacgcgttg
721 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc
781 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa
841 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac
901 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca
961 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg
1021 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt
1081 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg
1141 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg
1201 gaaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat
1261 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctcccta tcagtgatag
1321 agatctccct atcagtgata gagatcgtcg acgagctcgt ttagtgaacc gtcagatcgc
1381 ctggagacgc catccacgct gttttgacct ccatagagct agccttaaga agcttggtac
1441 cgaattcgat atcctgcaga gcggccgctc tagagggccc ctcgagcatc atcaccatca
1501 ccattgagtt taaaccgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt
1561 gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc
1621 taataaaatg aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt
1681 ggggtggggc aggacagcaa gggggaggat tgggaagaca atagcaggca tgctggggat
1741 gcggtgggct ctatggcttc tgaggcggaa agaaccagca gatcgatctc tatgtcgggt
1801 gcggagaaag aggtaatgaa atggcattat gggtattatg ggtctgcatt aatgaatcgg
1861 ccaaggatcc atatgcggtg tgaaataccg cacagatgcg taaggagaaa ataccgcatc
1921 aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga
1981 gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca
2041 ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg
2101 ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt
2161 cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc
2221 ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct
2281 tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc
2341 gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta
2401 tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca
2461 gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag
2521 tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag
2581 ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt
2641 agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa
2701 gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg
2761 attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga
2821 agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta
2881 atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc
2941 cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg
3001 ataccgcgag acccacgctc accggctcca gatttatcag caataaacca gccagccgga
3061 agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt
3121 tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgaaaaa
3181 ggatcttcac ctagatcctt ttcacgtaga aagccagtcc gcagaaacgg tgctgacccc
3241 ggatgaatgt cagctactgg gctatctgga caagggaaaa cgcaagcgca aagagaaagc
3301 aggtagcttg cagtgggctt acatggcgat agctagactg ggcggtttta tggacagcaa
3361 gcgaaccgga attgccagct ggggcgccct ctggtaaggt tgggaagccc tgcaaagtaa
3421 actggatggc tttctcgccg ccaaggatct gatggcgcag gggatcaagc tctgatcaag
3481 agacaggatg aggatcgttt cgcatgattg aacaagatgg attgcacgca ggttctccgg
3541 ccgcttgggt ggagaggcta ttcggctatg actgggcaca acagacaatc ggctgctctg
3601 atgccgccgt gttccggctg tcagcgcagg ggcgcccggt tctttttgtc aagaccgacc
3661 tgtccggtgc cctgaatgaa ctgcaagacg aggcagcgcg gctatcgtgg ctggccacga
3721 cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga agcgggaagg gactggctgc
3781 tattgggcga agtgccgggg caggatctcc tgtcatctca ccttgctcct gccgagaaag
3841 tatccatcat ggctgatgca atgcggcggc tgcatacgct tgatccggct acctgcccat
3901 tcgaccacca agcgaaacat cgcatcgagc gagcacgtac tcggatggaa gccggtcttg
3961 tcgatcagga tgatctggac gaagagcatc aggggctcgc gccagccgaa ctgttcgcca
4021 ggctcaaggc gagcatgccc gacggcgagg atctcgtcgt gacccatggc gatgcctgct
4081 tgccgaatat catggtggaa aatggccgct tttctggatt catcgactgt ggccggctgg
4141 gtgtggcgga ccgctatcag gacatagcgt tggctacccg tgatattgct gaagagcttg
4201 gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc gattcgcagc
4261 gcatcgcctt ctatcgcctt cttgacgagt tcttctgaat tttgttaaaa tttttgttaa
4321 atcagctcat tttttaacca ataggccgaa atcggcaaca tcccttataa atcaaaagaa
4381 tagaccgcga tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac
4441 gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa
4501 ccatcaccca aatcaagttt tttgcggtcg aggtgccgta aagctctaaa tcggaaccct
4561 aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa
4621 gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc
4681 gtaaccacca cacccgcgcg cttaatgcgc cgctacaggg cgcgtccatt cgccattcag
4741 gatcgaatta attcttaatt aacatcatca ataatatacc tt
//
***Note: The text map shown below is representative of the parental vector only and does not include the gene of interest. The sequence of the gene can be found through the accession number link on the product page.
1     ttttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgt 60
AAAACCTAACTTCGGTTATACTATTACTCCCCCACCTCAAACACTGCACCGCGCCCCGCA

61 gggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaa 120
CCCTTGCCCCGCCCACTGCATCATCACACCGCCTTCACACTACAACGTTCACACCGCCTT

Encap other(162,310)>>>
|
121 cacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacagg 180
GTGTACATTCGCTGCCTACACCGTTTTCACTGCAAAAACCACACGCGGCCACATGTGTCC

181 aagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagt 240
TTCACTGTTAAAAGCGCGCCAAAATCCGCCTACAACATCATTTAAACCCGCATTGGCTCA

241 aagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttg 300
TTCTAAACCGGTAAAAGCGCCCTTTTGACTTATTCTCCTTCACTTTAGACTTATTAAAAC

301 tgttactcatagcgcgtaatacggcagacctcagcgctagattattgaagcatttatcag 360
ACAATGAGTATCGCGCATTATGCCGTCTGGAGTCGCGATCTAATAACTTCGTAAATAGTC

amp prom(365,393)<<<
|
361 ggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg 420
CCAATAACAGAGTACTCGCCTATGTATAAACTTACATAAATCTTTTTATTTGTTTATCCC

HpaI
|
421 gttccgcgcacatttccccgaaaagtgccacctgacgttaactataacggtcctaaggta 480
CAAGGCGCGTGTAAAGGGGCTTTTCACGGTGGACTGCAATTGATATTGCCAGGATTCCAT

481 gcgaaagctcagatctggatctcccgatcccctatggtcgactctcagtacaatctgctc 540
CGCTTTCGAGTCTAGACCTAGAGGGCTAGGGGATACCAGCTGAGAGTCATGTTAGACGAG

541 tgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagta 600
ACTACGGCGTATCAATTCGGTCATAGACGAGGGACGAACACACAACCTCCAGCGACTCAT

601 gtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaa 660
CACGCGCTCGTTTTAAATTCGATGTTGTTCCGTTCCGAACTGGCTGTTAACGTACTTCTT

NruI
|
661 tctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttg 720
AGACGAATCCCAATCCGCAAAACGCGACGAAGCGCTACATGCCCGGTCTATATGCGCAAC

721 acattgattattgactagttattaatagtaatcaattacggggtcattagttcatagccc 780
TGTAACTAATAACTGATCAATAATTATCATTAGTTAATGCCCCAGTAATCAAGTATCGGG

781 atatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaa 840
TATATACCTCAAGGCGCAATGTATTGAATGCCATTTACCGGGCGGACCGACTGGCGGGTT

841 cgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggac 900
GCTGGGGGCGGGTAACTGCAGTTATTACTGCATACAAGGGTATCATTGCGGTTATCCCTG

901 tttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatca 960
AAAGGTAACTGCAGTTACCCACCTCATAAATGCCATTTGACGGGTGAACCGTCATGTAGT

961 agtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctg 1020
TCACATAGTATACGGTTCATGCGGGGGATAACTGCAGTTACTGCCATTTACCGGGCGGAC

1021 gcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtatt 1080
CGTAATACGGGTCATGTACTGGAATACCCTGAAAGGATGAACCGTCATGTAGATGCATAA

1081 agtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcg 1140
TCAGTAGCGATAATGGTACCACTACGCCAAAACCGTCATGTAGTTACCCGCACCTATCGC

1141 gtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttg 1200
CAAACTGAGTGCCCCTAAAGGTTCAGAGGTGGGGTAACTGCAGTTACCCTCAAACAAAAC

1201 gaaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaat 1260
CTTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTGTTGAGGCGGGGTAACTGCGTTTA

tetO reg(1305,1344)>>>
|
1261 gggcggtaggcgtgtacggtgggaggtctatataagcagagctctccctatcagtgatag 1320
CCCGCCATCCGCACATGCCACCCTCCAGATATATTCGTCTCGAGAGGGATAGTCACTATC

1321 agatctccctatcagtgatagagatcgtcgacgagctcgtttagtgaaccgtcagatcgc 1380
TCTAGAGGGATAGTCACTATCTCTAGCAGCTGCTCGAGCAAATCACTTGGCAGTCTAGCG

HindIII
|
1381 ctggagacgccatccacgctgttttgacctccatagagctagccttaagaagcttggtac 1440
GACCTCTGCGGTAGGTGCGACAAAACTGGAGGTATCTCGATCGGAATTCTTCGAACCATG

AvaI
|
XhoI
|
EcoRI NotI AvrI
| | |
KpnI EcoRV PstI XbaI ApaI 6xHis tag(1487,1504)>>>
| | | | | | | | |
1441 cgaattcgatatcctgcagagcggccgctctagagggcccctcgagcatcatcaccatca 1500
GCTTAAGCTATAGGACGTCTCGCCGGCGAGATCTCCCGGGGAGCTCGTAGTAGTGGTAGT

1501 cCATTGAGTTTAAACCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTT 1560
GGTAACTCAAATTTGGCGACTAGTCGGAGCTGACACGGAAGATCAACGGTCGGTAGACAA

1561 GTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCC 1620
CAAACGGGGAGGGGGCACGGAAGGAACTGGGACCTTCCACGGTGAGGGTGACAGGAAAGG

1621 TAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGT 1680
ATTATTTTACTCCTTTAACGTAGCGTAACAGACTCATCCACAGTAAGATAAGACCCCCCA

1681 GGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT 1740
CCCCACCCCGTCCTGTCGTTCCCCCTCCTAACCCTTCTGTTATCGTCCGTACGACCCCTA

ClaI
|
1741 GCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCAGATCGATCTCTATGTCGGGT 1800
CGCCACCCGAGATACCGAAGACTCCGCCTTTCTTGGTCGTCTAGCTAGAGATACAGCCCA

1801 GCGGAGAAAGAGGTAATGAAATGGCATTATGGGTATTATGGGTCTGCATTAATGAATCGG 1860
CGCCTCTTTCTCCATTACTTTACCGTAATACCCATAATACCCAGACGTAATTACTTAGCC

BamHI
|
1861 CCAAGGATCCATATGCGGTGtgaaataccgcacagatgcgtaaggagaaaataccgcatc 1920
GGTTCCTAGGTATACGCCACACTTTATGGCGTGTCTACGCATTCCTCTTTTATGGCGTAG

1921 aggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcga 1980
TCCGCGAGAAGGCGAAGGAGCGAGTGACTGAGCGACGCGAGCCAGCAAGCCGACGCCGCT

1981 gcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgca 2040
CGCCATAGTCGAGTGAGTTTCCGCCATTATGCCAATAGGTGTCTTAGTCCCCTATTGCGT

pBR322 origin(2094,2713)<<<
|
2041 ggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttg 2100
CCTTTCTTGTACACTCGTTTTCCGGTCGTTTTCCGGTCCTTGGCATTTTTCCGGCGCAAC

2101 ctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagt 2160
GACCGCAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTGCGAGTTCA

2161 cagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctcc 2220
GTCTCCACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGACCTTCGAGG

2221 ctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctccct 2280
GAGCACGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGAAAGAGGGA

2281 tcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtc 2340
AGCCCTTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGCCACATCCAG

2341 gttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgcctta 2400
CAAGCGAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCGACGCGGAAT

2401 tccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagca 2460
AGGCCATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGACCGTCGT

2461 gccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaag 2520
CGGTGACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTCAAGAACTTC

2521 tggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaag 2580
ACCACCGGATTGATGCCGATGTGATCTTCCTGTCATAAACCATAGACGCGAGACGACTTC

2581 ccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggt 2640
GGTCAATGGAAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGGTGGCGACCA

2641 agcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaa 2700
TCGCCACCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAGAGTTCTT

2701 gatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaaggg 2760
CTAGGAAACTAGAAAAGATGCCCCAGACTGCGAGTCACCTTGCTTTTGAGTGCAATTCCC

2761 attttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatga 2820
TAAAACCAGTACTCTAATAGTTTTTCCTAGAAGTGGATCTAGGAAAATTTAATTTTTACT

2821 agttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgctta 2880
TCAAAATTTAGTTAGATTTCATATATACTCATTTGAACCAGACTGTCAATGGTTACGAAT

2881 atcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactc 2940
TAGTCACTCCGTGGATAGAGTCGCTAGACAGATAAAGCAAGTAGGTATCAACGGACTGAG

2941 cccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatg 3000
GGGCAGCACATCTATTGATGCTATGCCCTCCCGAATGGTAGACCGGGGTCACGACGTTAC

3001 ataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccgga 3060
TATGGCGCTCTGGGTGCGAGTGGCCGAGGTCTAAATAGTCGTTATTTGGTCGGTCGGCCT

3061 agggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgt 3120
TCCCGGCTCGCGTCTTCACCAGGACGTTGAAATAGGCGGAGGTAGGTCAGATAATTAACA

3121 tgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgaaaaa 3180
ACGGCCCTTCGATCTCATTCATCAAGCGGTCAATTATCAAACGCGTTGCAACAACTTTTT

3181 ggatcttcacctagatccttttcacgtagaaagccagtccgcagaaacggtgctgacccc 3240
CCTAGAAGTGGATCTAGGAAAAGTGCATCTTTCGGTCAGGCGTCTTTGCCACGACTGGGG

3241 ggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagc 3300
CCTACTTACAGTCGATGACCCGATAGACCTGTTCCCTTTTGCGTTCGCGTTTCTCTTTCG

3301 aggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaa 3360
TCCATCGAACGTCACCCGAATGTACCGCTATCGATCTGACCCGCCAAAATACCTGTCGTT

NEOKAN prom(3366,3415)>>>
|
3361 gcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaa 3420
CGCTTGGCCTTAACGGTCGACCCCGCGGGAGACCATTCCAACCCTTCGGGACGTTTCATT

3421 actggatggctttctcgccgccaaggatctgatggcgcaggggatcaagctctgatcaag 3480
TGACCTACCGAAAGAGCGGCGGTTCCTAGACTACCGCGTCCCCTAGTTCGAGACTAGTTC

NTP_II marker(3507,4295)>>>
|
ORF_1 rf(3)(3504,4298)>>>
| |
3481 agacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccgg 3540
TCTGTCCTACTCCTAGCAAAGCGTACTAACTTGTTCTACCTAACGTGCGTCCAAGAGGCC

3541 ccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctg 3600
GGCGAACCCACCTCTCCGATAAGCCGATACTGACCCGTGTTGTCTGTTAGCCGACGAGAC

3601 atgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacc 3660
TACGGCGGCACAAGGCCGACAGTCGCGTCCCCGCGGGCCAAGAAAAACAGTTCTGGCTGG

3661 tgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacga 3720
ACAGGCCACGGGACTTACTTGACGTTCTGCTCCGTCGCGCCGATAGCACCGACCGGTGCT

3721 cgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgc 3780
GCCCGCAAGGAACGCGTCGACACGAGCTGCAACAGTGACTTCGCCCTTCCCTGACCGACG

3781 tattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaag 3840
ATAACCCGCTTCACGGCCCCGTCCTAGAGGACAGTAGAGTGGAACGAGGACGGCTCTTTC

3841 tatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccat 3900
ATAGGTAGTACCGACTACGTTACGCCGCCGACGTATGCGAACTAGGCCGATGGACGGGTA

3901 tcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttg 3960
AGCTGGTGGTTCGCTTTGTAGCGTAGCTCGCTCGTGCATGAGCCTACCTTCGGCCAGAAC

3961 tcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgcca 4020
AGCTAGTCCTACTAGACCTGCTTCTCGTAGTCCCCGAGCGCGGTCGGCTTGACAAGCGGT

4021 ggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgct 4080
CCGAGTTCCGCTCGTACGGGCTGCCGCTCCTAGAGCAGCACTGGGTACCGCTACGGACGA

4081 tgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgg 4140
ACGGCTTATAGTACCACCTTTTACCGGCGAAAAGACCTAAGTAGCTGACACCGGCCGACC

