RNA Sequencing (RNA-Seq)
 » 

Applied Biological Materials, Inc. is an Illumina Certified Service Provider, dedicated to ensuring the delivery of the highest-quality data available for genetic analysis applications. Click here for more details about the Illumina CSpro program.
  Offering new insights into genome organization and regulation.

Prices are in US dollars. Please contact technical@abmgood.com if you need a quotation in Canadian dollars. Prices include sample QC, library preparation and quantification, and sequencing. Custom sequencing requirements can be quoted by contacting our technical support team.
Service/Description Cat. No. Min. Samples Price*
Single-End
Total RNA Sequencing (8 million reads, 1x75bp SE) IR13008 2$375.00*
Total RNA Sequencing (20 million reads, 1x75bp SE) IR11020 2$485.00*
Total RNA Sequencing (40 million reads, 1x75bp SE) IR11040 2$655.00*
Total RNA Sequencing (80 million reads, 1x75bp SE) IR11080 2$995.00*
 
Paired-End
Total RNA Sequencing (8 million reads, 2x75bp PE) IR13007 2$445.00*
Total RNA Sequencing (20 million reads, 2x75bp PE) IR11021 2$645.00*
Total RNA Sequencing (40 Million Reads, 2x75bp PE) IR11041 2$975.00*
Total RNA Sequencing (80 Million Reads, 2x75bp PE) IR11081 2$1650.00*
 
miRNA-Seq
miRNA/Small RNA Sequencing (10 million, 1x75bp SE) IR12020 2$645.00*
 
Bioinformatics Analysis
Raw data provided in FASTQ format if none of the below services are selected.
Standard RNA-Seq Analysis
- Industry standard output in FASTQ format
- Standard exploratory bioinformatics analysis
- Read mapping
- Relative gene expression level estimation
Included
Reference Genome Import
Free Reference Genome Import for Human or Mouse - Included
Reference Genome Import (<10Mb genome) IB00001 1$50.00^
Reference Genome Import (>10Mb genome) IB00002 1$200.00^
Comparisons Between Samples or Groups
Pairwise Comparison for mRNA IB00003 1$200.00**
Pariwise Comparison for miRNA IB00005 1$600.00**
Genome Comparison
SNP Detection IB00008 1$350.00**
Novel Splice Junction Discovery IB00009 1$500.00**
Novel Isoform Discovery IB00010 1$500.00**
Functional Annotation of Differentially Expressed Genes
(GO, KEGG, OMIM, PFAM) IB00019 1$200.00*
Other bioinformatics analyses available, contact us for a quote.
 
Additional Sample Preparation Services
rRNA Depletion Treatment (human, mouse, or rat) IR16001 1$145.00*
rRNA Depletion Treatment (plant or bacteria) IR16002 1$145.00*
Total RNA Isolation for NGS IR19001 1$50.00*
 
Quality Control Service
Sample and Library QC IR18001 1$50.00*
 
Data Storage Service
Data Storage (per additional 3 months) IS10001 1$150.00
*Price per Sample
^Price per Species
**Price per Comparison
Service Details
Description of RNA-Seq Service
    RNA Sequencing (RNA-Seq) is an emerging technology that is transforming the landscape of current and future gene-expression studies. While traditional methods such as microarray and comparative genomic hybridization have been dominant over the last decade, RNA-Seq is expeditiously replacing these technologies through delivery of data that is proving to have higher sensitivity and accuracy. The RNA-seq service offered at abm produces high quality sequencing data and accurate gene expression level estimation to facilitate your next big discovery.

Key features for abm's RNA-Seq service
Sequencing Platform Illumina
Sequencing Scale 8 million reads for rapid expression analysis
40 million reads for detecting alternative splice forms
80 million reads for identifying low-abundance coding and non-coding transcripts
Higher coverage available up to 400 million reads per sample
Starting Material 0.1μg – 4μg of Total RNA
10-100ng of Poly-A enriched mRNA
10-100ng of rRNA depleted RNA
Library Type Strand-specific
Sequencing Type 75 bp single end or paired end sequencing.
Longer read lengths available upon custom request.
Bioinformatics Analyses FastQC on raw sequencing data (included)
Read alignment and estimation of gene expression (included)
Differential gene expression analysis
Functional annotation
Turn-around Time 2-4 weeks from passing sample QC plus 1-2 weeks for analysis
Data Storage 3 months

abm’s RNA-seq service overview:


Standard bioinformatics analyses:
    abm is quick to adopt the state of the art RNA-seq analysis methods that is orders of magnitude faster with higher sensitivity and specificity than current popular choices of TopHat2, Cufflinks, and Cuffdiff.


Measurements for sensitivity and specificity are calculated according to the definition laid out in (1) and implemented in Cuffcompare (2). The analysis of this graph was performed on published RNAseq data from (3). The results here show similar performance in comparison to previously published work where sensitivity and specificity ranges from 55-70 depending on the sample source (4).

Exploratory Bioinformatics Analyses
    At abm, we help our collaborators to jump start their data exploration by performing various statistical analyse including sample correlation, PCA, and differential gene expression analysis. The figures and tables are provided to quickly identify key genes or samples that will be of interest to you. Using published sample data, we show a few representative figures below.



Deliverables:
  1. Sequencing results in FASTQ format
  2. Expression level estimation table (FPKM and TPM)
  3. Differentially expressed gene table (If applicable)
  4. Functional annotation table (If applicable)
  5. QC and bioinformatics analysis report

    All of abm's sequencing services are performed by a group of specially trained and experienced scientists partaking in a streamlined workflow.
    For more information, please contact our technical support team with details of your project requirements at technical@abmgood.com.

Note:
(1) Burset M and Guigo R. Genomics 34 (3), 1996
(2) Trapnell et al., Nature Biotechnology 28 (5), 2010
(3) Adamo et al., Nature Genetics 47 (2), 2015
(4) Pertea et al., Nature Biotechnology 33 (3), 2015
RNA-Seq Sample Requirement Guidelines Click To Open
Sample Submission Form for RNA-Seq Click To Open
    Our technical support team will be happy to work on confirming the details of your NGS service. Please contact our specialists at technical@abmgood.com to get your order confirmation number. Any samples shipped to our facility without an order confirmation number in the attention line will be destroyed and disposed immediately upon receipt.
Confidentiality of RNA Sequencing Results
    All customer information is held in strict confidence. All materials and information sent to us and the products produced by us for the order are the property of the customer and will be returned to the customer or discarded in a confidential manner. We only archive customer materials when instructed to.
Project Design/Advice
    Please email us at NGS@abmgood.com for assistance with starting your RNA-Seq project or any inquiries about our next generation sequencing services. We offer discounts on bulk sample sequencing, please inquire for more details. ABM also provides an RNA purification service from original tissue samples for $50/sample. The minimum amount of RNA needed depends on the specific RNA preparation method pertinent for each project. A sample preparation guide for RNA Sequencing with ABM can be downloaded here.
Policies
    Our goal is always to deliver high-quality useful data to aid you in your research. We perform extensive maintenance and quality assurance on our equipment and strict quality control of samples throughout the sequencing process.However, next-generation sequencing by nature does not always deliver equally robust results due to a variety of factors, such as the variability inherent in the library preparation process, the biochemistry that takes place during sequencing and the quality of samples that we receive. We will make every effort to deliver the number of reads that are listed, although it is not possible to guarantee that those targets will always be achieved. The actual number of reads passing filter may vary by up to 10% from the listed target. Studies by various institutes have shown that there is minimal difference in coverage for 10% variation in reads past 5-10 million total reads.
Product Documents
Product References
FAQs
Submit a new question:
  Question:
  Email:      
Is your company certified as a service provider for Illumina sequencing?
Yes, we are a certified Illumina service provider.
What kind of analysis software do you use for sequence analysis?
The Illumina sequencers come with the integrated software that can perform the regular bioinformatics analysis functions. In addition, we have extensive experience with other open access software such as Galaxy, Adnuril, BioBike, etc. In other words, we are willing to perform additional bioinformatics analysis with different software and tools to satisfy a variety of demands from our customers.
What kind of QC methods do you adopt for the customer's sample(s)?
We will perform QC on your Total RNA samples prior to sequencing them, using the Agilent Bioanalyzer (industry standard) to determine the RNA Integrity Number (RIN). If the RIN is lower than 8, we consider these samples as having failed QC. If the samples do not pass QC, we will ask you to send us new samples. If we do not receive new samples, thereby cancelling the sequencing order, there will be a QC fee of $50/sample. This fee will be waived if you choose to continue with the sequencing order. A strict positive and negative control will be applied to this QC process.

The library QC will also be performed using the Agilent Bioanalyzer to determine library size and purity. Also, prior to loading the libraries on the sequencer, we perform qPCR quantification. The cost for this is included in the sequencing service.

For the QC of the final data from our sequencing service, the integrated software will generally do the job and provide adequate QC information, however, we can also provide additional QC data such as FASTQC upon request.

The data we output will pass our Q30 filter, which means that the error rate in base calls is less than 1 in 1000, or 0.1%. We will get a percentage at the end of the run which states the percentage of bases that have a Q score > 30, and this percentage is usually ≥85%.
What is the lead time for your WGS, WES, and RNA-Seq services?
Our sequencing lead times depend on workload, but are typically 2-4 weeks for sequencing data + 2-3 weeks for standard analysis. Please inquire for lead times for more detailed analysis.
Can you recommend any preferred RNA/DNA isolation kits to provide the best quality samples for these services?
For miRNA sequencing, you may isolate your RNA sample with a mirVana™ miRNA Isolation Kit,
mirVana™ PARIS™ Kit or PureLink® miRNA Isolation kit to enable adequate enrichment of your sample. If preferred, it should be okay to use Qiagen's kit, as long as the RNA Integrity Number (RIN) of the sample is above 8.0 to make sure there is no significant degradation. (Samples with a RIN lower than 8.0 may contain smaller degraded RNA fragments that can be sequenced in addition to the miRNAs). We prefer receiving Total RNA sample however so we can perform the bioanalyzer QC to check the RNA quality before beginning library construction. There will be no extra-charges if you submit Total RNA instead of isolated miRNA.

For miRNA sequencing we require 200ng-2ug of total RNA in 10ul of nuclease free water, as quantified with a fluorometric method. Lower amounts might result in inefficient ligation and low yield. If you are supplying purified miRNA, please submit a minimum of 50-100 ng of purified small RNA in 10ul is required. Purified small RNAs must be in nuclease free water or 10 mM Tris-HCI, pH 8.5.

For other services, there are generally no preferred DNA/RNA isolation kits as long as minimum requirements for QC are met.

Do I need any special software to view the data report files?
You will first need to unzip the fastq.gz files with winrar to view with vim, nano, gedit, Notepad plus plus. Nextgen workbench generally can view the data immediately without unzipping.

The RNASeq_sample_cufflinks_output.tar.gz will also need to be unzipped to see the text files by vim, nano, gedit, or Notepad plus plus. The unzipped data an also be imported as text into the data tab of Excel 2007. Other versions may differ.

To analyze further, Excel can sort, filter, find, match, etc and has many functions for conditional coloring, graphing, etc.
For the data, why are there no "ALT", "POS" and "ID" in your CSV file?
CSV files are meant to be used in conjunction with the raw fastq/bam files by certain commercial bioinformatics software. Many have a proprietary algorithms that takes the ALT POS and ID from the Fastq and indexes them for its own use. They are not meant to be used alone.
Would you let me know the description for the following: Genotype Sample_0, Coverage Sample_0, Coverage By Allele Sample_0, Variant Quality Sample_0, and Genotype Quality Sample_0?
Genotype (Sample Name) = nucleotide. Coverage (Sample Name) = will fail if there are insufficient reads. Coverage by allele (Sample Name) = will fail on one strand (+/-) read if only one side of the pair was sequenced. Variant Quality (Sample Name) = confidence of variant called. Genotype Quality (Sample Name) = confidence of genotype sequenced.
Concerning the column of "CHROM", would you let me know the rules of naming?
type of accession number| actual number| type of sequence| actual curated version used
Does your NGS service including RNA isolation?
We do not provide RNA isolation service by default. However we can provide this service. For more information, please refer to Cat#IR19001.
How many biological replicates do I need for each condition?
To increase confidence and reduce experimental error it is suggested that you submit at least 3 replicates per sample. Note that this is to serve as a guideline only and the final number of replicates and samples is to be determined by the end user based on their final experimental conditions.
When is it necessary to eliminate rRNA before sequencing? What advantage does it give to eliminate rRNA from my samples?
Large ribosomal RNA (rRNA) constitutes more than 90% RNA species in total RNA. Performing RNA-Seq without Poly(A) enrichment or rRNA depletion will result in most reads coming from ribosomal RNA (i.e., for 20 million reads, less than 2 million reads would be useful information). Poly(A) enrichment or rRNA depletion is necessary for any sequencing platform.
What advantages does RNA-Seq have over using Microarray?
ABM's Total RNA-Sequencing service now offers a more advanced technology platform than conventional microarray. The potential advantages of using RNA-Seq for your project have been outlined below:

1. RNA-Seq is able to sensitively carry out gene expression profiling and thus a comparison between the drug treated vs. untreated samples can be performed. This is similar to microarray, but in addition NGS offers a digital and highly accurate read out of data. RNA-Seq will allow you to obtain even more accurate quantification for all gene expression compared to microarray.

2. Microarray can only provide expression information for the genes incorporated into the chip, whereas NGS will provide a more comprehensive approach yielding additional information for novel gene variants and low-abundance transcripts.

3. The results obtained from NGS are far more reproducible and reliable than Microarray. It is not necessary to conduct qPCR after NGS, while it is a standard procedure to verify microarray results with qPCR.

Overall, this platform offers a more productive, more accurate, more reliable and more capable method to detect novel events. Choosing ABM as your NGS service provider will also offer you more competitive prices than using microarray, with our standard RNA-Seq services including the following bioinformatics and QC:

Read mapping (Tophat).
Gene expression quantification (Cufflinks /FPKM).
QC (RSeQC/FastQC).
3 months FREE storage of raw data.
What quantity of ribosomally depleted RNA you would require for RNA seq (if we perform this step for our samples before shipping).
Ideally we need a minimum of 200 ng total (10 ng/ul) after rRNA depletion.
Is library preparation included in your service costs?
Yes, library preparation is included in the RNA seq service cost. Sample enrichment prior to this step (i.e. Poly A enrichment or miRNA enrichment, depending on which type is required) is also included in the service. Alternatively, if rRNA depletion is required prior to library preparation, this will be an additional cost per sample.
In your miRNA Sequencing Service (IR12020), do you sequence mature miRNA or pri-mirnas?
After total RNA isolation with a kit that retains small RNAs, (such as the mirVana miRNA Isolation kit from Life Technologies), we perform size selection to enrich for the small RNAs before continuing with library construction. The average read length is around 20-30 bp, so only the mature miRNAs are sequenced
What format does the raw data come in?
Raw data is provided in fastq format.

All raw data are essentially big text files that, given enough computer RAM, can be viewed with a text editor, and contain information about the sequence, its ID, quality, reads and the more technical stuff like barcodes, multiplexing information, and internal control data if included. For example, a single read raw data entry (4 lines) in fastq format looks like:

+XUVBL:03110:11936
//6....(.::1
@XUVBL:08528:12845
GGCCAGCAAATTGCATGAGTTCAGGAGTGATCTCGCAACCCGTGACTTACAGCCCTTTCCCCCGTGACTATCAACTGACACACTCCCTTACTGCTGAGT
Should I choose PolyA enrichment or rRNA depletion for my RNA-seq experiment?
rRNA is very abundant in cells , so it is useful to deplete rRNA to allow for sufficient coverage of other genes.

PolyA selection is the most popular option as it is the best way to go for a simple RNAseq experiment. It will give you sufficient mRNA population and very efficiently separates mRNA from rRNA. Poly A enrichment will use Oligo dT to isolate the mRNA. Please note however that you will only get RNA-Seq information for coding mRNA transcripts, not for non-coding RNA (which requires rRNA depletion instead).

rRNA depletion will remove most of the rRNA in the sample, allowing sequencing of both mRNA and non-coding RNA. rRNA depletion is mainly used if you need non-polyA RNA transcripts and non-coding RNA populations to be sequenced. However, rRNA depleted samples typically require more reads as the rRNA removal process is not perfect and you will still pick up rRNA sequences. It is also more costly and time consuming, so if you do not require rRNA depletion, then we would recommend you go with the PolyA enrichment. The major factor in choosing between the two is whether or not you want information from non-coding RNA.

Prokaryotes like bacteria do not have PolyA tails on the transcripts, so rRNA depletion is necessary for these samples.
Do barcoded samples count as a single sample? And is barcoding included in the library prep service?
Yes, barcoding is included in the library prep service. Barcoded samples count as individual samples for sequencing, but can be sequenced together.

