pLenti-III-mir-Off Control Vector

CAT.NOUNITPRICE
m007500 ng
$175.00

Specifications


Description

This miRNA lentiviral vector is part of abm’s Lentivirus Expression System and can be packaged into virus using an appropriate packaging mix to over-express your miRNA of interest in a wide range of host cells or animal models. This construct contains a GFP reporter for monitoring transfection efficiency.

SKUm007
Applications
  • Direct non-viral plasmid transfection for immediate expression
  • Package into Lentiviral particles for high efficiency transduction and stably integrated expression
FormatVector
FeaturesGFP Reporter
SystemLentiviral Vector
Unit quantity500 ng
ReporterGFP
Vector Map

pLenti-III-mir-Off-Blank

SerotypeN/A
Storage Condition

Store at -20°C or below upon receipt

Disclaimer

1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final.
2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final.
3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s).
4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct.
5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression.
For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones.
abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.

FAQs


Are the inserts in our vector in a pri-miRNA format or a mature miRNA format?
Majority of our inserts are in the pri-miRNA format (about 500-600bp in size). If the miRNA is found in a cluster, the insert will then be the mature miRNA format (about 150bp in size) to ensure that the construct is only expressing one miRNA. If the R in mir is big (miR) and the accession# is MIMA#########, then it’s typically the Mature format. If the r in mir is small (mir) and the accession# is MI#########, then it’s typically the pre-miRNA format. This information can also be found on the "insert type" section of this product webpage.
what primers can I use to screen LentimiRa-GFP-miRNA constructs?
For screening: Forward primer sequence: Ctcggcatggacgagctgtacaag Reverse primer sequence: TGGAATAGCTCAGAGGCCGAGGC 407bp for the background, 407bp+500 to 600bp for the construct with insert
Are both the pre-miRNA and GFP under the same CMV promoter? If yes, is there a translational cleavage site between the two?
Yes, both the pre-miRNA and GFP are under the same CMV promoter. There is no translational cleavage site between the two. The transcription termination site is after the pre-miRNA, so both GFP and the pre-miRNA are transcribed together, thus making GFP an actual transcription reporter for the miRNA. The pre-miRNA region of the mRNA folds over on itself and forms a stem loop structure which will be processed in the cell by the Drosha/Pasha enzymes and cleaved from the GFP portion of the mRNA.
It is mentioned that the regular (untouched) 293T cells are to be maintained in 500ug/ml of geneticin (G418). Is this correct? If yes, please explain.
Yes, 293T cells are resistance to Geneticin(G418), as the drug was originally used to select cells expressing the SV40 large T antigen. Just like any other stable cell line generated, the cells should be kept at lower concentration of the selection drug to keep the selection pressure. Please note, that in this case since these wildtype cells are stably transfected with puromycin resistance gene, just adding puromycin may be sufficient to keep the selection pressure for the gene of interest.
Which antibiotic do you suggest to use for the LB agar plate selection?
Bacterial selection can be carried out with LB agar containing Kanamycin.
References


13
  • Qiao, J et al. "miR-335 and miR-363 regulation of neuroblastoma tumorigenesis and metastasis" Surgery 2:226-33 (2013). PubMed: 23806264. Application: miRNA Expression.
  • Wen, Z et al. "MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF " Plos One 9 (9):e104666 (2014). DOI: 10.1371/journal.pone.0104666. PubMed: 25251394. Application: miRNA expression and inhibition.
  • Bibikova, E. "Identification of Novel Pathways in the Pathogenesis of Diamond-Blackfan Anemia" Thesis: http://digitalcommons.library.tmc.edu/utgsbs_dissertations/516/ : (2014). Application: Control Vector.
  • Hasegawa, S et al. "MicroRNA-1246 expression associated with CCNG2-mediated chemoresistance and stemness in pancreatic cancer" Br J Cancer 111 (8):1572-1580 (2014). DOI: 10.1038/bjc.2014.454. PubMed: 25117811. Application: miRNA expression.
  • Briggs, Z et al. "microRNA-9 Targets the Neuroprotective Enzyme Glutamate Oxaloacetate Transaminase" Ohio State University Knowledge Bank (Thesis) : (2016).
  • Liang, Y., Song, X., Li, Y., Su, P., Han, D., Ma, T., … Yang, Q. "circKDM4C suppresses tumor progression and attenuates doxorubicin resistance by regulating miR-548p/PBLD axis in breast cancer" Oncogene 38(42):6850–6866 (2019). DOI: 10.1038/s41388-019-0926-z.
  • Verma, M., Asakura, Y., & Asakura, A. "Inhibition of microRNA‐92a increases blood vessels and satellite cells in skeletal muscle but does not improve duchenne muscular dystrophy–related phenotype in mdx mice" Muscle & Nerve 59(5):594–602 (2019). DOI: 10.1002/mus.26433.
  • Wu., Chien-Wei., . "Downregulation of MiR-144 by Triptolide Enhanced p85α−PTEN Complex Formation Causing S Phase Arrest of Human Nasopharyngeal Carcinoma Cells" European Journal of Pharmacology 855:137-148 (2019). DOI: 10.1016/j.ejphar.2019.04.052..
  • Wu, M.-J., Chen, Y.-S., Kim, M. R., Chang, C.-C., Gampala, S., Zhang, Y., … Chang, C.-J. "Epithelial-Mesenchymal Transition Directs Stem Cell Polarity via Regulation of Mitofusin" Cell Metabolism 29(4):993–1002.e6 (2019). DOI: 10.1016/j.cmet.2018.11.004.
  • Xiang, X., Zhou, Y., Sun, H., Tan, S., Lu, Z., Huang, L., & Wang, W. "Ivabradine abrogates TNF-α-induced degradation of articular cartilage matrix" International Immunopharmacology 66:347–353 (2019). DOI: 10.1016/j.intimp.2018.11.035.
  • Zhang, Y., Zhou, J., Li, M. . "MicroRNA-184 promotes apoptosis of trophoblast cells via targeting WIG1 and induces early spontaneous abortion"  Cell Death Dis 10  223: (2019). DOI: 10.1038/s41419-019-1443-2.
  • Zhou, Y., Lei, J., Xie, Q., Wu, L., Jin, S., Guo, B., ... & Zhang, J. "Fibrinogen-like protein 2 controls sepsis catabasis by interacting with resolvin Dp5" Science Advances 5(11):eaax0629 (2019).
  • Zhu, R., Xue, X., Shen, M., Tsai, Y., Keng, P. C., Chen, Y., … Chen, Y. "NFκB and TNFα as individual key molecules associated with the cisplatin-resistance and radioresistance of lung cancer" Experimental Cell Research 374(1):181–188 (2019). DOI: 10.1016/j.yexcr.2018.11.022.