4141 gtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttg 4200
CACACCGCCTGGCGATAGTCCTGTATCGCAACCGATGGGCACTATAACGACTTCTCGAAC

4201 gcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagc 4260
CGCCGCTTACCCGACTGGCGAAGGAGCACGAAATGCCATAGCGGCGAGGGCTAAGCGTCG

4261 gcatcgccttctatcgccttcttgacgagttcttctgaattttgttaaaatttttgttaa 4320
CGTAGCGGAAGATAGCGGAAGAACTGCTCAAGAAGACTTAAAACAATTTTAAAAACAATT

4321 atcagctcattttttaaccaataggccgaaatcggcaacatcccttataaatcaaaagaa 4380
TAGTCGAGTAAAAAATTGGTTATCCGGCTTTAGCCGTTGTAGGGAATATTTAGTTTTCTT

f1 origin(4403,4708)<<<
|
4381 tagaccgcgatagggttgagtgttgttccagtttggaacaagagtccactattaaagaac 4440
ATCTGGCGCTATCCCAACTCACAACAAGGTCAAACCTTGTTCTCAGGTGATAATTTCTTG

4441 gtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaa 4500
CACCTGAGGTTGCAGTTTCCCGCTTTTTGGCAGATAGTCCCGCTACCGGGTGATGCACTT

4501 ccatcacccaaatcaagttttttgcggtcgaggtgccgtaaagctctaaatcggaaccct 4560
GGTAGTGGGTTTAGTTCAAAAAACGCCAGCTCCACGGCATTTCGAGATTTAGCCTTGGGA

4561 aaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaa 4620
TTTCCCTCGGGGGCTAAATCTCGAACTGCCCCTTTCGGCCGCTTGCACCGCTCTTTCCTT

4621 gggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgc 4680
CCCTTCTTTCGCTTTCCTCGCCCGCGATCCCGCGACCGTTCACATCGCCAGTGCGACGCG

4681 gtaaccaccacacccgcgcgcttaatgcgccgctacagggcgcgtccattcgccattcag 4740
CATTGGTGGTGTGGGCGCGCGAATTACGCGGCGATGTCCCGCGCAGGTAAGCGGTAAGTC

4741 gatcgaattaattcttaattaacatcatcaataatatacctt 4782
CTAGCTTAATTAAGAATTAATTGTAGTAGTTATTATATGGAA
                                    LOCUS       dna                      4782 bp                                   
FEATURES Location/Qualifiers
Other Gene 162..310
/gene="Encap other"
Promoter 365..393
/gene="amp prom"
misc_binding 457..462
/dbxref="REBASE:HpaI"
misc_binding 691..696
/dbxref="REBASE:NruI"
Regulatory_Seq 1305..1344
/gene="tetO reg"
misc_binding 1430..1435
/dbxref="REBASE:HindIII"
misc_binding 1436..1441
/dbxref="REBASE:KpnI"
misc_binding 1442..1447
/dbxref="REBASE:EcoRI"
misc_binding 1448..1453
/dbxref="REBASE:EcoRV"
misc_binding 1454..1459
/dbxref="REBASE:PstI"
misc_binding 1461..1468
/dbxref="REBASE:NotI"
misc_binding 1469..1474
/dbxref="REBASE:XbaI"
misc_binding 1475..1480
/dbxref="REBASE:ApaI"
misc_binding 1481..1486
/dbxref="REBASE:AvaI"
misc_binding 1481..1486
/dbxref="REBASE:XhoI"
misc_binding 1481..1486
/dbxref="REBASE:AvrI"
Tag 1487..1504
/gene="6xHis tag"
misc_binding 1782..1787
/dbxref="REBASE:ClaI"
misc_binding 1865..1870
/dbxref="REBASE:BamHI"
Rep_Origin 2094..2713
/gene="pBR322 origin"
Promoter 3366..3415
/gene="NEOKAN prom"
ORF 3504..4298
/sequence="ORF_1 rf(3)"
Marker 3507..4295
/gene="NTP_II marker"
Rep_Origin 4403..4708
/gene="f1 origin"