For example, if two units of RNA-Seq are ordered:
- Two samples, Sample A and Sample B will be processed and libraries will be constructed for each of the two.
- Sample A will have barcode 1, and Sample B will have barcode 2.
- Sample A and Sample B will be sequenced together on the same chip or flow cell.
- The data from Sample A and Sample B will be de-multiplexed and separated by the barcodes used.
Should we send samples of cells or RNA?
In general, we recommend providing RNA samples. ABM also provides an RNA purification service from original tissue samples for $50/sample if required (Cat#: IR19001).
How many reads do you suggest for plant species?
With plant species, there are many repeats and copies of a gene, so in order to differentiate different copies of a gene and perform read mapping, we suggest paired-end sequencing and more reads.

The results are based less on just read depth, as paired-end sequencing will provide longer reads and allow us to capture more useful information and map the reads back to the proper regions.
We suggest at least 60-80 million reads for this type of project.
Which library prep kits are used for RNA sequencing and miRNA sequencing?
For RNA-Seq, we use the Illumina TruSeq stranded mRNA kit. For miRNA-seq, we use NEB's NEBNext small RNA library prep kit.
Is 20 million reads, SE enough for looking at differences in gene expression levels among samples?
It depends on whether the transcripts you are looking at are rare or highly expressed. 20 Million reads will give an overall look at gene expression of normal or highly expressed genes, but 40-80 million will provide deeper sequencing and may pick up the rarer transcripts.
Is PolyA enrichment or rRNA depletion required for miRNA sequencing?
No enrichment is required for miRNA sequencing as adapters are selectively ligated directly to small RNAs only.
I tried to download the fastq file. However, the file is too large to be opened in Microsoft word, notepad etc.
Please make sure that there is enough RAM for your computer. Fastq files can be opened by text editors on windows computers with enough RAM. Linux has no issues with file size and text editing and would still be the preferred option to review the file content. Alternatively, you may consider free fastq specific readers like Nextgen Workbench.
Will you provide details of the procedures used for sample processing, library construction, and bioinformatics analyses (of the type that are needed for the 'Methods' section in journal articles)?
Please refer to the sample report (under documents section on this page) for the type information we will be providing along with the sequencing results. There is a short paragraph for the Service Summary, as well as tables and steps in the RNA sample QC, Library Construction and Cluster Generation sections.

TopHat is a fast splice junction mapper for RNA-Seq reads. It aligns RNA-Seq reads to mammalian-sized genomes using the ultra high-throughput short read aligner Bowtie, and then analyzes the mapping results to identify splice junctions between exons.

Cufflinks assembles transcripts, estimates their abundances, and tests for differential expression and regulation in RNA-Seq samples. It accepts aligned RNA-Seq reads and assembles the alignments into a parsimonious set of transcripts.

Cufflinks then estimates the relative abundances of these transcripts based on how many reads support each one, taking into account biases in library preparation protocols.
Does Cat# IB00006 apply to plants as well?
No, due to the complexity of the plant transcriptome and the number of repeats in the genomes, please refer to Cat# IB00017. We suggest sequencing more reads (i.e. 80-120 million) if this is an analysis you would like to go with.
You recommend 80 million reads / sample to detect differential expression of long non-coding RNAs. What's the percentage of reads can be matched to genome, or matched to long noncoding RNAs? Usually, what's the number of lncRNAs or differentially expressed lncRNAs can be detected? How about 40 million reads/sample?
This can be dependent on the purity of the sample and library. On average, 15 to 20% are unmatched to genome. One can often match the remainder to a well curated transcriptome of the same species, assuming there is no library contamination.
We will have 12 samples collected in different weeks. Should we do sequencing for all samples same time?
You may send samples to us in several batches. This will allow us to run QC first to check for the sample quality. If sample does not pass QC, this will give you some time to prepare new samples. We will do the sequencing when we receive all the samples, as this would allow for the best RNA quality.
Which version of the human genome and GTF file have been used in the Tophat and cufflink analysis?
We are using hg19 with the RefSeq annotations.
For miRNA sequencing, do we need to perform miRNA isolation?
There is no need to use purified miRNA as the starting material. The Illumina TruSeq Small RNA kit uses total RNA as the starting material since it uses special 3' and 5' adapters that will ligate to miRNAs specifically and not to rRNA or other transcripts.
May we send the samples as precipitated in %75 ethanol rather than RNAStable?
If you cannot ship with dry ice, we recommend using RNAstable, as we have had many clients send us their samples in RNAstable at room temperature with good RNA quality after reconstitution. RNA degradation may lead to the sequenced miRNA reads being diluted by the short degradation products.
Should we submit E.Coli cells or E.coli RNA samples? Do you have a procedure for us to follow or a kit to recommend for extraction purposes?
If you send us E. coli cells, then there will be an isolation cost of $50/sample Cat No. IR19001.
If you send us E. coli RNA (treated with DNaseI), then we can exclude Cat. No. IR19001.

