CRE-IRES-dsRED Adenovirus
Cat. No.
000841A
Unit
1.0 ml
Price
$395.00
| Cat. No. | 000841A |
| Name | CRE-IRES-dsRED Adenovirus |
| Unit | 1.0 ml |
| Description |
This adenovirus is part of abm’s Adenoviral Expression System and can be used directly to transiently over-express your gene of interest in a wide range of host cells. This adenovirus can be used to amplify more adenovirus by transducing HEK293 cells. For enhanced transduction efficiency, the use of ViralPlus (G698) at 1:100 is recommended at the time of transduction. |
| Storage Condition |
DMEM with 2.5% glycerol |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. 000841A |
Print & Download Datasheet
Search CoA here
There are no Documents for this product yet!
| Are your pPB protein expression vectors high or low copy number plasmids? | |
|
Our protein expression vectors are medium copy number plasmids and can be amplified using any standard miniprep or midi/maxi prep kits.
There is no standard protocol that fits all proteins, therefore recombinant protein expression will need to be optimized and determined experimentally.
|
| How long after transduction can the infection efficiency be observed? | |
|
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
| What are the primers to use for SV40T and SV40T tsA58 detection? | |
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
| What is the sequence of the SV40 large T antigen? | |
|
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
| When the protein is expressed from this vector, which enzyme do I need to use to remove my tag? | |
|
The enzyme required to remove the tag (if possible) will depend upon the vector backbone corresponding to your product:
1) pPB-C-His: the His tag is NOT cleavable.
2) pPB-His-GST: the His-GST tag can be cleaved using TEV protease.
3) pPB-His-MBP: the His-MBP tag can be cleaved using TEV protease.
4) pPB-N-His: the His tag can be cleaved with Thrombin.
5) pPM-C-HA: the HA tag is NOT cleavable.
6) pPM-C-His: the His tag is NOT cleavable.
7) pPM-N-D-C-HA: the N-terminal D-tag can be cleaved using TEV protease. The C-terminal HA tag is NOT cleavable.
8) pPM-N-D-C-His: the N-terminal D-tag can be cleaved using TEV protease. The C-terminal His tag is NOT cleavable.
Please see the following page for further details:
https://www.abmgood.com/Protein-Vector.html
|
| For G221 and LV620, what does the 'V12' in RasV12 mean? | |
|
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
| Where is the SV40T tsA58 gene sequence? | |
|
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
- Bayati, A et al. (2022). "Rapid macropinocytic transfer of α-synuclein to lysosomes." Cell Reports. 40(3):111102. DOI: 10.1016/j.celrep.2022.111102. Application: Organelle Labeling Lentivirus.
This product has no review yet.
Controls and Related Product: