Lentivirus miRNA Expression

miRNA mimics are used for functionality assessments and serve as a useful exogenous tool for gain-of-function studies. abm's miRNA-expressing Lentiviruses allow for stable, long term expression of miRNAs from your cell line.

To serve all your needs, we offer miRNA lentiviruses expressing both primary miRNAs and mature miRNAs. Expression of the primary miRNA means that the entire region surrounding the miRNA will be expressed, and both arms of the precursor will be processed, just as it would be endogenously. Our mature miRNA expression vectors are specially designed for high levels of expression and processing of the mature miRNA.

Key Features

  • We offer a collection of over 6500 mature and primary miRNAs from human, mouse, and rat.
  • Lentiviral delivery for integration of genetic material into host cells, causing stable, long term gene expression.
  • Lentivirus has a broad host range and can infect both dividing and non-dividing cells, allowing gene delivery to a wide variety of cell types.

Search miRNA Library

Lentivirus miRNA Library

We offer miRNA lentiviruses expressing either primary miRNAs or mature miRNAs for human, mouse and rat, available with or without a GFP reporter.

Product Information

  • miRNA binding
    We have miRNA overexpression/mimics products and miRNA inhibitiors in synthetic, vector or virus formats to suit your experiment.
  • pLenti-III-mir-GFP, pLenti-III-mir, 	pLenti-III-mico-GFP, pLenti-III-mico vector map
    Vector Map
    Our miRNA overexpression products are available with or without GFP, and can be provided with premature miRNA inserts or mature 5p and 3p miRNA inserts.
  • Gene Regulation Product Range
    Product Range
    Our miRNA products are available in many systems and formats. Choose the best one for your workflow.

Top Publications

01 MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF.

Wen, Z et al.
Plos One 9 (9):e104666 (2014).

02 MicroRNA-146a induces immune suppression and drug-resistant colorectal cancer cells.

Tumor Biology 39(5):1-12 (2017).

03 Down-Regulation of eIF4GII by miR-520c-3p Represses Diffuse Large B Cell Lymphoma Development.

Mazan-Mamczarz, K et al.
PLoS Genet. 10(1):e1004105. (2014)

doi: 10.1371/journal.pgen.1004105


What is the Sanger miRBase Sequence Database?
miRBase is a sequence database that has been established by the Sanger Institute. Each entry in the microRNA Registry represents a predicted hairpin portion of a microRNA transcript (termed mir in the database), with information on the location and sequence of the mature microRNA sequence (termed miR). The database provides microRNA gene hunters with unique names for novel microRNA genes prior to publication of results and a searchable database of published microRNA.
When was the latest update of your array sequences?
The content of our arrays has been updated to miRBase Release 16.0.
Can I quantify mature miRNA in total RNA using your cDNA synthesis and kit and qPCR master mix?
Yes, that is what it is designed for.
Which genes are targeted by a specific miRNA?
You can search for predicted and validated miRNA target genes at http://mirbase.org/.

Just type in your miRNA name (eg. hsa-mir-145) or accession number in the search bar and look for the targeted genes.
pLenti-III-miR-Off system or LentimiRa system uses blank vector for control, but I usually use scrambled control for si-RNA experiments. Is it supported to use blank control not scrambled for miRNA experiments?
Both scrambled and blank controls are effective negative controls. However, there are debates over off-target effects when using scrambled sequences. By using a blank vector as negative control, the off-target effect can be eliminated. If your experiment requires a scrambled control over a blank control, we can custom make that for you as well upon request.
Are the inserts in our vector in a pri-miRNA format or a mature miRNA format?
Majority of our inserts are in the pri-miRNA format (about 500-600bp in size). If the miRNA is found in a cluster, the insert will then be the mature miRNA format (about 150bp in size) to ensure that the construct is only expressing one miRNA.

If the R in mir is big (miR) and the accession# is MIMA#########, then it’s typically the Mature format.
If the r in mir is small (mir) and the accession# is MI#########, then it’s typically the pre-miRNA format.
This information can also be found on the "insert type" section of this product webpage.
What primers can I use to screen LentimiRa-GFP-miRNA constructs?
For screening:
Forward primer sequence:

Reverse primer sequence: TGGAATAGCTCAGAGGCCGAGGC

407bp for the background,
407bp+500 to 600bp for the construct with insert
Are both the pre-miRNA and GFP under the same CMV promoter? If yes, is there a translational cleavage site between the two?
Yes, both the pre-miRNA and GFP are under the same CMV promoter.

There is no translational cleavage site between the two.

The transcription termination site is after the pre-miRNA, so both GFP and the pre-miRNA are transcribed together, thus making GFP an actual transcription reporter for the miRNA. The pre-miRNA region of the mRNA folds over on itself and forms a stem loop structure which will be processed in the cell by the Drosha/Pasha enzymes and cleaved from the GFP portion of the mRNA.

Browse Products

Showing 1-10 of 39961

per page
Set Descending Direction

  1. Sku: mm0664
    Price: $245.00
    Unit: 1.0 ml
    This miRNA adenovirus is part of abm’s Adenoviral Expression System and can be used directly to transiently over-express your miRNA of interest in a wide range of host cells. This adenovirus can be used to amplify more adenovirus by transducing...

  2. Sku: m008
    Price: $285.00
    Unit: 2 x 50 μl
    This ready-to-use miRNA lentivirus is part of abm’s Lentivirus Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models. This virus contains a GFP reporter for monitoring...

  3. Sku: mh12749
    Price: $215.00
    Unit: 500 ng
    This miRNA lentiviral vector is part of abm’s Lentivirus Expression System and can be packaged into virus using an appropriate packaging mix to over-express your miRNA of interest in a wide range of host cells or animal models. This construct...

  4. Sku: mh15002
    Price: $485.00
    Unit: 2 x 50 μl
    This ready-to-use miRNA lentivirus is part of abm’s Lentivirus Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models. This virus contains a GFP reporter for monitoring...

  5. Sku: mh11528
    Price: $215.00
    Unit: 500 ng
    This miRNA lentiviral vector is part of abm’s Lentivirus Expression System and can be packaged into virus using an appropriate packaging mix to over-express your miRNA of interest in a wide range of host cells or animal models. This construct...

  6. Sku: mh16528
    Price: $485.00
    Unit: 2 x 50 μl
    This ready-to-use miRNA lentivirus is part of abm’s Lentivirus Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models. This virus contains a GFP reporter for monitoring...

  7. Sku: mh15003
    Price: $485.00
    Unit: 2 x 50 μl
    This ready-to-use miRNA lentivirus is part of abm’s Lentivirus Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models. This virus contains a GFP reporter for monitoring...

  8. Sku: mh11529
    Price: $215.00
    Unit: 500 ng
    This miRNA lentiviral vector is part of abm’s Lentivirus Expression System and can be packaged into virus using an appropriate packaging mix to over-express your miRNA of interest in a wide range of host cells or animal models. This construct...

  9. Sku: mh16529
    Price: $485.00
    Unit: 2 x 50 μl
    This ready-to-use miRNA lentivirus is part of abm’s Lentivirus Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models. This virus contains a GFP reporter for monitoring...

  10. Sku: mh15001
    Price: $485.00
    Unit: 2 x 50 μl
    This ready-to-use miRNA lentivirus is part of abm’s Lentivirus Expression System and can be used directly to over-express your miRNA of interest in a wide range of host cells or animal models. This virus contains a GFP reporter for monitoring...

Showing 1-10 of 39961

per page
Set Descending Direction