We use the PureLink RNA Mini Kit from Life Technologies to isolate RNA from E. coli.
We also require the purified RNA sample to be treated with DNAse I as well to remove genomic DNA from the sample.
http://www.lifetechnologies.com/order/catalog/product/12183020
How should E.Coli cells be submitted?
If you would like to send us E.Coli cells, please send us Frozen cell pellets (dry ice shipping required). We recommend freezing down the cell pellets from 3-5ml of log phase E. coli culture. If you can split each sample into two 1.5-2ml microfuge tubes, that would be ideal.
Given that our samples are precious and we do not have a lot of sample, we would prefer not to use any on a gel. Is an image of a gel to confirm the quality of the RNA being submitted required?
We typically require customers to send a gel shot to us so that we can make sure there is no genomic DNA contamination and that there is no visible RNA degradation. This will prevent customers from sending us bad samples to begin with and save them both time and money spent on shipping costs.

If your sample is precious, you can send us the sample without the gel shot as we will be performing RNA QC on the Agilent Bioanalyzer. However, please note that we won't be able to check for genomic DNA contamination, and if the RNA is too degraded, we won't be able to continue with library construction. If we do not receive new samples, thereby cancelling the sequencing order, there will be a QC fee of $50/sample (Cat#. IR18001). This fee will be waived if you choose to continue with the sequencing order.
What kits should I use to isolate RNA from cells or tissue samples?
We prefer to use the PureLink RNA Mini Kit from Life Technologies or the Qiagen RNeasy Mini Kit to isolate Total RNA.
What are the library sample submission requirements?
Minimum requirements:
20nM concentration, 20ul.
What kits would you recommend for plant leaf RNA extractions?
For isolating total RNA from plant samples, we would recommend:
RNeasy Plant Mini Kit (QIAGEN)
MasterPure- Plant RNA Purification Kit (Epicentre)

If you are interested in doing miRNA- sequencing, then we would suggest:
MasterPure- Plant RNA Purification Kit (Epicentre)
mirVana miRNA Isolation Kit in conjunction with the Plant RNA Isolation Aid
Can we submit samples in trizol?
Yes we can receive samples in trizol but there will be an RNA Isolation fee Cat# IR19001.
For clients that deplete their own rRNA, how much do you typically receive from them?
Please submit at least 50-100ng of rRNA depleted RNA sample to us.
Can lncRNA be sequenced?
Yes, lncRNA can be sequenced when rRNA depletion is done and polyA enrichment is skipped. You would need to order an rRNA depletion service (if are not performing this step yourself) and a Total RNA sequencing service.
If I submit cells rather than total RNA for RNA-seq, how many cells should I provide for each sample?
As a general guideline, we find that one can obtain around 10-30pg of RNA per cell. For each sample, we ideally request for 6-10 μg of RNA, with the absolute minimum being 200 ng per sample. Note that a larger quantity of RNA submitted or obtained for the service correlates with improved RNA Sequencing results; thus, the more cells that are submitted for the service, the better.

For tissues samples, this would depend on a case by case basis, and is harder to define (around a single 1cm cube in most cases). The more samples that you are able to submit, the better it is.
After treating my purified RNA samples with DNase, do you recommend a step to remove the enzyme?
This will be dependent on whether you would prefer to select PolyA enrichment or rRNA depletion for your samples.

If PolyA enrichment is preferred, we have found in the past that it is not necessary to remove the enzyme prior to library prep, since the very first wash step after binding the mRNA to the oligo dT beads will wash the enzyme away.

In contrast, it would indeed be required to remove the DNase enzyme if rRNA depletion is preferred. For rRNA depletion samples, usually we would prefer for an on-column DNase I treatment, but if your RNA is already extracted then we can instead do a DNase treatment followed by an AMPure XP bead cleanup to recover the RNA. This process works similarly to a column, except it uses magnetic beads to reversibly capture the nucleic acids instead of a filter. This process does have a drawback, however, in that it does not allow for quantitative gene expression of small RNA's; i.e. RNAs less than 100 nucleotides in length would be recovered at a lower rate, thereby impacting our ability to reliably estimate their expression levels. If you are not concerned about RNA in this size range, then this approach would be suitable and can perform this for you here at ABM.